Foxp3⁺ Treg cells up-regulate IL-4Rα expression after Sm infection

IL-4Rα-mediated signaling and associated factors critically mediating the function of Th2 cells were recently shown to play an important role in controlling Foxp3⁺ Treg cell function [10,12,14,15,18–20]. However, whether IL-4Rα-mediated signaling on Foxp3⁺ Treg cells promotes [10,19] or inhibits [14,15,18] their suppressive function(s) remains unclear. To address this, we examined the surface protein expression pattern of IL-4Rα on Foxp3⁺ Treg cells in spleen and mesenteric lymph nodes (MLNs) of naïve and 8-wk-Sm-infected BALB/c mice. CD4⁺ Foxp3⁺ Treg cells expressed IL-4Rα under a steady state and up-regulated their expression upon Sm infection (Fig 1A–1C). These results suggest that IL-4Rα-mediated signaling might be important for Foxp3⁺ Treg cells to function under steady-state and inflammatory conditions.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Foxp3⁺ Treg cells up-regulate IL-4Rα expression upon infection.

(A) Gating strategy for identifying Foxp3⁺ Treg cell population. (B) Representative histograms of IL-4Rα expression by Foxp3⁺ Treg cells in spleen and MLNs of IL-4Rα^−/− (gray tinted), naïve (solid line), and Sm-infected (dashed line) IL-4Rα^−/lox mice with the mean of Δ GMFI IL-4Rα (GMFI IL-4Rα^−/lox − GMFI IL-4Rα^−/−) ± S.E.M summarized in (C). Data are from two independent experiments. n = 6–8 mice/group. * P < 0.05, ** P < 0.001, *** P < 0.0001 by two-tailed unpaired Student t test. Underlying data can be found in S1 Data. CD3, cluster of differentiation 3; CD4, cluster of differentiation 4; Foxp3, forkhead box P3; FSC-A, forward scatter A; FSC-H, forward scatter H; GMFI, geometric mean fluorescence intensity; IL-4Rα, interleukin-4 receptor alpha; MLN, mesenteric lymph node; Sm, S. mansoni; SSC-A, side scatter A; Treg, regulatory T.

https://doi.org/10.1371/journal.pbio.2005850.g001

Generation and characterization of Foxp3^cre IL-4Rα^−/lox BALB/c mice

To better dissect the role of IL-4Rα-mediated signaling on Foxp3⁺ Treg cells, we generated a murine model, termed Foxp3^cre IL-4Rα^−/lox, with a specific cyclic recombinase (Cre)-mediated deletion of the il-4rα gene in Foxp3-expressing cells. Foxp3^cre IL-4Rα^−/lox mice were generated by intercrossing BALB/c mice expressing Cre under control of foxp3 gene promoter [21] with global knock-out (IL-4Rα^−/−) BALB/c mice [22] for two generations to generate Foxp3^cre IL-4Rα^−/− BALB/c mice (Figs 2A and S1). These mice were further intercrossed with homozygous floxed IL-4Rα (IL-4Rα^lox/lox) BALB/c mice (exon 7 to 9 flanked by LoxP sites; Fig 2B) [23] to generate a Foxp3-specific IL-4Rα-deficient mouse BALB/c strain (Foxp3^cre IL-4Rα^−/lox BALB/c mice; Figs 2A and S1). Foxp3^cre IL-4Rα^−/lox mice were identified by PCR genotyping (Fig 2C). The cellular specificity of Cre-mediated IL-4Rα deletion was assessed at the genomic level by performing quantitative real-time PCR (qPCR). Genomic DNA was extracted from cluster of differentiation 19 (CD19)⁺, CD4⁺ Foxp3⁻, and CD4⁺ Foxp3⁺ sorted cells from pooled spleen and MLN cells of naïve Foxp3^cre IL-4Rα^−/lox, their littermate control (IL-4Rα^−/lox), and global knock-out (IL-4Rα^−/−) mice (Fig 2D); and il-4rα exon 8 (absent in IL-4Rα-deficient cells) was quantified by qPCR and normalized to il-4rα exon 5 (present in all cells). As expected, only CD4⁺ Foxp3⁺ T cells, but not CD19⁺ or CD4⁺ Foxp3⁻ cells, from Foxp3^cre IL-4Rα^−/lox mice had a lower exon8:exon5 ratio when compared to their littermate controls (Fig 2E). Genotypic deletion of il-4rα within CD4⁺ Foxp3⁺ Treg cells in Foxp3^cre IL-4Rα^−/lox mice was further confirmed at the protein level by flow cytometry analyses of IL-4Rα surface expression on spleen and MLN cells of naïve mice. In both organs, IL-4Rα was deleted specifically within CD4⁺ Foxp3⁺ Treg cell population in Foxp3^cre IL-4Rα^−/lox male and female mice (Fig 2F and 2G). il-4rα gene deletion within the CD4⁺ Foxp3⁺ Treg cell population was more efficient in males (efficiency of deletion [Ed] = 90.48% ± 5.45%, Fig 2H and 2I) when compared to females (Ed = 39.74% ± 5.776%, Fig 2H and 2I), enabling via the present model an assessment of the effect of partial (female) versus quasi-complete (male) impairment of IL-4Rα-mediated signaling on CD4⁺ Foxp3⁺ Treg cell in Foxp3^cre IL-4Rα^−/lox mice.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Generation and characterization of Foxp3^Cre−/+ IL-4Rα^−/lox mice.

