Figures
Abstract
Background
Vitamin D, causally implicated in bone diseases and human malignancies, exerts its effects through binding to the vitamin D receptor (VDR). VDR is a transcription factor modulating the expression of several genes in different pathways. Genetic variants in the VDR gene have been associated with several cancers in different population including colorectal cancer.
Objective
To assess the association of VDR gene polymorphisms in relation with colorectal cancer (CRC) in a Saudi population.
Methods
The polymorphisms of VDR gene (BsmI, FokI, ApaI and TaqI) were analyzed by the polymerase chain reaction amplification of segments of interest followed by Sanger sequencing. One hundred diagnosed CRC patients and 100 healthy control subjects that were age and gender matched were recruited.
Results
We did not observe significant association of any of the four VDR polymorphisms with colorectal cancer risk in the overall analysis. Although not statistically significant, the AA genotype of BsmI conferred about two-fold protection against CRCs compared to the GG genotype. Stratification of the study subjects based on age and gender suggests statistically significant association of CRC with the ‘C’ allele of ApaI in patients >57 years of age at disease diagnosis and BsmI polymorphism in females. In addition, statistically significant differences were observed for the genotypic distributions of VDR-BsmI, ApaI and TaqI SNPs between Saudi Arabian population and several of the International HapMap project populations.
Conclusion
Despite the absence of correlation of the examined VDR polymorphisms with CRCs in the combined analysis, ApaI and BsmI loci are statistically significantly associated with CRC in elderly and female patients, respectively. These findings need further validation in larger cohorts prior to utilizing these SNPs as potential screening markers for colorectal cancers in Saudi population.
Citation: Alkhayal KA, Awadalia ZH, Vaali-Mohammed M-A, Al Obeed OA, Al Wesaimer A, Halwani R, et al. (2016) Association of Vitamin D Receptor Gene Polymorphisms with Colorectal Cancer in a Saudi Arabian Population. PLoS ONE 11(6): e0155236. https://doi.org/10.1371/journal.pone.0155236
Editor: Graham R. Wallace, University of Birmingham, UNITED KINGDOM
Received: February 18, 2016; Accepted: April 26, 2016; Published: June 16, 2016
Copyright: © 2016 Alkhayal et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper.
Funding: The study was funded by King Saud University, through Vice Deanship of Research Chairs. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Colorectal cancer (CRC) is the fourth leading cause of cancer-related mortality worldwide with its incidence increasing rapidly in recent years [1]. The incidence of CRC is on the rise in the Kingdom of Saudi Arabia. CRC presentation is at a younger age in Saudis, especially in women [2]. Besides genetics, environmental factors may contribute to the development of the disease. In 1980 Garland and Garland hypothesized that higher incidence rates for CRC in areas with low sunlight exposure might be attributable to lower levels of vitamin D [3]. Deficiency of vitamin D is a common occurrence in Saudi Arabia, especially among young women and is becoming a major public health concern. Several factors that contribute to the high prevalence of vitamin D deficiency have been proposed which include insufficient nutritional intake along with inadequate exposure to sunlight, abnormality in vitamin D absorption and malnutrition [4].
Vitamin D is involved in biological processes such as bone metabolism, cell proliferation and differentiation. An inverse relationship between serum vitamin D and the incidence of cancer has been suggested [5]. It has been reported that Vitamin D reduces epithelial cell proliferation and promote differentiation in human colon derived cells as well as in experimental animal studies [6–8]. A higher serum level of 25-OH vitamin D has been associated with decreased colorectal adenoma risk [9, 10]. Vitamin D deficiency has been associated with breast cancer [11], ovarian cancer [12] and prostate cancer [13–14].
