Evaluation of the S-locus in Prunus domestica, characterization, phylogeny and 3D modelling

Angel Fernandez i Marti; Sarah Castro; Theodore M. DeJong; Richard S. Dodd

doi:10.1371/journal.pone.0251305

Abstract

Self-compatibility has become the primary objective of most prune (Prunus domestica) breeding programs in order to avoid the problems related to the gametophytic self-incompatibility (GSI) system present in this crop. GSI is typically under the control of a specific locus., known as the S-locus., which contains at least two genes. The first gene encodes glycoproteins with RNase activity in the pistils., and the second is an SFB gene expressed in the pollen. There is limited information on genetics of SI/SC in prune and in comparison., with other Prunus species, cloning., sequencing and discovery of different S-alleles is very scarce. Clear information about S-alleles can be used for molecular identification and characterization of the S-haplotypes. We determined the S-alleles of 36 cultivars and selections using primers that revealed 17 new alleles. In addition, our study describes for the first time the association and design of a molecular marker for self-compatibility in P. domestica. Our phylogenetic tree showed that the S-alleles are spread across the phylogeny, suggesting that like previous alleles detected in the Rosaceae., they were of trans-specific origin. We provide for the first time 3D models for the P. domestica SI RNase alleles as well as in other Prunus species, including P. salicina (Japanese plum), P. avium (cherry), P. armeniaca (apricot), P. cerasifera and P. spinosa.

Citation: Fernandez i Marti A, Castro S, DeJong TM, Dodd RS (2021) Evaluation of the S-locus in Prunus domestica, characterization, phylogeny and 3D modelling. PLoS ONE 16(5): e0251305. https://doi.org/10.1371/journal.pone.0251305

Editor: Jen-Tsung Chen, National University of Kaohsiung, TAIWAN

Received: March 15, 2021; Accepted: April 23, 2021; Published: May 13, 2021

This is an open access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication.

Funding: This research was funded in part from grants to RSD from the California Dried Plum Board (PN-17-18) and the Innovative Genomics Institute (Dodd2017RPIL). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. There was no additional external funding received for this study.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Self-incompatibility (SI) is an important biological feature of flowering plants, in which pollen-pistil interactions prevent self-fertility and determine the success of mating in out-crossed plants [1]. The mechanism takes on special significance in agricultural fruit and nut crops, where SI reduces the potential for successful fertilization in minimally genetically diverse orchards. For such species, fruit and nut breeders commonly select for self-compatibility that has the added advantage of reduced dependence on insect pollinators [2].

Prunus, which belongs to the Rosaceae, is one of the most important genera of fruit and nut trees that includes several commercially important species. Because successful fertilization is critical for fruit and nut production, the genus has been the subject of many studies of the genetic mechanisms of SI and the identification of SI groups that can aid in orchard design. Fruit production is controlled by a gametophytic SI (GSI) system that is regulated by a single polymorphic locus containing at least two linked genes; one specifically expressed in the pistil and the other in the pollen [3]. In diploid species, pollen tube growth is arrested in the style whenever the single S haplotype expressed in pollen matches one of the two S haplotypes expressed in the diploid pistil tissue [4]. The pistil component of SI in the Rosaceae, as in the Solanaceae and Plantaginaceae, is a ribonuclease, S-RNase [5, 6], which acts as a cytotoxin in self-pollen tubes, whereas the candidate gene for the pollen component in all Prunus species was identified by [7], to be a specific F-box (SFB) gene that is tightly linked to the S-RNase gene [8, 9]. However, the role of SFB proteins is not completely understood.

As would be expected for proper functioning of the GSI system, co-evolution between pollen and stigma parts of the S-locus requires mutations in one part to be complemented by mutations in the other [10], leading to expectations of high polymorphism at both loci under frequency dependent selection. Indeed, high S-RNase allelic diversity has been detected for most species studied and high pollen part polymorphism has been reported, for example in P. dulcis P. dulcis [7], P. avium [11] and in several additional Prunus spp. [11]. The pistil S-RNases are believed to be ancestral in most eudicots [12], however, diversification of the pollen S F-box proteins appears to be more taxon-dependent [7, 13–15], perhaps as a result of the rapid birth/death of F-box genes [16].