(A) Mouse breeding strategy. IL-4Rα^−/− BALB/c mice were intercrossed for two generations with transgenic BALB/c mice expressing Cre-recombinase under control of foxp3 gene promoter and IL-4Rα^lox/lox mice to generate Foxp3Cre^−/+ IL-4Rα^−/lox BALB/c mice. (B) Schematic diagram showing the structure of il4ra gene loci in IL-4Rα^−/lox and Foxp3^cre IL-4Rα^−/lox mice. (C) Genotyping of Foxp3Cre^−/+ IL-4Rα^−/lox mice. The Cre specific amplicon is 368 bp, loxP is 450 bp (floxed) or 356 bp (wild type), the wild-type IL4-Rα amplicon is 600 bp, and the deleted IL-4Rα amplicon is 471 bp. (D) Representative flow cytometric analysis of the CD19⁺, CD4⁺ Foxp3⁻, and CD4⁺ Foxp3⁺ cell populations before and after FACS sorting of pooled cells from spleen and MLN of naïve IL-4Rα^−/lox, Foxp3^cre IL-4Rα^−/lox, and IL-4Rα^−/− mice. (E) Efficiency of IL-4Rα deletion by qPCR. Genomic DNA was extracted from sorted CD19⁺ B cells, CD4⁺ Foxp3⁻, and CD4⁺ Foxp3⁺ T cell, and il4ra exon 8 (deleted in IL-4Rα deficient cells) was quantified by qPCR and normalized to the quantity of exon 5 (present in all cells). (F) Flow cytometry analysis of IL-4Rα expression by CD19⁺ B cells, CD4⁺ Foxp3⁻, and CD4⁺ Foxp3⁺ T cell from the spleen of naïve mice. (G) Flow cytometry analysis of IL-4Rα expression by CD19⁺ B cells, CD4⁺ Foxp3⁻, and CD4⁺ Foxp3⁺ T cell from the MLNs of naïve mice. (H) Formula for calculating the Ed of il4ra gene. (I) Efficiency of IL-4Rα deletion on CD4⁺ Foxp3⁺ T cells in the MLNs of naïve male and female Foxp3^cre IL-4Rα^−/lox mice. (J) Representative histograms of IL-4Rα expression before (gray tinted) and after recombinant IL-4 (black solid line) stimulation. Cells pooled from spleen and MLNs from naïve IL-4Rα^−/lox and Foxp3^cre IL-4Rα^−/lox mice were cultured for 40 hr in 0 or 1 ng/ml of rIL-4. (K) Flow cytometry analysis of IL-4Rα GMFI up-regulation from (J). Results are representative of three independent experiments with 6–8 mice/group. Data are expressed as mean ± S.E.M. NS, P > 0.05; * P < 0.05, ** P < 0.001, *** P < 0.0001 by two-tailed unpaired Student t test and one-way ANOVA with Bonferroni posttest analysis. Underlying data can be found in S1 Data. CD3, cluster of differentiation 3; CD4, cluster of differentiation 4; CD19, cluster of differentiation 19; Cre, cyclic recombinase; Ed, efficiency of deletion; FACS, fluorescence-activated cell sorting; Foxp3, forkhead box P3; GMFI, geometric mean fluorescence intensity; IL-4Rα, interleukin-4 receptor alpha; loxP, locus of X-over P1; MLN, mesenteric lymph node; NS, not significant; qPCR, quantitative real-time PCR; rIL-4, recombinant interleukin-4.

https://doi.org/10.1371/journal.pbio.2005850.g002

To assess the functional impairment of IL-4Rα-mediated signaling on CD4⁺ Foxp3⁺ Treg cells in our newly generated model, pooled spleen and MLN cells of naïve male and female Foxp3^cre IL-4Rα^−/lox mice and their littermate controls were cultured with or without recombinant IL-4 (rIL-4) for 40 hr and/or 1 hr, and then, levels of IL-4Rα surface expression and signal transducer and activator of transcription 6 (STAT6) phosphorylation were measured by flow cytometry, respectively. CD19⁺ B cells and CD4⁺ Foxp3⁻ T cells from Foxp3^cre IL-4Rα^−/lox mice and their littermate control had a comparable level of IL-4Rα expression, as determined by IL-4Rα geometric mean fluorescence intensity (GMFI), after the addition of rIL-4 (Fig 2J and 2K). In agreement, no major differences in the level of phosphorylated STAT6 (p-STAT6) either at baseline (S2A and S2B Fig) or after rIL-4 stimulation (S2A Fig and S2C–1E) in both populations (CD19⁺ B cells and CD4⁺ Foxp3⁻ T cells) were noted between Foxp3^cre IL-4Rα^−/lox mice and their littermate controls. In contrast, a proportion of rIL-4-stimulated CD4⁺ Foxp3⁺ Treg cells derived from Foxp3^cre IL-4Rα^−/lox mice were significantly impaired in their ability to up-regulate IL-4Rα expression compared to CD4⁺ Foxp3⁺ Treg cells derived from their littermate control (Fig 2J and 2K). In support, STAT6 phosphorylation upon rIL-4 stimulation in CD4⁺ Foxp3⁺ Treg cells in IL-4Rα^−/lox mice was significantly higher compared to Foxp3^cre IL-4Rα^−/lox mice (S2A and S2C Fig), indicating that the IL-4Rα signaling pathway on CD4⁺ Foxp3⁺ Treg cells is impaired in our Foxp3^cre IL-4Rα^−/lox mice. Of interest, we noted that at baseline, male mice do have a higher level of p-STAT6 when compared to female mice (S2B Fig). In our Foxp3^cre IL-4Rα^−/lox mice, even though the increase in STAT6 phosphorylation upon rIL-4 stimulation in Foxp3⁺ Treg cell compartment was higher in female mice than males (S2D and S2E Fig) because of the differential deletion of il4ra gene on Foxp3⁺ Treg cells, the initial higher level of p-STAT6 noticed in male mice brought the absolute final level of p-STAT6 in male and female mice to a comparable level (S2C Fig).

Collectively, these results reveal that IL-4Rα is specifically deleted on CD4⁺ Foxp3⁺ Treg cells in Foxp3^cre IL-4Rα^−/lox mice either partially (approximately 40% in females) or quasi-completely (approximately 90% in males), resulting—in both cases—in a significant impairment of IL-4Rα-mediated signaling in the Foxp3⁺ Treg cell population.

Impairment of IL-4Rα within Foxp3⁺ Treg cells neither alters Foxp3⁺ Treg cell compartment nor breaks tolerance under a steady state

Equipped with the aforementioned murine model, we first interrogated the need for Foxp3⁺ Treg cells to express IL-4Rα expression under a steady state in vivo. Naïve Foxp3^cre IL-4Rα^−/lox mice and littermate control, IL-4Rα^−/lox mice, were examined for alteration of Foxp3⁺ Treg cell compartments, overall tissue pathologies, and tissue cellularities. Foxp3^cre IL-4Rα^−/lox mice had similar tissue frequencies of CD4⁺ Foxp3⁺ Treg cells among cluster of differentiation 3 (CD3)⁺ T cells when compared to their littermate control (Figs 3A and 3B and S3A). No aberrant changes in body weight (Figs 3C and S3B), vital organs’ weight (Figs 3D and S3C), or organs’ cellularities (Figs 3E and S3D) were noted. Foxp3^cre IL-4Rα^−/lox mice also displayed normal lymphocyte compartments in their primary lymphoid organ (thymus), secondary lymphoid organs (spleen and MLN), and peripheral tissues (lung and liver) (Fig 3F–3K and S3E–2I). Together, our findings suggest that no major physical alterations are consequent to the impairment of IL-4Rα-mediated signaling within the Foxp3⁺ T-cell compartment in our Foxp3^cre IL-4Rα^−/lox mouse model under a steady state.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Deletion of IL-4Rα on Foxp3⁺ Treg cells does not break immune tolerance under a steady state.