Vitamin D (1, 25(OH)2D3, calcitriol) acts via binding to an intracellular vitamin D receptor (VDR) in target tissues [15]. VDR is located on chromosome 12q12-14 and consists of two promotor regions, eight protein coding exons (2–9) and six untranslated exons (1a-1f) [16]. More than sixty SNPs of the VDR gene located in the promoter region have been discovered in relation to cancer occurrence and prognosis [15, 17]. ApaI (rs7975232), TaqI (rs731236), BsmI (rs1544410) and FokI (rs10735810) are functional VDR SNPs that affect VDR gene expression and mRNA stability [9].
Recently, several epidemiologic studies reported the association between various VDR genetic variants and CRC with contradictory results [18–24] and significant associations between VDR gene SNPs with the risk of CRC has been presented [18, 20, 21, 22, and 24]. In contrast, other studies reported no association [19, 22]. Furthermore, the association between VDR gene polymorphisms and the risk of CRC may be associated with adiposity [23].
The aim of this study was to investigate four SNPs (FokI, BsmI, TaqI and ApaI) within the VDR gene in Saudi patients with CRC versus healthy controls. The selection of these SNPs were based on the common VDR SNPs sites that were examined in other populations in previous genetic epidemiological studies.
Materials and Methods
Study population
One hundred sporadic CRC patients (age from 20–80 years old) who underwent operations for CRC at King Khalid University Hospital (KKUH) in the period between 2013 and 2014, and 100 healthy subjects of equivalent age range were recruited for blood donation at the KKUH, Riyadh, Saudi Arabia. All adult donors were requested to sign a fully informed and written consent, approved by the Ethics Review Committee of the KKUH. We received 95% response rate from patients and controls that were requested to participate in the study. This study was approved by the Ethical Committee of the king Saud University.
DNA extraction
Peripheral blood was extracted and DNA was purified from 3 mL of whole blood, using a QIAamp DNA Blood Mini Kit (QIAGEN Sciences, Valencia, CA, USA), following the manufacturer's instructions. DNA concentrations were determined spectrophotometrically on NanoDrop 8000 (Thermo Scientific, USA), and the purity determined by using standard A260/A280 and A260/A230 ratios. Samples were stored in -80°C until used.
Genotyping
Genotyping for FokI (rs2228570), BsmI (rs1544410), TaqI (rs731236) and ApaI (rs7975232) polymorphisms in the VDR gene was performed by PCR amplification, followed by sequencing. PCR amplification of the region of the gene encompassing the variants was done using DNA polymerase, 5XFIREPol Master Mix (Solis BioDyne, Estonia, Europe) and specific primers. The following primers were used FokI: 5’-CATGTATGAGGGCTCCGAAG (right) and 5’- ACCTTGCTTCTTCTCCCTCC- (left); BsmI: 5’- AGGACAAAGACCTGCTGAGG (right) and 5’- TCACTGCACATTGCCTCCAA (left); TaqI: 5’- CTGAGAGCTCCTGTGCCTTC (right) and 5’-AAGGGGCGTTAGCTTCATGC (left); and ApaI: 5’- GGTATCACCGGTCAGCAGTC (right) and 5’- CGTTAGCTTCATGCTGCACT (left). Cycle sequencing of the purified PCR fragments was performed using the Big Dye Terminator kit by capillary electrophoresis (Applied Biosystems, Sequencer model 3730xl). Genotyping analysis was performed with the Sequencing Analysis software version 5.2 (Applied Biosystems, CA, USA).
Statistical analysis
In this case-control study, tests for association and deviation from Hardy-Weinberg equilibrium were performed using the web based program http://ihg.gsf.de/cgi-bin/hw/hwa1.pl as done previously [25]. Chi-square values, odds ratios (OR), 95% confidence intervals (CI) and p-values were calculated to compare the distribution of genotype and allele frequencies between the CRC patients and healthy controls. Pair-wise chi-square analysis was performed in a 3 x 2 contingency table to assess the difference in the distribution of genotypes between Saudi Arabians and the International HapMap project populations. The genotype counts for the International HapMap populations were obtained from the HapMap project database release #28 (http://hapmap.ncbi.nlm.nih.gov). A p-value of <0.05 was considered as significant.
