Combinatorial selection for replicable RNA by Qβ replicase while maintaining encoded gene function
Fig 6
Model selection experiments of serS and glnS.
A 1:1 mixture of plasmids encoding wild-type gene and non-functional mutant gene was subjected to in vivo functional selection (steps [5–7] in Fig 5). The plasmid mixture before (lane B) and after (lane A) selection was directly digested with EcoRV and PstI for glnS or digested with ClaI after PCR amplification with primers, GGCGATTAAGTTGGGTAACGCCAG and CCGGCTCGTATGTTGTGTGG for SerS. Bands specific for mutant gene were indicated with arrowheads. The “M” lane indicates λ-Hind III marker.