Breakdown of the GSI system results in self-compatible (SC) genotypes that are of great interest to the horticultural industry. The presence of haplotypes conferring SC has been studied in diploid Prunus species, including almond (P. dulcis), Japanese plum (P. salicina), sweet cherry (P. avium) and apricot (P. armeniaca). In most cases SC has been attributed to loss-of-pistil function or to mutations at the SFB gene. For example, in apricot and sweet cherry the SC haplotypes are hypothesized to be a pollen-part mutant in most cases [17–19]. However, the presence of a modifier locus outside the S locus has also been reported in sweet cherry, almond and apricot [20–25]. Other putative causes of SC found in Japanese plum and almond have been associated with a low transcriptional level in the S_e-RNase [26], or to epigenetic mutations in the S_f-RNase [27].

Whereas most work on GSI functioning in Prunus has focused on diploid species, several polyploid taxa are important fruit crops, including the tetraploid sour cherry (P. cerasus) and the hexaploid prune (P. domestica). Functioning of the SI system is likely to be considerably more complicated in polyploids than in diploids and appears to vary among taxonomic groups. For example, polyploidy in the Solanaceae induces a competitive interaction among alleles and the breakdown of the SI interaction with heteroallelic pollen [28]. Competitive interaction was reported by [29] for an SC selection of P. pseudocerasus that would be comparable with the Solanaceae. However, in P. cerasus [30], have shown that loss of SI is genotype dependent, rather than ploidy dependent, and that, in contrast to the Solananceae, heteroallelic pollen is SI. Detailed crossing studies between P. cerasus and the diploid P. avium support a one-allele match model, in which pollen is rejected when a functional S-haplotype occurs in both diploid pollen and tetraploid stylar tissue and so, breakdown of SI occurs when pollen contains two non-functional S-haplotypes that may be due to stylar, or pollen mutations [30, 31].

Among polyploid Prunus species, relatively little is known about the GSI system in the hexaploid prune Prunus domestica L, including a dearth of information on allelic variation at the two loci within the S haplotype. Lack of this information limits detailed characterization of germplasm, breeding efforts and appropriate orchard design. S-genotyping using consensus S-RNase primers developed in other Prunus species, has successfully identified S-RNase alleles [32–36]. However, only three S-RNase alleles have been cloned and sequences deposited in the NCBI repository (Sutherland et al., 2008), making genotyping analysis for the remaining alleles very difficult, since these are based on individual interpretations of banding patterns on gels.

In this study we use a multilevel approach that combines traditional field research with molecular gene analysis to understand variation in the S-RNase and SFB loci among cultivars and to ascertain the factors affecting reproductive success in P. domestica. This integrative approach (pollen tube growth, fruit set evaluation, PCR analysis, genomic DNA cloning/sequencing and 3D protein modelling) was undertaken in order to identify the SC haplotypes among thirty-six selections developed within the University of California, Davis prune breeding program and to characterize diversity at the S locus.

Material and methods

Plant material

Pistils and leaves from thirty-six different selections and varieties, including Improved French, Sutter, Muir Beauty and Tulare Giant, were collected from trees growing in the UC Davis prune germplasm collection during three consecutive years (2018, 2019 and 2020). Name of the cultivars and breeding selections are listed in Table 1. Some breeding selections have been derived from crosses among Improved French prune, some others are imported prune clones from France and others are traditional European plum cultivars grown in the US. The UC Davis prune breeding program currently has around 75 selected candidate cultivars for potential release, as well as thousands of seedlings that require evaluation.