(A) Representative flow cytometry analysis of CD4⁺ Foxp3⁺ cells among CD3⁺ cells from spleen, lung, MLN, and thymus of naïve IL-4Rα^−/lox and Foxp3^cre IL-4Rα^−/lox mice. (B) Frequency of CD4⁺ Foxp3⁺ T cells from (A). (C) Body weight of naïve IL-4Rα^−/lox and Foxp3^cre IL-4Rα^−/lox mice. (D) Organ weights of naïve mice. (E) Total cell number of spleen, liver, lung, MLN, and thymus of naïve mice. (F) Frequency of CD3⁺, (G) CD3⁺ CD8⁺, and (H) CD3⁺ CD4⁺ T cells from organs of mice as in (E). (I) Frequency of CD19⁺ B cells in spleen, lung, and MLN of naïve mice. (J) Frequency of double-positive and (K) double-negative T cells in the thymus of naïve mice. (L) Serum analysis of naïve mice. (M) Analysis of liver function in naïve mice. (N) Gating strategy for identifying cytokine-producing CD4⁺ T cells. (O) Frequency of IFN-γ, IL-4, IL-10, and IL-13-expressing CD4⁺ T cells. MLN cells from naïve mice were restimulated with PMA/Ionomycin in the presence of monensin, after which CD4⁺ T cells stained intracellularly for indicated cytokines. Results are representative of two independent experiments with 7–9 mice/group. Data are expressed as mean ± S.E.M. NS, P > 0.05; * P < 0.05, ** P < 0.001, *** P < 0.0001 by two-tailed unpaired Student t test. Underlying data can be found in S1 Data. AST, aspartate aminotransferase; CD3, cluster of differentiation 3; CD4, cluster of differentiation 4; CD8, cluster of differentiation 8; CD19, cluster of differentiation 19; FMO, fluorescence minus one; Foxp3, forkhead box P3; FSC, forward scatter; IFN-γ, interferon gamma; IgE, immunoglobulin E; IL-4, interleukin-4; IL-10, interleukin-10; IL-13, interleukin-13; IL-4Rα, interleukin-4 receptor alpha; MLN, mesenteric lymph node; ND, not detectable; NS, not significant; PMA, phorbol myristate acetate; SSC-A, side scatter A; TNF-α, tumor necrosis factor alpha; Treg, regulatory T.

https://doi.org/10.1371/journal.pbio.2005850.g003

Mice with a Treg cell–specific deletion of GATA3, a transcription factor closely associated with IL-4Rα-mediated signaling [24], have been shown to develop a spontaneous inflammatory disorder with an increased release of inflammatory soluble mediators [25]. To address whether the deletion of IL-4Rα within Foxp3⁺ Treg cells would also instruct a spontaneous and perhaps more subtle inflammatory response in Foxp3^cre IL-4Rα^−/lox mice, serum levels of soluble inflammatory mediators and liver enzymes and cytokine production by CD4⁺ T cells were determined. Serum levels of IL-4, tumor necrosis factor alpha (TNF-α), immunoglobulin E (IgE; Figs 3L and S3J), and aspartate aminotransferase (AST) (Figs 3M and S3K) in Foxp3^cre IL-4Rα^−/lox mice were similar to those of littermate controls. All CD4⁺ T cell–derived cytokines tested were also similar between Foxp3^cre IL-4Rα^−/lox mice and littermate controls (Figs 3N and 3O and S3L). Collectively, these results show that in vivo under a steady state, impairment of IL-4Rα-mediated signaling within the Foxp3⁺ T-cell compartment neither alters Foxp3⁺ Treg cell compartments nor results in spontaneous inflammatory disorder in Foxp3^cre IL-4Rα^−/lox mice.

To further address the molecular basis of Foxp3⁺ Treg cells’ need to express IL-4Rα signaling, we assessed the in vitro Foxp3 Treg conversion and expansion capacity of CD4⁺ CD25⁻/CD4⁺ CD25⁺ cells from Foxp3^cre IL-4Rα^−/lox mice, respectively, in comparison with CD4⁺ CD25⁻/CD4⁺ CD25⁺ cells from IL-4Rα^−/lox littermate controls. CD4⁺ CD25⁻ T cells were sorted with 99.8% purity (S4A Fig) from naïve Foxp3^cre IL-4Rα^−/lox mice and their IL-4Rα^−/lox littermate controls. Sorted cells were cultured in the presence of transforming growth factor beta 1 (TGF-β1) in combination with T-cell receptor stimulation using anti-CD3 and anti-CD28 for 72 hr (S4B and S4C Fig), which are known to induce conversion from CD25-negative to CD25-positive CD4⁺ T cells [26]. In our cultures, CD4⁺ CD25⁻ T cells converted to CD4⁺ CD25⁺ Foxp3⁺ T cells (induced Treg [iTreg] cells), with the highest rate of conversion recorded from CD4⁺ CD25⁻ T-cell cultures derived from Foxp3^cre IL-4Rα^−/lox mice (S4B and S4C Fig). This suggests that IL-4Rα signaling on CD4⁺ CD25⁻ T cells might interfere with their ability to convert but is clearly not needed to promote their differentiation into Foxp3⁺ Treg cell in vitro.

Next, we measured the effect of IL-4 stimulation on Treg cells. To do so, CD4⁺ CD25⁺ T cells, sorted from naïve Foxp3^cre IL-4Rα^−/lox mice and their littermate control (S4A Fig), were cultured in the presence or absence of rIL-4 for 18 or 36 hr. Whereas IL-4 treatment enhanced the survival of CD4⁺ CD25⁺ T cells from control mice, the survival of CD4⁺ CD25⁺ T cells from Foxp3^cre IL-4Rα^−/lox mice remained unaltered following treatment with rIL-4 (S4D Fig). These results suggest that IL-4/IL-4Rα signaling promotes CD25⁺ Treg cell survival in vitro and that this process is abrogated in CD25⁺ Treg cells from Foxp3^cre IL-4Rα^−/lox mice. Furthermore, CD4⁺ CD25⁺ Treg cells derived from IL-4Rα^−/lox mice considerably expanded Foxp3⁺ Treg cells’ frequency (S4E Fig) and expression level (S4F and S4G Fig) in response to in vitro stimulation with rIL-4, whereas CD4⁺ CD25⁺ Treg cells from Foxp3^cre IL-4Rα^−/lox mice failed to do so. Taken together, these data indicate that even though IL-4Rα-mediated signaling negatively influences the ability of naive CD4⁺ CD25⁻ Foxp3⁻ T cells to convert into Foxp3⁺ Treg cells, this receptor, later on, promotes the survival and enhances the Foxp3 expression of CD4⁺ CD25⁺ Treg cells in vitro.

Intact IL-4Rα-mediated signaling on Foxp3⁺ Treg cell is required for the regulation of exacerbated immune responses