Results
Association between VDR SNPs and CRC risk
In this case-control study, a total of 200 subjects were examined for four SNPs in the VDR gene to determine the risk of predisposition to colorectal cancer. The study group comprised 100 histopathologically confirmed CRCs and 100 age and gender matched normal healthy controls from Saudi Arabian ethnicity. The age of the CRC patients were between 20 and 80 with the median age of 57.5 years while the controls aged between 21 and 81 with the median age being 57.5 years. The clinicopathological characteristics of CRC patients has been reported earlier [25]. Briefly, 64% of the cases were males and 36% were females. Majority of the primary tumors were located in the colon (85%) while 15% of the patients had tumor in the rectum. According to the Union internationale contre le cancer (UICC) clinical staging, 11%, 58% and 17% patients were categorized as stage I, stage II and stage III, respectively, while 14% patients had metastatic disease. Histological grading as per UICC classified 97% of the cases as G2.
The distribution of genotypes at SNPs loci rs7975232 and rs731236 in the CRC group and that of SNPs rs1544410 and rs7975232 in the control group deviated from the Hardy-Weinberg equilibrium (Table 1). Genotypes of rs1544410 and rs2228570 in the CRC patients and that of rs2228570 and rs731236 in the controls were in accordance with the Hardy-Weinberg equilibrium (Table 1). The allelic and genotype frequencies of the analyzed SNPs in the VDR gene in CRCs and normal population are shown in Table 2. In the overall analysis, none of the four genetic variants in the VDR gene were found to be significantly associated with risk of developing colorectal cancer. Although the AA genotype of rs1544410 conferred about two-fold decreased risk of developing CRCs compared to the GG genotype, this association was not statistically significant (OR = 0.492, χ2 = 3.14, p = 0.07629) (Table 2).
Age at disease diagnosis and gender based correlation of VDR SNPs and CRC
To determine whether genetic variants in the VDR gene have any influence on the age of onset of CRC, patients were grouped according to the median age at disease diagnosis as ≤57 (n = 50) and >57 (n = 50) years. The distribution of genotypes and allelic frequencies in the CRC patient group were compared to the age matched controls and are depicted in Table 3. Only the rs7975232 exhibited statistically significant association with CRCs based on the allelic model in patients of age group >57 years. Individuals with the C allele at rs7975232 have about two-fold higher risk of developing CRC compared to those having the A allele (OR = 1.778, χ2 = 4.00, p = 0.04554). Additionally, it was observed that the CC homozygosity compared to the AA homozygosity of rs7975232 impart about two-fold greater risk of acquiring CRCs, however, this association did not reach statistical significance (OR = 2.273, χ2 = 2.90, p = 0.08860) (Table 3). The other SNPs in the VDR gene that were examined were not associated significantly with colorectal cancer cases in either age group.
The distribution of genotype and allele frequencies of the four VDR gene polymorphisms segregated according to gender are presented in Table 4. In the male patients, none of the VDR gene polymorphisms were significantly associated with CRC. However, the rs1544410 was found to associated significantly with CRCs in females (OR = 0.217, χ2 = 4.21, p = 0.04021). The AA homozygous women are 4.6 fold less likely to get CRCs relative to those having GG homozygosity of rs1544410. In the allelic model as well similar association with CRCs was observed in female patients where the A allele imparted significant protective effect (Table 4). The other three SNPs, rs2228570, rs7975232 and rs731236 were not found to be associated with colorectal cancers in female patients.