Download:

Table 1. Summary of the 36 selections of P. domestica used in this study, including their origins and their detected S-RNase-genotype.

https://doi.org/10.1371/journal.pone.0251305.t001

Pollen tube growth and fruit set

Twelve of the 36 selections formed an in vitro study of self-pollination (Table 2). During three consecutive years (2018, 2019 and 2020), at least 12 flower buds a year [37] from each of the 12 seedlings were collected from the field, emasculated and placed in a tray with tap-water, allowing the contact of the flower peduncles with the tray water to prevent dehydration (Fig 1). Anthers were removed from the emasculated flowers and allowed to dry for two days. This pollen was used to self-pollinate the pistils in the tray. Ninety-six hours after pollination, the pistils were placed in tubes containing 5 ml of a 5% solution of Na₂SO₃. The samples were maintained at 4°C until observation, when they were stained with 0.1% (v/v) aniline blue in 0.1 N potassium phosphate as a specific stain for callose [38]. This growth was assessed by observation under an Olympus BH2 microscope with UV illumination with a Chiu Technical Corp with a Mercury-100 lamp. A genotype was considered SC when pollen tubes reached the base of at least 8 of the 12 styles, in a minimum of two years. In addition, a branch with a minimum of 100 flowers was bagged before bloom in the field, in order to assess the level of SC by evaluating fruit set in enclosed branches. Sets were calculated 3 months after bagging by counting the total number of fruits and were ranked according to [39], i) less than 2% = SI; ii) between 2% and 5% = low SC; iii) between 5% and 10% = SC and iv) higher than 10% = highly SC.

Download:

Fig 1. Pollen tube growth in prune flowers.

Preparation of pollen grains and drying anthers before being used to hand-pollinate the pistils (A), emasculated flowers on wet florist foam (B), pollen grains in self-pollinated flowers of prune germinating at the stigma (C), pollen tubes growing along the style (D), pollen tubes reaching the base of the style (E).

https://doi.org/10.1371/journal.pone.0251305.g001

Download:

Table 2. Data showing fruit set after bagging and pollen tube growth for three years and phenotype for SC/SI from the evaluations in the field and in the lab under microscope observations.

https://doi.org/10.1371/journal.pone.0251305.t002

Isolation of genomic DNA

In addition to the twelve selections, total DNA from twenty-four more selections was isolated from young leaves using a Qiagen DNA Kit (Qiagen, USA). The quantification and quality evaluation of DNA was performed by a Qubit spectrophotometer (Thermo Fisher Scientific, USA).

S-locus fragment analysis

Pistil S-RNase genotyping was performed using four primer pairs that have shown good transferability among other Prunus species and have revealed high diversity within the S-RNase gene [PaConsIF/PaConsIIR and PaConsIF/EMPC5-consRD [10, 37], PruT2/PCER and PruC2/PCER [40, 41]. For the pollen SFB gene, we used the primer combination Fbox5’F/FboxIntronR [42]. All primer information can be found in Table 3.

Download:

Table 3. Sequence information of the primers used and designed in this study.

https://doi.org/10.1371/journal.pone.0251305.t003

PCR reactions for the S-RNase markers were performed in a volume of 25 μl containing 1x PCR buffer, 1.5 mM MgCl₂, 0.2 mM dNTPs, 0.5 μM of each primer and 1 unit of Taq DNA Polymerase. The program consisted of a 2 min denaturation at 94°C, 35 cycles of 1 min at 94°C, 2 min at 50°C and 4 min at 68°C followed by a final extension of 10 min at 68°C. Amplification products were separated on 1% TAE agarose gel in 1X TAE buffer and stained with SYBRGreen and visualized with UV light. A 100 bp DNA ladder was used for fragment size determination.