The strategy of probing subtle immune impairments, nonapparent during a steady state, under more inflammatory settings has previously proven to be efficient in unveiling hidden immune defects [5,27]. Moreover, the aforementioned enhancement of survival and Foxp3 expression of CD4⁺ CD25⁺ Treg cells upon induction of IL-4/IL-4Rα-mediated signaling in vitro and the striking higher expression of IL-4Rα by Foxp3⁺ Treg cells observed during infection warranted us to further address the possible higher need for this receptor by Foxp3⁺ Treg cells, in vivo, during inflammatory disease conditions. To do so, IL-4Rα^−/lox, Foxp3^cre IL-4Rα^−/lox, and IL-4Rα^−/− mice were infected with Sm cercariae and euthanized 8 wk thereafter. Deletion of il-4rα within the Foxp3⁺ Treg cell population was confirmed at the genomic level by qPCR (Fig 4A) and at the protein level by flow cytometry (Figs 4B, S5A and S5B), at which specific deletion of IL-4Rα on Foxp3⁺ Treg cells (more efficient in males, when compared to females), but not on CD19⁺ B cells, was observed. Flow cytometry analysis of Foxp3⁺ Treg cells within the Sm-diseased livers showed significant reduction of Foxp3⁺ Treg cell infiltration into the liver of Sm-infected Foxp3^cre IL-4Rα^−/lox when compared to their littermate controls (Figs 4C, 4D and S5C). Furthermore, we noted that Foxp3⁺ Treg cells in the liver of Sm-infected Foxp3^cre IL-4Rα^−/lox mice had a significant reduction in the expression levels of Foxp3 (Figs 4E and S5D). This suggests that IL-4Rα signaling seems to be necessary for the Foxp3⁺ Treg cell in order to maintain or up-regulate its expression of the suppressive marker Foxp3 in vivo during inflammation. Deletion of IL-4Rα signaling on Foxp3^cre IL-4Rα^−/lox mice resulted in elevated cytokine production, including Type 1 (IFN-γ), Type 17 (interleukin-17 [IL-17]), and Type 2 (IL-4, interleukin-5 [IL-5], interleukin-10 [IL-10], interleukin-13 [IL-13]) cytokines in the liver of both male and female Sm-infected Foxp3^cre IL-4Rα^−/lox mice (Figs 4F and S5E). These suggest that Foxp3⁺ Treg cells do require IL-4/IL-4Rα-mediated signaling in vivo to suppress overshooting inflammation.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. IL-4Rα-mediated signaling on Foxp3⁺ Treg cell is required for the accumulation of Treg cells and the control of effector T-cells.

IL-4Rα^−/lox, Foxp3^cre IL-4Rα^−/lox, and IL-4Rα^−/− mice were infected with Sm cercariae and euthanized 8 wk post infection. (A) Efficiency of il4ra deletion by qPCR. CD4⁺ Foxp3⁺ T cells were sorted 8 wk post infection from pooled spleen and MLN cells, genomic DNA was extracted, and the ratio of exon8:exon5 was calculated. (B) Flow cytometry analysis of IL-4Rα expression by CD19⁺ B cell and CD4⁺ Foxp3⁺ T cell in pooled spleen and MLN cells 8 wk post infection. (C) Representative flow cytometry of CD4⁺ Foxp3⁺ T cells from the liver of mice infected with Sm for 8 wk. (D) Frequency of CD4⁺ Foxp3⁺ T cells (left) and (E) Foxp3 GMFI in CD4⁺ Foxp3⁺ T cells from (C). (F) Liver cytokine production 8 wk post infection. Livers from infected mice were homogenized, and the levels of the indicated cytokines were detected by ELISA and normalized to mg of liver tissue. (G) Representative flow cytometry of CD4⁺ Foxp3⁺ T cells from the MLN of mice infected with Sm for 8 wk. (H) Frequency of CD4⁺ Foxp3⁺ T cells (left) and (I) Foxp3 GMFI in CD4⁺ Foxp3⁺ T cells from (G). (J) Representative flow cytometry of CD4⁺ Ki-67⁺ cells within CD4⁺ Foxp3⁻ T-cell population in MLN 8 wk post infection. (K) Frequency of CD4⁺ Ki-67⁺ cells from (J). (L) Frequency of CD3⁺ CD4⁺ CD44⁺ effector T cells in MLN 8 wk post infection. (M) Frequency of cytokine-producing CD3⁺ CD4⁺ T cells, from MLN, after stimulation with PMA/Ionomycin in the presence of monensin. (N) Frequency of indicated transcription factor–expressing CD4⁺ T cells in the MLN 8 wk post infection. (O) Frequency of cytokine-producing CD4⁺ GATA3⁺ T cells, from MLN, after stimulation with PMA/Ionomycin in the presence of monensin. (P) Frequency of cytokine-producing CD4⁺ Foxp3⁺ T cells, from MLN, after stimulation with PMA/Ionomycin in the presence of monensin. Results are representative of two independent experiments with 6–10 mice/group. Data are expressed as mean ± S.E.M. NS, P > 0.05; * P < 0.05, ** P < 0.001, *** P < 0.0001 by two-tailed unpaired Student t test. Underlying data can be found in S1 Data. Bcl-6, B cell lymphoma 6; CD3, cluster of differentiation 3; CD4, cluster of differentiation 4; CD19, cluster of differentiation 19; CD44, cluster of differentiation 44; Foxp3, forkhead box P3; GATA3, GATA binding protein 3; GMFI, geometric mean fluorescence intensity; IFN-γ, interferon gamma; IL-4, interleukin-4; IL-4Rα, interleukin-4 receptor alpha; IL-5, interleukin-5; IL-10, interleukin-10; IL-13, interleukin-13; IL-17, interleukin-17; MLN, mesenteric lymph node; NS, not significant; PMA, phorbol myristate acetate; qPCR, quantitative real-time PCR; RORγt, RAR-related orphan receptor gamma; Sm, S. mansoni; T-bet; T-box transcription factor; Treg, regulatory T.

https://doi.org/10.1371/journal.pbio.2005850.g004

The analysis within the MLNs supported this conclusion. Even though the frequency of Foxp3⁺ Treg cells (Figs 4G, 4H and S5G) within the MLNs in Sm-infected Foxp3^cre IL-4Rα^−/lox mice were similar to littermate controls at 8 wk post infection, Foxp3 surface expression level on a per-cell basis was, however, dramatically reduced in Sm-infected Foxp3^cre IL-4Rα^−/lox mice compared to infected littermate controls (Figs 4I and S5H). Reduced suppressive capacity potential was combined with increased frequency of proliferating (CD4⁺ Foxp3⁻ ki67⁺; Figs 4J, 4K and S5I) and effector (CD4⁺ cluster of differentiation 44 [CD44]⁺; Figs 4L and S5J) T cells within the MLN of Sm-infected Foxp3^cre IL-4Rα^−/lox mice, accompanied by significant increase in IL-4, IL-10, and IL-13 production by CD4⁺ T cells (Figs 4M and S5K). Together, these findings strongly suggest that the impairment of IL-4/IL-4Rα-mediated signaling within the Foxp3⁺ T-cell compartment diminishes Foxp3⁺ Treg cell recruitment to affected tissues during inflammation and impairs Treg cell ability to up-regulate suppressive factor, culminating into a heightened immune activation.