Comparison of VDR SNPs genotypes distribution between KSA and International HapMap project populations
The genotypic distribution of the three polymorphic loci, rs1544410, rs7975232 and rs731236 in the VDR gene for which the data were available from the International HapMap project populations (http://hapmap.ncbi.nlm.nih.gov/) were compared to Saudi Arabian control population. Pairwise chi-square test showed that the distribution of the three genotypes of rs1544410 was significantly different between the Saudi Arabian population (KSA) and those from the HapMap project populations except Utah residents with Northern and Western European ancestry (CEU); Maasai in Kinyawa, Kenya (MKK) and Tuscan in Italy (TSI) (Table 5). The genotype frequencies of rs7975232 for all the eleven populations included in the HapMap project were significantly different compared to our population. In the case of rs731236 SNP, the genotypes distribution in the KSA population used in this study were similar to that found in five International HapMap project populations namely, African ancestry in Southwest USA (ASW); CEU; Gujarati Indians in Houston, Texas (GIH); Luhya in Webuye, Kenya (LWK) and TSI. Statistically significant difference was observed for the rs731236 genotypes in KSA population compared to the Han Chinese in Beijing, China (CHB); Chinese in Metropolitan Denver, Colorado (CHD); Japanese in Tokyo, Japan (JPT); Mexican ancestry in Los Angeles, California (MEX); MKK and Yoruban in Ibadan, Nigeria (YRI) included in the HapMap project (Table 5).
Discussion
Deficiency of vitamin D has been implicated in bone diseases, metabolic syndromes and human malignancies. 1, 25(OH)2D3 bring about its antitumorigenic effects by promoting cellular differentiation while decreasing cell growth, proliferation, invasion and metastasis [26]. Since vitamin D acts through its binding to VDR, suboptimal responsiveness of the VDR can be manifested as vitamin D deficiency. Polymorphisms in VDR gene have been significantly associated with various cancers including prostate, breast, skin and colorectal [27]. Several investigations have focused on the association of genetic variants in the VDR gene and predisposition of colorectal cancers in different populations [28–33]. Due to the high prevalence of colorectal cancers in Saudi Arabian population, we examined four commonly studied polymorphic loci, rs1544410 (BsmI), rs2228570 (FokI), rs7975232 (ApaI) and rs731236 (TaqI) in the VDR gene for a possible association with the risk of developing this malignancy. The departure from Hardy-Weinberg equilibrium in this study for the SNPs rs7975232 and rs731236 in the CRC patients and rs1544410 and rs7975232 in the control population may be due to the high rate of consanguineous marriages in Saudi society [34–35]. The observed deviation from the Hardy-Weinberg equilibrium for the mentioned SNPs are unlikely due to misclassification of the genotypes as they were identified by highly reliable DNA sequencing in both the directions. In this study, none of the SNPs were found to be significantly associated with CRC in the overall analysis for both the genotypic and allelic models. The lack of association of these SNPs does not rule out the possibility of the involvement of VDR as other polymorphic loci in the gene might influence the development of CRC. In the absence of association of the VDR polymorphisms observed in our study, the increased incidence of CRCs may be attributed to the high prevalence of vitamin D deficiency among Saudis, since substantial evidence suggests that vitamin D may play significant role in CRC risk [36–38]. A recent study in a Jordanian population which may be ethnically similar to Saudi Arabians found a significant association between low serum level of vitamin D and CRCs. The authors also observed an association of VDR-TaqI polymorphism and CRC risk in Jordanians [39]. The discrepancy for the VDR-TaqI polymorphism between the Jordanian and Saudi population is not known and it is possible that certain confounding factors might be involved in the different results obtained for this genetic variant. Analysis after stratification of the samples based on age and gender suggests statistically significant association of CRC with the ‘C’ allele of rs7975232 in patients >57 years of age at disease diagnosis and rs1544410 in females. These results, however, needs further validation in larger cohorts due to the limitation of small sample size in our study. The 4.6 fold protective effect of the ‘AA’ genotype of rs1544410 compared to the ‘GG’ genotype in females could be due to the higher serum levels of 1,25(OH)2D3 associated with the ‘AA’ genotype relative to the ‘GG’ genotype [40]. Our results are in accordance with