Mou et al. investigated the association between the colorectal carcinoma (CRC) and JC Polyomavirus (JCV) [1]. JCV is a small DNA tumour virus with oncogenic potential. Several investigators detected and quantified, mainly by PCR techniques, JCV sequences in CRC [1, 2]. However, other studies reported JCV-negative data [3].
In recent experiments, set up to detect JCV footprints in CRC, we followed procedures in collecting and processing CRC specimens, which do not differ substantially from other protocols routinely used in many laboratories. CRC and colorectal normal tissue (CRN) specimens were collected in sterile saline, immediately after surgery. Then, within two hours the same biopsy was transferred in RPMI medium with penicillin-streptomycin-gentamicin, 500 U/mL, 500 µg/mL and 100 µg/mL, respectively, and transported in 30 minutes from the surgery clinic to the research laboratory. The sample was processed for DNA extraction/purification with the mixture containing phenol/chloroform/isoamyl-alcohol, followed by DNA precipitation (4). DNA from CRC and CRN was analysed by quantitative Real-Time-PCR (qRT-PCR) for JCV large T antigen (Tag) sequences and viral DNA load. Briefly, the qRT-PCR reactions were performed in duplicate, in 50 μL reaction volumes using 10 μL of DNA, 10 μL Applied Taq-Man, 0.45 μL of primers (JCF: 5’-TAGGTGGGGTAGAGTGTTGGGAT-3’ and JCR: 5’-TAATGAGAAGTGGGATGAAGAC-3’), 0.65 μL TaqMan Tag or LT probe (6-FAM - TTCTTCATGGCAAAACAGGTCTT – MGB) and 8 μL H2O. The qRT-PCR reactions were carried out using the CFX96 Touch (Bio-Rad) using the following conditions: 50 °C for 2 min, 95 °C for 10 min, by 45 cycles of 95 °C for 5 s and 60 °C for 1 min, followed by a hold at 4 °C. The raw data were analysed using the automatic cycle threshold (Ct) setting for assigning the baseline and the threshold for Ct determination. The samples with a Ct value >37 were excluded from the comparison (5). Following this procedure JCV sequences were detected in the 70% (28/40) of CRC DNA, while the viral DNA load was in the range of 10-2 copy/cell. None of the normal sample tested JCV-positive. In a second step, additional DNA from 20 CRC and 20 CRN biopsies was extracted and qRT-PCR analysed. None of these specimens was JCV-positive. In brief, we found out that one of the operators did not follow the procedure for the tissue processing described above. Indeed CRC specimens were left at room temperature on the bench for several hours. Very likely, these biopsies, unprocessed for many hours, encountered the degradation of the viral DNA by endogenous cellular nucleases. It is worth recall that JCV DNA is usually present inside the nucleus of the cell in the episomal form, with a low copy number. Considering the negative data published by different investigators, it is possible that the technical flaw described herein may occurred in other laboratories. Our report may contribute to elucidate the conflicting data published on the association between CRC and JCV, and it may stimulate further studies with the aim to verify the role of JCV in the CRC onset/progression.

Mauro Tognon*^, Silvia Pietrobon*, Andrea Puozzo*, Ilaria Bononi*, Carlo Feo**, Roberta Gafà***, Fernanda Martini*.
Department of Morphology, Surgery and Experimental Medicine, Sections of *Pathology, Oncology and Experimental Biology, **Surgery Clinic, School of Medicine, University of Ferrara and ***Pathological Anatomy Unit, University Hospital of Ferrara, Ferrara. Italy.
________________________________________________________________________________

References:
1. Mou X, Chen L, Liu F, Lin J, Diao P, Wang H, et al. Prevalence of JC virus in Chinese
patients with colorectal cancer. PLoS One. 2012;7:e35900.
2. Collins D, Hogan AM, Winter DC. Microbial and viral pathogens in colorectal cancer.
Lancet Oncol. 2011;12:504-12.
3. Newcomb PA, Bush AC, Stoner GL, Lampe JW, Potter JD, Bigler J. No evidence of an
association of JC virus and colon neoplasia. Cancer Epidemiol Biomarkers Prev.
2004;13:662-6.
4. Pancaldi C, Corazzari V, Maniero S, Mazzoni E, Comar M, Martini F, et al. Merkel cell
polyomavirus DNA sequences in the buffy coats of healthy blood donors. Blood.
2011;117:7099-101.
5. Comar M, Zanotta N, Croci E, Murru I, Marci R, Pancaldi C, et al. Association between the
JC polyomavirus infection and male infertility. PLoS One. 2012;7:e42880.

This work was supported by the grant FAR 2012, University of Ferrara.

Author contributions: S.P., A.P, I.B. performed the experiments; C.F. selected the clinical cases and did the surgery, R.G. carried out the histopathology examinations; M.T., S.P., A.P., I.B., C.F., R.G., F.M. analyzed the experimental data; M.T. and F.M. conceived and designed the experiments; M.T. wrote the paper.
The authors declare no conflict of interest.
^E-mail: mauro.tognon@unife.it