PCR reaction for the SFB marker ‘Fbox5’F/FboxIntronR’ was performed with M13 labeled tail in its 5’ extremity (CACGACGTTGTAAAACGACA). PCR conditions were as follow, 1X buffer containing 1.5 mM MgCl₂., 0.2 mM of each dNTP, 1U Taq polymerase (New England Biolabs), 0.02 μM forward primer with M13 tail in its 5´ extremity, 0.2 μM of M13 Dye (6-Fam) primer and 0.2 μM of reverse primer. The program consisted of 94°C for 5 min; 30 cycles of 94°C for 30 s., 56°C for 45 s, and 72°C for 45 s; 8 cycles of 94°C for 30 s, 53°C for 45 s, and 72°C for 45 s; and a final elongation step at 72°C for 10 min. PCR products were detected using an ABI PRISM 3730xl Genetic Analyzer and GeneMapper analysis software (Applied Biosystems, CA, USA) located at the Evolutionary Genetics Lab (UC Berkeley).

Cloning, sequencing, primer design and analysis of the S-RNase alleles

Once the samples were genotyped, the different S-RNase alleles were gel-cut, cloned and sequenced. Prior to cloning, the band size corresponding to the target alleles was purified using the Wizard Plus Miniprep DNA Purification System (Promega, CA, USA) and quantified on 1.5% agarose gel using a standard 1 kb DNA ladder (Invitrogen, CA, USA). The purified PCR products were cloned into the vector pGEM using the Promega Cloning Kit. For each allele, at least three plasmids from different PCR reactions were sequenced from both ends following the methodology described by Fernandez i Marti et al. (2010, 2014). Plasmids were sequenced on an automated sequencer ABI PRISM 3730 Genetic Analyzer (Applied Biosystems, CA). The coding sequences from C1 to C5 of the cloned S-alleles, were translated and the deduced amino acid sequences were aligned by the ClustalX method using MegAlign Software (DNASTAR., Madison, WI, USA). S-RNase sequences obtained in this work were deposited in GenBank under accession numbers MW407935- MW407936. In order to obtain a complete coverage of the S-RNase gene, additional markers were developed by using the primer walking strategy. All primers were designed using the primer3 software [43]. Specific primers for the S₁₇ RNase allele were designed (Table 3). The PCR program consisted of an initial denaturation at 94°C for 2 min, followed by 34 cycles of denaturation at 94°C for 20 s, 40 s at 57°C, extension at 72°C for 1 min, and a final extension at 72°C for 7 min. PCRs were set up on ice under sterile conditions and the thermocycler was preheated to 94°C before adding the reactions. PCR products were run on a 1% agarose gel.

Diversity analysis and evolutionary phylogenetic analysis of S-RNase alleles

P. domestica is believed to have originated as an interspecific hybrid of a diploid P. cerasifera and a tetraploid P. spinosa; the latter species may have been an interspecific hybrid of P. cerasifera and an unknown Eurasian plum species [44]. The goal of our phylogenetic analysis was to investigate whether the origins of S-RNase alleles that we detected in P. domestica could be traced to its putative ancestors. Therefore, we obtained available GenBank sequences for 86 published SI alleles from members of subgenus Prunus sensu according to [45], see S1 Table. Sequences included S-RNase alleles from the putative parents of P. domestica (P. cerasifera and P. spinosa) as well as the diploid plum (P. salicina) and seven randomly selected alleles for other Prunus species; P. avium, P. dulcis and P. armeniaca. Six Pyrus communis L. SI-RNase alleles were used as outgroup. Protein sequences for each species, together with the alleles detected in this study for P. domestica, were aligned using ClustalW integrated within the program Geneious. The alignment was visualized and manually refined using Jalview software (www.jalview.org). Phylogenetic analyses were performed using the maximum likelihood method through RAxML 8.0 [46]. The resulting tree was visualized using FigTree v1.4.2.