the findings of Takeshige and colleagues who also did not find significant association of colorectal cancers with any of the four VDR SNPs (BsmI, FokI, ApaI and TaqI) in Japanese patients [33]. Similarly, in a multivariate analysis adjusted for ethnicity, sex, age, body mass index, and noncancer status with polyps in African American and Hispanic populations, none of the four VDR SNPs were significantly associated with CRC. However, in a univariate analysis, while BsmI, ApaI and TaqI SNPs were not found to be associated with CRCs, the authors were able to observe significant association between VDR-FokI polymorphism and CRC cases [31]. Laczmanska et al, in a cohort of Polish colorectal cancer patients, did not find any association for the FokI polymorphism, however, the authors observed statistically significant correlation with the risk of CRC for the BsmI, ApaI and TaqI polymorphic loci [32]. A large meta-analysis on the VDR polymorphisms and cancer risk suggests only BsmI SNP to be associated with CRC in Caucasian population while the other three SNPs, FokI, ApaI and TaqI were not associated with CRCs [41]. Two other meta-analysis on the VDR-BsmI polymorphism also found significant association of this SNP with CRC [42–43]. Our analysis revealed VDR-BsmI polymorphism to be significantly associated with CRC in female patients, thus validating to some extent the findings from earlier studies. Gandini and colleagues reviewed 79 studies involving more than 52,000 different cancer cases and 62,000 controls to identify relevance of VDR BsmI, FokI, ApaI and TaqI polymorphism for various cancers and found BsmI, FokI and TaqI to be associated with CRC [27]. While we observed the ‘C’ allele of VDR-ApaI to confer 77% increased risk for CRC in patients >57 years of age at the time of disease diagnosis, a recent meta-analysis by Serrano et al did not identify higher risk of CRC with VDR-ApaI but found a significant association with VDR-TaqI polymorphism [44]. Several other studies did not find an association of these VDR genetic variants with colorectal cancer risk in Caucasian populations [28–30]. The discrepancies with the risk association of the VDR polymorphisms and colorectal tumors in various investigations could be due to the different genetic background of cancers where haplotype clusters might have more relevance rather than individual genotype. Ethnicity and environmental factors may also have considerable modifying effect in combination with the genetic variants towards the risk of the disease. We found significant differences in the distribution of the genotype frequencies of the VDR SNPs between Saudi Arabian population and several of the International HapMap project populations. This can in part explain the lack of association of the VDR SNPs in the overall analysis in this study compared to those who observed significant association with colorectal cancers in their populations.
The strength of the present study is that the cases and controls were from the same ethnicity and were age and gender matched. We also used a highly reliable DNA Sanger sequencing technique for detecting the genotypes of the study subjects. Limitations of this study included small sample size which may not be representative distribution of the population and hence results should be interpreted with caution without generalization. Moreover, the power to detect small effects is also likely to be decreased with smaller sample size. Although control subjects were age and gender matched, hospital-based enrollment of the participants may introduce selection bias and might be different from the population-based controls. Further, our study did not take in to account potential effect of environmental factors such as smoking, diet and exercise on the association of VDR polymorphisms and CRC risk.
In conclusion, this is the first study to assess the role of VDR polymorphism in the risk of developing colorectal cancer in Saudi Arabian population. While in the overall analysis the VDR-BsmI, FokI, ApaI and TaqI SNPs did not correlate with the susceptibility to CRC, ApaI and BsmI was significantly associated with CRC in elderly and female patients, respectively. These findings need to be validated in larger cohorts of Saudi ethnicity to predict any beneficiary role of utilizing these VDR polymorphisms as a potential screening marker for colorectal cancers in our population.
Acknowledgments
The study was funded by King Saud University, through Vice Deanship of Research Chairs.
Author Contributions
Conceived and designed the experiments: KAA OAAO AZ RH AW. Performed the experiments: ZA RH MV MA. Analyzed the data: ZHA MA. Contributed reagents/materials/analysis tools: KAA OA AZ RH AW MV MA. Wrote the paper: MA ZHA ZK.