We next questioned the nature of the heightened immune response observed during inflammation in Foxp3^cre IL-4Rα^−/lox mice. To do so, MLN cells from Sm-infected Foxp3^cre IL-4Rα^−/lox mice and littermate controls were probed for CD4⁺ T cell–expressing GATA3 as a marker of Th2 responses [24], T-box transcription factor (T-bet) as a marker of T helper 1 (Th1) responses [28], RAR-related orphan receptor gamma (RORγt) as a marker of Th17 responses [29], and B cell lymphoma 6 (Bcl-6) as a marker of T follicular responses [30,31]. Consistent with the Th2 hegemony that is characteristic of Sm infection [32], MLN CD4⁺ T cells from Sm-infected Foxp3^cre IL-4Rα^−/lox mice overexpressed GATA3 (Figs 4N and S5L and S6A); however, all other T-cell polarization markers remained unaltered compared to littermate control (Figs 4N and S5L and S6A). Of importance, CD4⁺ GATA binding protein 3 (GATA3)⁺ cells from Sm-infected Foxp3^cre IL-4Rα^−/lox mice produced more IL-4, IL-10, and IL-13 compared to littermate controls (Figs 4O and S5M and S6B). Together, these suggest that CD4⁺ GATA3⁺ responses likely drive the heightened immune response and the elevated cytokine production observed in Foxp3^cre IL-4Rα^−/lox mice during inflammation. Nevertheless, with the recent description of ex-Foxp3 T cells [14,15,18], this observation could be confounded by the likelihood of cytokine production by newly formed ex-Foxp3⁺ T cells dually expressing GATA3 and Foxp3 and releasing cytokines following deletion of IL-4Rα. To address that, we traced back the source of the produced cytokines during Sm infection by co-staining of intracellular cytokines and Foxp3 in CD4⁺ T cells. We observed that CD4⁺ Foxp3⁺ T cells did not produce more cytokines in the MLN of Sm-infected Foxp3^cre IL-4Rα^−/lox mice (Figs 4P and S5N and S6B), ruling out a role for Foxp3⁺ T cells in the heightened cytokine production observed in Sm-infected Foxp3^cre IL-4Rα^−/lox mice. Collectively, we conclude that the heightened immune response observed—which is due to impairment of IL-4Rα-mediated signaling within the Foxp3⁺ T-cell compartment in Sm-infected Foxp3^cre IL-4Rα^−/lox mice—is driven at least in part by CD4⁺ GATA3⁺ Foxp3⁻ but not Foxp3⁺ T cells.

Deletion of IL-4Rα within Foxp3⁺ Treg cell population impairs their ability to control tissue inflammation in diseases

To further appraise the consequences of the heightened immune responses observed in diseased Sm-infected Foxp3^cre IL-4Rα^−/lox mice, egg-driven fibrogranulomatous inflammation, as well as Foxp3⁺ Treg cells’ infiltration in the liver of Sm-infected Foxp3^cre IL-4Rα^−/lox mice, was microscopically assessed in comparison with that of Sm-infected littermate controls. We noted that Sm infection resulted in enlarged egg-driven granulomas in the liver of Foxp3^cre IL-4Rα^−/lox mice when compared to granulomas in the liver of their littermate control (Fig 5A and 5B). In agreement with this observation, we found that the average number of Foxp3⁺ Treg cells within egg-driven granulomas in Foxp3^cre IL-4Rα^−/lox mice was significantly reduced when compared to the amount of Foxp3⁺ Treg cells recruited to the liver of littermate controls (Fig 5C and 5D). Furthermore, collagen levels, attesting the degree of tissue fibrosis, were considerably higher in the livers of Sm-infected Foxp3^cre IL-4Rα^−/lox mice when compared to the levels reported in Sm-infected littermate controls (Fig 5E). Indeed, colorimetric measurement of 4-hydroxyproline, a direct product of acid hydrolysis of collagen, confirmed our observed increased level of collagen in the liver of Sm-infected Foxp3^cre IL-4Rα^−/lox mice (Figs 4F and S5F). In fact, with similar egg burdens in the guts and livers of Foxp3^cre IL-4Rα^−/lox mice and their littermate control (Fig 5G), Sm-infected Foxp3^cre IL-4Rα^−/lox mice still displayed much larger coalescing granulomas (Fig 5H), as indicated by hematoxylin–eosin (HE) (Fig 5A) and chromotrope aniline blue (CAB) staining (Fig 5E). Similar to the liver, gut tissues of Sm-infected Foxp3^cre IL-4Rα^−/lox mice revealed elevated levels of cellular recruitment around trapped parasite eggs (Fig 5I), which was associated with a more pronounced deposition of collagen (Fig 5J), as confirmed by gut hydroxyproline content (Figs 5K and S5O), indicating a heightened fibrogranulomatous inflammation around Sm-trapped eggs in Foxp3^cre IL-4Rα^−/lox mice when compared to littermate controls.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Deletion of IL-4Rα on Foxp3⁺ Treg cells impairs the control of fibrogranulomatous inflammation during schistosomiasis.

(A) Representative HE staining of liver sections from mice infected with Sm for 8 wk (original magnification 100×). (B) Liver granuloma size. Granuloma size was determined from (A) by using a computerized morphometric analysis program (NIS elements by NIKON) by measuring 100 granulomas/group. (C) Representative Foxp3 Treg cells’ infiltration within liver granuloma 8 wk post Sm infection (original magnification 100×) of IL-4Rα^−/Lox and Foxp3^Cre IL-4Rα^−/Lox mice. Thin arrows point to Foxp3⁺ cells. (D) Quantification of the number of Foxp3⁺ cells per each granuloma from (C). (E) Representative CAB-stained liver sections from Sm-infected mice (original magnification 40×). (F) Liver hydroxyproline content measured by colorimetry 8 wk post infection. (G) Liver and gut egg burden 8 wk post infection. (H) Bar graphs showing the number of coalescent granulomas. (I) Representative HE staining of gut sections 8 wk post infection (original magnification 100×). (J) Representative CAB-stained gut sections 8 wk post infection (original magnification 200×). (K) Gut hydroxyproline content 8 wk post infection. Results are representative of two independent experiments with 6–10 mice/group. Data are expressed as mean ± S.E.M. NS, P > 0.05; * P < 0.05, ** P < 0.001, *** P < 0.0001 by two-tailed unpaired Student t test and one-way ANOVA with Bonferroni posttest analysis. Underlying data can be found in S1 Data. CAB, chromotrope aniline blue; EPG, egg per gram; Foxp3, forkhead box P3; HE, hematoxylin–eosin; IL-4Rα, interleukin-4 receptor alpha; NS, not significant; Sm, S. mansoni; Treg, regulatory T.

