Reader Comments
Post a new comment on this article
Post Your Discussion Comment
Please follow our guidelines for comments and review our competing interests policy. Comments that do not conform to our guidelines will be promptly removed and the user account disabled. The following must be avoided:
- Remarks that could be interpreted as allegations of misconduct
- Unsupported assertions or statements
- Inflammatory or insulting language
Thank You!
Thank you for taking the time to flag this posting; we review flagged postings on a regular basis.
closeIssues with the PCR amplifications for ovine KRTAP11-1 and KRTAP3-3
Posted by Z197 on 26 Apr 2016 at 23:10 GMT
The KRTAP11-1 PCR primers described in this study are expected to amplify a 127 bp fragment as shown in Table S1. However, the result obtained (Figure 1A) suggests that the PCR product is about 200 bp. What are the possible causes of this inconsistency?
Regarding KRTAP3-3, there are several nucleotide differences between the reverse PCR primer designed based on the bovine sequence and ovine cDNA sequence, which may affect the qPCR for KRTAP3-3. Why the authors used this reverse primer for qPCR?
RE: Issues with the PCR amplifications for ovine KRTAP11-1 and KRTAP3-3
MeiYu replied to Z197 on 03 May 2016 at 03:10 GMT
1. In order to confirm that the sheep KRTAP11-1 gene is expressed in a tissue- specific manner, we have designed two different KRTAP11-1 PCR primers. The first primer pair produces a 127-bp band and the primer sequences were posted in Table S1. The second primer pair produces a 200-bp band which was shown in Figure 1A. The sequences of the second primer pair that were not shown in Table S1 are (5′-3′) : TGC CTG AGT GAC TTC ATT GCT(Forward) and ACATGCCAAAACCCTTAGAGAC (Reverse). In S1 Appendix , we posted the cDNA sequence of the sheep KRTAP11-1 gene in which you can find the binding sequences of the two primers. The PCR amplifications with both the two primers indicated that the sheep KRTAP11-1 gene is expressed in a tissue- specific manner.
2. In this study, the sheep genes that are expressed in a tissue- specific manner were isolated several years ago. At that time, sequences of some ovine genes we investigated were available in database, so we designed the primers based on the conserved regions between ovine and bovine sequences. However, the ovine sequences of other genes we investigated including KRTAP3-3 gene were not available in database. In this case, we designed the primers for those genes based on the bovine sequences. The KRTAP3-3 primers we designed for PCR and qPCR have a reasonable efficiency without producing any non- specific band. In addition, the ovine cDNA sequence of KRTAP3-3 gene posted in S1 Appendix was obtained after we confirmed the tissue-specific expression pattern of the KRTAP3-3 gene.
RE: RE: Issues with the PCR amplifications for ovine KRTAP11-1 and KRTAP3-3
Z197 replied to MeiYu on 03 May 2016 at 04:35 GMT
Thank you for providing this additional information.