References
- 1. Uhry Z, Belot A, Colonna M, Bossard N, Rogel A, Iwaz J, et al. National cancer incidence is estimated using the incidence/mortality ratio in countries with local incidence data: is this estimation correct? Cancer Epidemiol. 2013; 37(3):270–7. pmid:23312453
- 2. Alsanea N, Abduljabbar AS, Alhomoud S, Ashari LH, Hibbert D, Bazarbashi S. Colorectal cancer in Saudi Arabia: incidence, survival, demographics and implications for national policies. Ann Saudi Med. 2015; 35(3):196–202. pmid:26409793
- 3. Garland CF, Garland FC. Do sunlight and vitamin D reduce the likelihood of colon cancer? Int J Epidemiol. 1980; 9(3):227–31. pmid:7440046
- 4. Hussain AN, Alkhenizan AH, El Shaker M, Raef H, Gabr A. Increasing trends and significance of hypovitaminosis D: a population-based study in the Kingdom of Saudi Arabia. Arch Osteoporos. 2014; 9:190. pmid:25213798
- 5. Mohapatra S, Saxena A, Gandhi G, Koner BC, Ray PC. Vitamin D and VDR gene polymorphism (FokI) in epithelial ovarian cancer in Indian population. J Ovarian Res. 2013; 6(1):37. pmid:23705897
- 6. Sitrin MD, Halline AG, Abrahams C, Brasitus TA. Dietary calcium and vitamin D modulate 1, 2-dimethylhydrazine-induced colonic carcinogenesis in the rat. Cancer Res. 1991; 51:5608–5613. pmid:1913678
- 7. Tong WM, Kallay E, Hofer H, Hulla W, Manhardt T, Peterlik M et al. Growth regulation of human colon cancer cells by epidermal growth factor and 1, 25-dihydroxyvitamin D3 is mediated by mutual modulation of receptor expression. Eur J Cancer. 1998; 34:2119–2125. pmid:10070321
- 8. Xue L, Lipkin M, Newmark H, Wang J. Influence of dietary calcium and vitamin D on diet-induced epithelial cell hyperproliferation in mice. J Natl Cancer Inst Bethesda. 1999; 91:176–181.
- 9. Uitterlinden AG, Fang Y, Van Meurs JB, Pols HA, Van Leeuwen JP. Genetics and biology of vitamin D receptor polymorphisms. Gene. 2004; 1; 338(2):143–56. pmid:15315818
- 10. Ingles SA, Wang J, Coetzee GA, Lee ER, Frankl HD, Haile RW. Vitamin D receptor polymorphisms and risk of colorectal adenomas (United States). Cancer Causes Control. 2001; 12(7):607–14. pmid:11552708
- 11. Garland FC, Garland CF, Gorham ED, Young JF. Geographic variation in breast cancer mortality in the United States: a hypothesis involving exposure to solar radiation. Prev Med. 1990; 19(6):614–22. pmid:2263572
- 12. Lefkowitz ES, Garland CF. Sunlight, vitamin D, and ovarian cancer mortality rates in US women. Int J Epidemiol. 1994; 23(6):1133–6. pmid:7721513
- 13. Schwartz GG, Hulka BS. Is vitamin D deficiency a risk factor for prostate cancer? (Hypothesis). Anticancer Res. 1990;
- 14. Hanchette CL, Schwartz GG. Geographic patterns of prostate cancer mortality Evidence for a protective effect of ultraviolet radiation. Cancer. 1992; 70(12):2861–9. pmid:1451068
- 15. Köstner K, Denzer N, Müller CS, Klein R, Tilgen W, Reichrath J. The relevance of vitamin D receptor (VDR) gene polymorphisms for cancer: a review of the literature. Anticancer Res. 2009; 29:3511–36. pmid:19667145
- 16. Baker AR, McDonnell DP, Hughes M, Crisp TM, Mangelsdorf DJ, Haussler MR, et al. Cloning and expression of full-length cDNA encoding human vitamin D receptor. Proc Natl Acad Sci U S A. 1988; 85(10):3294–8. pmid:2835767
- 17. Perna L, Hoffmeister M, Schöttker B,Arndt V, Haug U, Holleczek B, et al. Vitamin D receptor polymorphism and colorectal cancer specific and all-cause mortality. Cancer Epidemiol. 2013; 37:905–7. pmid:24075799
- 18. Park K, Woo M, Nam J, Kim JC. Start codon polymorphisms in the vitamin D receptor and colorectal cancer risk. Cancer Lett. 2006; 237:199–206. pmid:16019132
- 19. Flugge J, Krusekopf S, Goldammer M, et al. Vitamin D receptor haplotypes protect against development of colorectal cancer. Eur J Clin Pharmacol. 2007; 63:9971005.