https://doi.org/10.1371/journal.pbio.2005850.g005

Since Cre expression can generate a phenotype of its own [33–39], we sought to address whether the uncontrolled immune responses and the exaggerated fibrogranulomatous inflammation noted in the Sm-infected Foxp3^cre IL-4Rα^−/lox mice were due to the specific deletion of IL-4Rα on the Foxp3⁺ Treg cells or were an artefact effect from the Cre transgene alone. To test that, IL-4Rα^+/+ and Foxp3^cre IL-4Rα^+/+ mice were infected with 100 Sm cercariae, and then, Foxp3⁺ Treg cell compartments and fibrogranulomatous inflammation in liver and gut were investigated 8 wk post infection. We noted that IL-4Rα expression on either CD19⁺ B cells or Foxp3⁺ Treg cell compartment (S7A Fig) in Sm-infected Foxp3^cre IL-4Rα^+/+ mice was similar to littermate controls. Furthermore, in liver, the frequency of Foxp3⁺ Treg cell population (S7B and S7C Fig) and level of Foxp3 (S7D and S7E Fig) as well as GATA3 (S7F and S7G Fig) expression within the Foxp3⁺ Treg cell compartment in Sm-infected Foxp3^cre IL-4Rα^+/+ mice were similar or slightly affected when compared to their infected littermate controls. The similar frequency of Foxp3⁺ Treg cell population (S7H and S7I Fig), as well as the comparable level of Foxp3 expression (S7J and S7K Fig), was also noted in the MLN of Sm-diseased mice. In fact, Cre transgene expression in Foxp3^cre IL-4Rα^+/+ mice led to neither an expansion of CD4⁺ GATA3⁺ T-cell population (S7L Fig) nor uncontrolled Type 1 (IFN-γ), Type 17 (IL-17), or Type 2 (IL-4, IL-5, IL-10, IL-13) cytokine production (S7M Fig). In agreement with these observations, we found that Cre expression did not affect either liver granuloma size (S8A and S8B Fig) or hepatic fibrosis, as indicated by CAB staining (S8C Fig) and colorimetric measurement of 4-hydroxyproline (S8D Fig). Similar to the liver, gut tissues of Sm-infected Foxp3^cre IL-4Rα^+/+ mice had a comparable granuloma size (S8E Fig), similar collagen deposition (S8F Fig), and a similar level of 4-hydroxyproline content (S8G Fig) when compared to their infected littermate controls, indicating that Cre transgene, in our mouse model, does not have any impact on either the immune responses or the tissue inflammation.

Taken together, these observations indicate that the impairment of IL-4Rα-mediated signaling, but not the Cre transgene expression, specifically within the Foxp3⁺ Treg cell compartment during experimental schistosomiasis drives a poor accumulation of Foxp3⁺ T cells in the inflamed tissues and consequently results in elevated host fibrogranulomatous responses around the trapped parasite eggs.

We next aimed to test whether this would also hold true in another inflammatory helminth disease model. We found that following subcutaneous infection of Foxp3^cre IL-4Rα^−/lox and IL-4Rα^−/lox littermate control mice with Nb, the airways of Nb-infected Foxp3^cre IL-4Rα^−/lox mice showed much heavier mucus production 9 d post infection (S9A and S9B Fig). Moreover, we noted that Foxp3⁺ Treg cells’ recruitment to the inner layer of the alveoli of the lungs of Nb-infected Foxp3^cre IL-4Rα^−/lox mice (S9C and S9D Fig) was diminished, indicating that in this model as well the impairment of IL-4Rα-mediated signaling within the Foxp3⁺ T-cell compartment impairs their ability to accumulate at the inflamed tissue and to control local tissue inflammation. Collectively, these results clearly suggest, in two different and major inflammatory helminth models, that impairment of IL-4Rα-mediated signaling within the Foxp3⁺ T-cell compartment leads to uncontrolled immune responses and exacerbated tissue(s) inflammation, underscoring a hitherto-unappreciated role of IL-4Rα-mediated signaling on Foxp3⁺ Treg cells to control inflammatory responses in vivo.

IL-4Rα-mediated signaling on Foxp3⁺ Treg cell is required for the generation of potent effector Foxp3⁺ Treg (eTreg) cell population

Next, we investigated the mechanisms underpinning the poor ability of Foxp3⁺ Treg cells to accumulate in the inflamed tissues in our diseased Foxp3^cre IL-4Rα^−/lox mice. First, we assessed the effect of IL-4Rα deletion specifically on Foxp3⁺ T-cell compartment for its ability to build up the eTreg cells needed to contain the immune responses at the site of inflammation [40]. To address that, central Foxp3⁺ Treg (cTreg) cell and eTreg cell populations in hepatic lymph nodes (hLNs) and MLNs of Foxp3^cre IL-4Rα^−/lox mice infected with Sm for 8 wk were assessed in comparison to those of Sm-infected littermate controls. In both lymph nodes, deletion of IL-4Rα specifically on Foxp3⁺ Treg cells resulted in the accumulation of cTreg cells (Figs 6A and 6B and S10A), which was associated with a significant reduction in the pool of eTreg cell population (Figs 6A and 6C and S10B), indicating that IL-4Rα-mediated signaling on Foxp3⁺ Treg cells could be playing a role in inducing the conversion of cTreg cell to eTreg cell. Furthermore, the ability of these eTreg cells to maintain or up-regulate the expression of C-X-C motif chemokine receptor 3 (CXCR3), a chemoattractant receptor required for the migration of eTreg cells to nonlymphoid tissues (in particular, liver [40,41]), was significantly impaired in both hLNs (Fig 6D and 6E) and MLNs (S10C and S10D Fig) of Foxp3^cre IL-4Rα^−/lox mice infected with Sm for 8 wk. In support, the expression level of GATA3, a transcription factor required for Treg cell accumulation at the site of inflammation [42], within the Foxp3⁺ Treg cell in the liver of Foxp3^cre IL-4Rα^−/lox mice infected with Sm for 8 wk was diminished when compared to littermate controls (Fig 6F and 6G). Together, these results suggest that IL-4Rα-mediated signaling on Foxp3⁺ Treg cell is required for the maintenance or up-regulation of the markers required for migration and accumulation of Foxp3⁺ Treg cell in the inflamed tissue.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. IL-4Rα-mediated signaling on Foxp3⁺ Treg cell is required for eTreg cell expansion, recruitment, and sustainability during schistosomiasis.

(A) Representative flow cytometry of cTreg cells and eTreg cells from the hLN of mice infected with Sm for 8 wk. (B) Frequency of central CD4⁺ Foxp3⁺ Treg cells (left) and (C) effector CD4⁺ Foxp3⁺ Treg cells from (A). (D) Representative histogram of CXCR3 expression by effector CD4⁺ Foxp3⁺ T cells in the hLN 8 wk post infection with the mean values summarized in (E). (F) Representative histogram of GATA3 expression by CD4⁺ Foxp3⁺ T cells in the liver 8 wk post infection with the mean values summarized in (G). (H) Frequency of CD4⁺ Foxp3⁺ Helios⁺ Treg cells in the liver of Sm-infected mice. (I) Frequency of CD4⁺ Foxp3⁺ Helios⁻ Treg cells in the liver of Sm-infected mice. (J) Representative histogram of Ki-67 expression by CD4⁺ Foxp3⁺ T cells in the liver 8 wk post infection with the mean values summarized in (K). (L) Representative histogram of Bcl-2 expression by CD4⁺ Foxp3⁺ T cells in the liver 8 wk post infection with the mean values summarized in (M). (N) Representative histogram of caspase-3 expression by CD4⁺ Foxp3⁺ T cells in the liver 8 wk post infection with the mean values summarized in (O). (P) Representative histogram of fixable dye in CD4⁺ Foxp3⁺ T cells in the liver 8 wk post infection with the mean values summarized in (Q). Results pooled from two independent experiments with 3–4 mice/group. Data are expressed as mean ± S.E.M. NS, P > 0.05; * P < 0.05, ** P < 0.001, *** P < 0.0001 by two-tailed unpaired Student t test. Underlying data can be found in S1 Data. Bcl-2, B cell lymphoma 2; CD44, cluster of differentiation 44; CD62L, L-selectin; cTreg, central regulatory T; CXCR3, C-X-C motif chemokine receptor 3; eTreg, effector regulatory T; Foxp3, forkhead box P3; GATA3, GATA binding protein 3; GMFI, geometric mean fluorescence intensity; hLN, hepatic lymph node; IL-4Rα, interleukin-4 receptor alpha; NS, not significant; Sm, S. mansoni; Treg, regulatory T.

