Studies on the Assembly Characteristics of Large Subunit Ribosomal Proteins in S. cerevisae

Uli Ohmayer; Michael Gamalinda; Martina Sauert; Julius Ossowski; Gisela Pöll; Jan Linnemann; Thomas Hierlmeier; Jorge Perez-Fernandez; Beril Kumcuoglu; Isabelle Leger-Silvestre; Marlène Faubladier; Joachim Griesenbeck; John Woolford; Herbert Tschochner; Philipp Milkereit

doi:10.1371/journal.pone.0068412

Loading metrics

Open Access

Peer-reviewed

Research Article

Studies on the Assembly Characteristics of Large Subunit Ribosomal Proteins in S. cerevisae

Uli Ohmayer,

Affiliation Lehrstuhl für Biochemie III, Universität Regensburg, Regensburg, Germany
⨯
Michael Gamalinda,

Affiliation Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, Pennsylvania, United States of America
⨯
Martina Sauert,

Current address: Max F. Perutz Laboratories, Vienna, Austria

Affiliation Lehrstuhl für Biochemie III, Universität Regensburg, Regensburg, Germany
⨯
Julius Ossowski,

Affiliation Lehrstuhl für Biochemie III, Universität Regensburg, Regensburg, Germany
⨯
Gisela Pöll,

Affiliation Lehrstuhl für Biochemie III, Universität Regensburg, Regensburg, Germany
⨯
Jan Linnemann,

Affiliation Lehrstuhl für Biochemie III, Universität Regensburg, Regensburg, Germany
⨯
Thomas Hierlmeier,

Affiliation Lehrstuhl für Biochemie III, Universität Regensburg, Regensburg, Germany
⨯
Jorge Perez-Fernandez,

Affiliation Lehrstuhl für Biochemie III, Universität Regensburg, Regensburg, Germany
⨯
Beril Kumcuoglu,

Affiliation Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, Pennsylvania, United States of America
⨯
Isabelle Leger-Silvestre,

Affiliation Laboratoire de Biologie Moléculaire Eucaryote, UMR 5099, Universite Paul Sabatier, Toulouse, France
⨯
Marlène Faubladier,

Affiliation Laboratoire de Biologie Moléculaire Eucaryote, UMR 5099, Universite Paul Sabatier, Toulouse, France
⨯
Joachim Griesenbeck,

Affiliation Lehrstuhl für Biochemie III, Universität Regensburg, Regensburg, Germany
⨯
John Woolford ,

* E-mail: jw17@andrew.cmu.edu (JW); herbert.tschochner@vkl.uni-regensburg.de (HT); philipp.milkereit@vkl.uni-regensburg.de (PM)

Affiliation Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, Pennsylvania, United States of America
⨯
Herbert Tschochner ,

* E-mail: jw17@andrew.cmu.edu (JW); herbert.tschochner@vkl.uni-regensburg.de (HT); philipp.milkereit@vkl.uni-regensburg.de (PM)

Affiliation Lehrstuhl für Biochemie III, Universität Regensburg, Regensburg, Germany
⨯
Philipp Milkereit

* E-mail: jw17@andrew.cmu.edu (JW); herbert.tschochner@vkl.uni-regensburg.de (HT); philipp.milkereit@vkl.uni-regensburg.de (PM)

Affiliation Lehrstuhl für Biochemie III, Universität Regensburg, Regensburg, Germany
⨯

Studies on the Assembly Characteristics of Large Subunit Ribosomal Proteins in S. cerevisae

Uli Ohmayer,
Michael Gamalinda,
Martina Sauert,
Julius Ossowski,
Gisela Pöll,
Jan Linnemann,
Thomas Hierlmeier,
Jorge Perez-Fernandez,
Beril Kumcuoglu,
Isabelle Leger-Silvestre

Published: July 10, 2013
https://doi.org/10.1371/journal.pone.0068412

Reader Comments

Post a new comment on this article

Correction: Sequence of oligo O2160

Posted by pmilkereit on 01 Jul 2015 at 16:02 GMT

I just realized that the sequence of Oligo O2160, which is listed in Figure S4, is not correct. The correct sequence of Oligo O2160 used in this study is: TCATATTTTTTTTAAAGTACATGCAAAAGAAAGAATAAGAAGTAGAGAAATACGACTCACTATAGGG.
Sorry for any inconveniance which might have been caused by this error!
Philipp Milkereit

No competing interests declared.

Subject Areas
?

For more information about PLOS Subject Areas, click here.
We want your feedback. Do these Subject Areas make sense for this article? Click the target next to the incorrect Subject Area and let us know. Thanks for your help!

Ribosomal RNA
Is the Subject Area "Ribosomal RNA" applicable to this article?

Thanks for your feedback.
Yeast
Is the Subject Area "Yeast" applicable to this article?

Thanks for your feedback.
Biosynthesis
Is the Subject Area "Biosynthesis" applicable to this article?

Thanks for your feedback.
Ribosomes
Is the Subject Area "Ribosomes" applicable to this article?

Thanks for your feedback.
Northern blot
Is the Subject Area "Northern blot" applicable to this article?

Thanks for your feedback.
Eukaryota
Is the Subject Area "Eukaryota" applicable to this article?

Thanks for your feedback.
Affinity purification
Is the Subject Area "Affinity purification" applicable to this article?

Thanks for your feedback.
Precursor cells
Is the Subject Area "Precursor cells" applicable to this article?

Thanks for your feedback.

Studies on the Assembly Characteristics of Large Subunit Ribosomal Proteins in S. cerevisae

Studies on the Assembly Characteristics of Large Subunit Ribosomal Proteins in S. cerevisae

Reader Comments

Post Your Discussion Comment

Why should this posting be reviewed?

Thank You!

Correction: Sequence of oligo O2160

Posted by pmilkereit on 01 Jul 2015 at 16:02 GMT