- 20. Kadiyska T, Yakulov T, Kaneva R, et al. Vitamin D and estrogen receptor gene polymorphisms and the risk of colorectal cancer in Bulgaria. Int J Colorectal Dis. 2007; 22:395–400. pmid:16788818
- 21. Yaylim-Eraltan I, Ergen A, Arikan S, et al. Investigation of the VDR gene polymorphisms association with susceptibility to colorectal cancer. Cell Biochem Funct. 2007; 25:731–737. pmid:17243190
- 22. Theodoratou E, Farrington SM, Tenesa A, et al. Modification of the inverse association between dietary vitamin D intake and colorectal cancer risk by a FokI variant supports a chemoprotective action of vitamin D intake mediated through VDR binding. Int J Cancer. 2008; 123:2170–2179. pmid:18709640
- 23. Ochs-Balcom HM, Cicek MS, Thompson CL, et al. Association of vitamin D receptor gene variants, adiposity and colon cancer. Carcinogenesis. 2008; 29:1788–1793. pmid:18628249
- 24. Li C, Li Y, Gao LB, et al. Vitamin D receptor gene polymorphisms and the risk of colorectal cancer in Chinese population. Dig Dis Sci. 2009; 54:634–639. pmid:18618252
- 25. Hamadien MA, Khan Z, Vaali-Mohammed MA, Zubaidi A, Al-Khayal K, McKerrow J, et al. Tumour Biol. 2015 Nov 16.
- 26. Holick MF. Vitamin D deficiency. N Engl J Med. 2007; 357(3):266–81. pmid:17634462
- 27. Gandini S, Gnagnarella P, Serrano D, Pasquali E, Raimondi S.Vitamin D receptor polymorphisms and cancer. Adv Exp Med Biol. 2014; 810:69–105. pmid:25207361
- 28. Hughes DJ, Hlavatá I, Soucek P, Pardini B, Naccarati A, Vodickova L, et al. Variation in the vitamin D receptor gene is not associated with risk of colorectal cancer in the Czech Republic. J Gastrointest Cancer. 2011; 42(3): 149–54. pmid:20585998
- 29. Kupfer SS, Anderson JR, Ludvik AE, Hooker S, Skol A, Kittles RA, et al. Genetic associations in the vitamin D receptor and colorectal cancer in African Americans and Caucasians. PLoS One. 2011; 6(10):e26123. Epub 2011 Oct 27. pmid:22046258
- 30. Bentley RW, Keown DA, Gearry RB, Cameron VA, Keenan J, Roberts RL, et al. Vitamin D receptor polymorphisms in colorectal cancer in New Zealand: an association study. N Z Med J. 2012; 125(1356): 47–51. pmid:22729058
- 31. Sarkissyan M, Wu Y, Chen Z, Mishra DK, Sarkissyan S, Giannikopoulos I, et al. Vitamin D receptor FokI gene polymorphisms may be associated with colorectal cancer among African American and Hispanic participants. Cancer. 2014; 120(9): 1387–1393. pmid:24510435
- 32. Laczmanska I, Laczmanski L, Bebenek M, Karpinski P, Czemarmazowicz H, Ramsey D, et al. Vitamin D receptor gene polymorphisms in relation to the risk of colorectal cancer in the Polish population. Tumour Biol. 2014; 35(12): 12397–12401. pmid:25195132