https://doi.org/10.1371/journal.pbio.2005850.g006

Then, we traced back whether the reduction in the Foxp3⁺ Treg cell population in the liver of Foxp3^cre IL-4Rα^−/lox mice infected with Sm for 8 wk was due to a global defect in Foxp3⁺ Treg cells or in the Treg cell de novo conversion in vivo, since eTreg cell can be thymic-derived and/or peripherally induced. To address that, we analyzed the thymic-derived Foxp3⁺ Treg cells (Foxp3⁺ Helios⁺ Treg cells) and the peripherally iTreg cells (Foxp3⁺ Helios⁻ Treg cells) in the liver of Foxp3^cre IL-4Rα^−/lox mice infected with Sm for 8 wk and their littermate controls. We noted that in the liver of Foxp3^cre IL-4Rα^−/lox mice infected with Sm for 8 wk, both Foxp3⁺ Helios⁺ and Foxp3⁺ Helios⁻ Treg cells were significantly reduced (Fig 6H and 6I), suggesting a global defect in the Foxp3⁺ Treg cell population.

Finally, inasmuch as the reduction of Foxp3⁺ Treg cell population was independent of its proliferation as Foxp3⁺ Treg cells in the liver of Foxp3^cre IL-4Rα^−/lox mice infected with Sm for 8 wk and their littermate control had a comparable expression level of Ki-67 (Fig 6J and 6K), we therefore asked whether the reduction of Foxp3⁺ Treg cell population in the liver could be possibly driven, in addition to their poor migration and accumulation, by the lessened ability of these Foxp3⁺ Treg cells to survive in the absence of IL-4Rα-mediated signaling. Indeed, we noted a diminished expression level of the pro-survival factor B cell lymphoma 2 (Bcl-2; Fig 6L and 6M) within the Foxp3⁺ Treg cell population in the liver of the Foxp3^cre IL-4Rα^−/lox mice infected with Sm for 8 wk when compared to their littermate control. In support, those Foxp3⁺ Treg cell population had a higher expression level of the apoptotic marker caspase-3 (Fig 6N and 6O) as well as the fixable viability stain (Fig 6P and 6Q), indicating that the Foxp3⁺ Treg cell population in the liver has a higher propensity to undergo apoptosis in the absence of IL-4Rα-mediated signaling, which recapitulates our in vitro data mentioned earlier. Collectively, our results suggest that IL-4Rα-mediated signaling is required for the conversion of cTreg cells into eTreg cells. These eTreg cells further need the IL-4Rα-mediated signaling to maintain or up-regulate markers required for their migration, accumulation, and survival at the site of inflammation.

Ethics statement

All mice were maintained in specific-pathogen-free barrier conditions in individually ventilated cages at the University of Cape Town biosafety level 2 animal facility. Experimental mice were sex- and age-matched and used between 6 and 8 wk of age. All the experimental work was in strict accordance with the recommendations of the South African national guidelines and of the University of Cape Town practice for laboratory animal procedures, as in ethics protocols 014/003 and 016/027 approved by the Animal Research Ethics Committee of the Faculty of Health Science, University of Cape Town. All efforts were made to minimize animals’ suffering. Prior to percutaneous infection with Sm cercariae, animals were anesthetized by intraperitoneal injection of a cocktail of ketamine (100 mg/kg) and xylazine (10 mg/kg) and monitored for 5 min to confirm deep anesthesia. Anesthesia was confirmed by the absence of pedal reflex (toe pinch) and eyeblink reflex amid a regular respiratory rate. The anesthesia duration was of a maximum of 30 min. During the anesthesia phase, animals were exposed to an infrared lamp to help them maintain their core body temperature. This procedure was performed and duly cared for by trained and authorized researchers. Post infection, animals were monitored until regaining of consciousness, and moistened food was added to the cage bedding. Upon reaching the study’s experimental end point and/or the protocol-defined humane end point, animals were euthanized under this study by exposure to an excess of halothane (4% in air) for 5 minutes. Death was confirmed either by neck dislocation or exsanguination by cardiac puncture. Death was not a predetermined end point in any of the arms of this study.

Mice

IL-4Rα^+/+, IL-4Rα^−/−, and IL-4Rα^−/lox mice on BALB/c background and C57BL/6 mice were previously described [22,23]. For Foxp3^cre IL-4Rα^−/lox mice, transgenic Foxp3^cre mice (a generous gift from Prof. James Wing, Osaka University) were intercrossed for two generations with IL-4Rα^−/− BALB/c mice [22]. These mice were further intercrossed with homozygous IL-4Rα^lox/lox BALB/c mice [23] to generate hemizygous Foxp3^cre IL-4Rα^−/lox mice BALB/c strain. Hemizygous littermates (IL-4Rα^−/lox) were used as wild-type controls in all experiments. Mice were genotyped as described previously [22,23].

Mice infection and challenge

Cell isolation

Thymus and MLN single-cell suspensions were prepared by mechanical squeezing through a 40 μM cell strainer (Falcon, Corning, MA, US). Single-cell spleen suspensions were prepared by mechanical squeezing through a 70 μM cell strainer (Falcon). Liver lymphomyeloid cells were isolated following a modified version of the method of Gossen and colleagues and Hardy and colleagues [50,51]. Briefly, single-cell suspensions from the liver tissues were prepared by chopping them into 10 mm³ small pieces and incubating them in Iscove’s Modified Dulbecco’s Medium (IMDM) containing 220 U/mg Collagenase I (Gibco, Waltham, MA, US), 13 U/mg DNase I (Sigma, St. Louis, MO, US), and 5% inactivated fetal calf serum (iFCS; Gibco) (digestion buffer) for 30 min at 37°C under constant rotation. The resulting suspension was mechanically squeezed through a 100 μM sterile cell strainer (Falcon), followed by centrifugation at 1,200 rpm for 10 min at 4°C. Supernatant was discarded and the cells resuspended in 36% of isotonic Percoll (Sigma). This suspension was mixed thoroughly, and separation was performed at 500 g, without breaks, for 10 min at 4°C. For lungs, single-cell suspensions were prepared by chopping the lungs into 10 mm³ pieces, incubating them in digestion buffer for 30 min at 37°C, and mechanically squeezing them through a 70 μM cell strainer. Erythrocytes were lysed using RBC lysis buffer. Cells were washed; resuspended in IMDM containing 10% iFBS, 100 U/ml penicillin (Gibco), and 100 μg/ml streptomycin (Gibco) (IMDM culture medium); and checked for viability and cell number by trypan blue staining.

