The Fastq sequence at the top of page 7 (PDF) has been line-wrapped. It should be in a font small enough to fit within the column (even cropping it to fit if required, but preferably by adjusting font size) and with the new lines as seen in the example below:

@SRR062634.2724179 HWI-EAS110_103327062:6:13:11133:13696/1
TGGAATCAGATGGAATCATCGAATGGACTGGAATGGAATCATTGAATGGACTCGAAAGG
+
GGGFGGFDGGGGGGFGFGGGGGGGGGGGGGGEFGGGGFGEDGGGFGGGFEDFGCDFDG?
@SRR062634.2724180 HWI-EAS110_103327062:6:13:11133:11572/1
ATATAGTCCATTGTACTCCCTTGCTTAAATCTGGATCCCTGCAAATAAAAACATCTTCC
+
GGGGGGGGFGGGGEGGFGGGEGGFDGEAEGGEEEEBEEEEEEEEEEEEEEEEEEECCCC

(The above should be 8 lines of text with "+" being the sole character on 2 of them. I have no idea if the correction posting system is going to line-wrap for me.)