- 33. Takeshige N, Yin G, Ohnaka K, Kono S, Ueki T, Tanaka M, et al. Associations between vitamin D receptor (VDR) gene polymorphisms and colorectal cancer risk and effect modifications of dietary calcium and vitamin D in a Japanese population. Asian Pac J Cancer Prev. 2015; 16(5): 2019–2026. pmid:25773805
- 34. El-Hazmi MA, al-Swailem AR, Warsy AS, al-Swailem AM, Sulaimani R, al-Meshari AA. Consanguinity among the Saudi Arabian population. J Med Genet. 1995; 32(8): 623–6. pmid:7473654
- 35. El Mouzan MI, Al Salloum AA, Al Herbish AS, Qurachi MM, Al Omar AA. Consanguinity and major genetic disorders in Saudi children: a community-based cross-sectional study. Ann Saudi Med. 2008; 28(3): 169–73. pmid:18500181
- 36. Tuffaha M, El Bcheraoui C, Daoud F, Al Hussaini HA, Alamri F, Al Saeedi M, et al. Deficiencies under Plenty of Sun: Vitamin D Status among Adults in the Kingdom of Saudi Arabia, 2013. N Am J Med Sci. 2015; 7(10): 467–475. pmid:26713293
- 37. Nabi G, Hobani Y, Sarwat M. High prevalence of vitamin D deficiency and cancer in Saudi Arabian populations: Can we hypothesize a link? Med Hypotheses. 2015; 85(2): 117–119. pmid:26025591
- 38. Meeker S, Seamons A, Maggio-Price L, Paik J. Protective links between vitamins D, inflammatory bowel disease and colon cancer. World J Gastroenterol. 2016; 22(3): 933–948. pmid:26811638
- 39. Atoum MF, Tchoporyan MN. Association between circulating vitamin D, the Taq1 vitamin D receptor gene polymorphism and colorectal cancer risk among Jordanians. Asian Pac J Cancer Prev. 2014; 15(17): 7337–7341. pmid:25227839
- 40. Ma J, Stampfer MJ, Gann PH, Hough HL, Giovannucci E, Kelsey KT, et al. Vitamin D receptor polymorphisms, circulating vitamin D metabolites, and risk of prostate cancer in United States physicians. Cancer Epidemiol Biomarkers Prev. 1998;7:385–390. pmid:9610787
- 41. Xu Y, He B, Pan Y, Deng Q, Sun H, Li R, et al. Systematic review and meta-analysis on vitamin D receptor polymorphisms and cancer risk. Tumour Biol. 2014; 35(5): 4153–69. pmid:24408013
- 42. Raimondi S, Pasquali E, Gnagnarella P, Serrano D, Disalvatore D, Johansson HA, et al. BsmI polymorphism of vitamin D receptor gene and cancer risk: a comprehensive meta-analysis. Mutat Res. 2014; 769: 17–34. pmid:25771722
- 43. Yu K, Yang J, Jiang Y, Song R, Lu Q. Vitamin D receptor BsmI polymorphism and colorectal cancer risk: an updated analysis. Asian Pac J Cancer Prev. 2014; 15(12): 4801–4807. pmid:24998544
- 44. Serrano D, Gnagnarella P, Raimondi S, Gandini S. Meta-analysis on vitamin D receptor and cancer risk: focus on the role of TaqI, ApaI, and Cdx2 polymorphisms. Eur J Cancer Prev. 2016; 25(1): 85–96. pmid:25738688