Flow cytometry

Antibodies used for flow cytometry analysis were as follows: IL-4Rα (mIL4R-M1), CD3ε (500A2), CD4 (RM4-5), CD8α (53–6.7), CD25 (7D4), CD19 (1D3), Lineage, Foxp3 (FJK-16s), GATA3 (L50-823), T-bet (eBio4B10), Bcl-6 (K112-91), RoRγt (Q31-378), Helios (22F6), IRF4 (irf4.3e4), Ki67 (B56), Bcl-2, caspase-3 (C92-605), FVS dye, CXCR3 (CXCR3-173), CD44 (IM7), CD62L (MEL-14), IFN-γ (XMG1.2), IL-4 (11B11), IL-10 (JES5-16E), IL-13 (eBio13A), and p-STAT6 (J71-773.58.11) purchased from BD Biosciences (Franklin Lakes, NJ, US) and eBioscience (San Diego, CA, US). For staining of cell-surface markers, cells (1 × 10⁶) were labeled and washed in PBS containing 1% BSA (Roche, Switzerland) and 0.1% NAN₃ (FACS buffer). For detection of intracellular cytokines, cells were seeded at a density of 2 × 10⁶ cells/well in complete IMDM culture medium and stimulated with 50 ng/ml phorbol myristate acetate (PMA), 250 ng/ml Ionomycin, and 200 μM monensin (all from Sigma) for 8–12 hr at 37°C in a humidified atmosphere containing 5% CO₂. After the incubation period, cells were harvested, washed, fixed in 2% (w/v) paraformaldehyde, permeabilized with 0.5% saponin buffer, and then stained for cytokine production as previously described [23]. For intranuclear staining, BD Pharmingen Transcription Factor Buffer Set (BD Biosciences) was used as per manufacturer's instruction for detection of transcription factors. Acquisition was performed using BD LSRFortessa (BD Biosciences), and data were analyzed using FlowJo software (Treestar, Ashland, OR, US).

Genotypic evaluation of efficiency and specificity of IL-4Rα deletion

Genomic DNA was isolated from CD3⁺ CD4⁺ Foxp3⁻, CD3⁺ CD4⁺ Foxp3⁺ T cells and CD19⁺ B cells sorted using BD FACSAria III cell sorter (BD Biosciences). Cell purity determined by flow cytometer amounted to at least 99%, and NanoDrop (ND-1000 Spectrophotometer, Thermo Fischer Scientific) was used for measuring DNA concentration and purity. Efficiency of il-4rα gene deletion was quantified by qPCR on LightCycler 480 Instrument II (Roche) using the following primers; exon 5: forward 5′ AACCTGGGAAGTTGTG 3′ and reverse 5′ CACAGTTCCATCTGGTAT 3′, exon 8: forward 5′ GTACAGCGCACATTGTTTTT 3′ and reverse 5′ CTCGGCACTGACCCATCT 3′. PCR conditions were 94°C for 2 min, 94°C for 20 s, 45°C for 30 s, and 72°C for 20 s for 55 cycles.

Cell culture

Pooled cells from spleen and MLN from naïve Foxp3^cre IL-4Rα^−/lox mice and their littermate control were cultured at 5 × 10⁶ cells/ml in RPMI medium (Lonza, Walkersville, MD, US) supplemented with 10% iFBS and penicillin and streptomycin (100 U/ml and 100 μg/ml) (RPMI culture medium) for 40 hr at 37°C in a humidified atmosphere containing 5% CO₂, in medium supplemented with 0 or 1 ng/ml rIL-4 (BD Biosciences). For measuring the level of STAT6 phosphorylation, spleen and MLN cells from naïve Foxp3^cre IL-4Rα^−/lox mice, their littermate control, and global knock-out mice were cultured at 1 × 10⁶ cells/ml RPMI culture medium for 1 hr at 37°C in a humidified atmosphere containing 5% CO₂, in medium supplemented with 0 or 10 ng/ml rIL-4. After the incubation period, cells were harvested, washed in FACS buffer, and then stained for IL-4Rα and/or p-STAT6. IL-4Rα expression and level of STAT phosphorylation were detected by flow cytometry. In other settings, sorted CD4⁺ CD25⁺ T cells from naïve Foxp3^cre IL-4Rα^−/lox mice and their littermate control were cultured at 1 × 10⁶ cells/ml in RPMI medium for 18 or 36 hr, at 37°C in a humidified atmosphere containing 5% CO₂, with 0 or 10 ng/ml rIL-4; then, cells were checked for survival and Foxp3 expression by flow cytometry.

In vitro Treg cell conversion assay

CD4⁺ T cells were enriched from a pool of naïve spleens and MLN cells by using EasySep Mouse T Cell Isolation Kit (Stemcell Technologies, Vancouver, Canada, Catalogue no. 19852A) as per the manufacturer’s instruction, and then, the CD4⁺ CD25⁻ population was sorted by using BD FACSAria III cell sorter (BD Biosciences). Sorted CD4⁺ CD25⁻ cells (2.5 × 10⁶ cells/ml) were cultured with plate-bound anti-CD3 (10 μg/ml) in the presence of soluble anti-CD28 (2 μg/ml) and different concentrations of TGFβ (0, 1, or 2 ng/ml) (BD Pharmingen) in 96-well, flat-bottomed plates in triplicates. After 3 d, the iTreg cells were analyzed by flow cytometry for CD25 and Foxp3 expression.

Serum analyses

Histology

Tissue homogenate for cytokine analysis

Livers were collected and homogenized in lysis buffer (PBS [pH 7.1], 0.1% Tween 20 [Merck], and 1% protease inhibitor cocktail [Sigma-Aldrich, St. Louis, MO, US, catalogue no. P8340]). Cytokines (IL-4, IL-5, IL-10, IL-13, IFN-γ, and IL-17, all from BD Pharmingen) were measured in the protein extracts by sandwich ELISA as described previously [23]. Cytokine values were normalized according to the protein content measured by Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, catalogue no. 23225).

Hydroxyproline quantification

Hydroxyproline content as a measure of collagen production was quantified using a modified protocol [53]. In brief, weighed liver samples were hydrolyzed overnight at 110°C in 6 M HCl and then filtered through Whatman filter papers. Filtrate was neutralized with 1% phenolphthalein and titrated against 10 M NaOH. An aliquot was mixed with isopropanol and added to a chloramine-T/citrate buffer solution (pH 6.0) (Sigma). Ehrlich’s reagent solution (25 g p-dimethyl-amino-benzaldehyde, 37.5 ml 60% perchloric acid) was added and measured at 570 nm using a VersaMax microplate spectrophotometer (Molecular Devices). Hydroxyproline levels were calculated by using 4-hydroxy-L-proline (Calbiochem, San Diego, CA, US) as standard, and results were expressed as μg hydroxyproline per weight of liver tissue that contained 10⁴ eggs.

Statistics

Statistical analysis was conducted using GraphPad Prism 4 software (http://www.prism-software.com). Data were calculated as the mean ± SD. Statistical significance was determined using the unpaired Student t test and one-way ANOVA with Bonferroni’s posttest, defining differences to IL-4Rα^−/lox mice as significant (*, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001).