Three-dimensional modelling of S-RNase proteins

The protein sequence of the P. domestica S₁₇ RNase (MW407938.1; this work), along with protein sequences obtained from the NCBI database for the SC alleles [P. dulcis S_f-RNase (QDB64273.1), P. armeniaca S_c-RNase (ABO34168.1), P. avium S_6’-RNase (AAT72120.1), P. salicina S_e-RNase (BAF91848.1)] and the SI alleles [P. domestica S₁₆-RNase (MW407946.1), P. cerasifera S₁-RNase (AM992048.1) and P. spinosa S₂₄-RNase (ABV02077.1)] were used for 3D modelling analysis. The modelling procedure began with alignment of the sequences with the related known protein sequence and crystal structure (template) derived from the Protein Data Bank (PDB). The known 3D structure was chosen based on the protein sequence identity, which had to be higher than 35% with our target genes. Sequences were aligned using the deduced protein sequences for these Prunus RNase alleles using T-Coffee (EMBL-EBI). The frame of the 3D model was constructed by MODELLER 9v24 [47]. Forty models were constructed for each S-RNase. The four models with the lowest value of the Modeller objective function were retrieved for further analysis. Energy function was evaluated through PROSAIIv3 [48].

Stereo-chemical quality and the overall G-factors of the protein models were calculated using PROCHECK [49]. The models with lower numbers of amino acid residues in disallowed regions were selected as the most suitable models. Finally, the molecular graphics of the best models were generated with PYMOL, which visualizes protein structures. Additionally, the 3D models of all S-RNases were compared with that of Pyrus pyrifolia S₃-RNase (BAA93052.1; [50]), another Rosaceous species.

Results

Phenotypic expression

In an attempt to characterize and identify the phenotypes associated with self-compatibility in P. domestica, we analyzed the pollen tube behavior in pistils under the microscope after self-pollinations.

Observations of pollen tube growth allowed classifying the phenotype of the selections as SC or SI. Out of the twelve individuals analyzed in the lab, only seven (58.3%) showed pollen tubes at the base of the style (G16N19, G5N35, H13S-58, G16N19, Sutter, Muir Beauty and Improved French). As shown in Table 2, the percentage of pistils with pollen tubes reaching the ovary was between 76% (G16N19) and 91% (Muir Beauty). Consequently, these selections were considered as self-compatible (Fig 1). In the remaining five samples, pollen tube growth was arrested in the middle third of the style of the self-pollinated pistils, and no pollen tubes were observed at the style base or in the ovary., displaying the characteristic arrest of pollen tube growth as the typical SI response (D6N-103, D18S-50, F3S-5, F13S-46 and Tulare Giant). Germinated pollen grains on the stigma were observed in all the selections.

Fruit set after bagging confirmed the SC/SI of all selections previously identified as SC/SI by pollen tube growth. Among the SC selections, five genotypes (G16N19, G5N35, Sutter, Muir Beauty and Improved French) were highly SC according to the criteria of [39] with a fruit set higher than 10%, whereas the selections G16N19 and H13S-58 are considered as SC because fruit sets were between 5% and 10% (Table 2). In addition, sets after bagging confirmed the SI phenotype for the three years of the five individuals previously classified as SI under microscopic observation since their fruit set was lower than 2% in the three years.

Genotyping, cloning and sequencing analysis of the SI alleles in P. domestica

Of all primer combinations tested for the S-RNase locus, the primer set PruC2-PCER., which flanks the second and fifth conserved domains of S-RNases, was the most successful in all the samples. The number of alleles amplified with the other primer combinations was very low and, in most cases, no more than two alleles were identified for each individual. However, the PruC2-PCER primer set yielded a multiallelic profile showing from two (Muir Beauty) to five (WN16.1) different fragments per genotype. PCR allele identification revealed seventeen different bands on the gel, including one that was common to all SC phenotypes. This high number of amplified fragments reveals the high genetic diversity for S alleles in prune. Allele sizes ranged from 350 bp (S₁₀) to 1350 bp (S₁₃). The most common alleles were S₁₇ that was common to all SC phenotypes and S₄, S₁₄, S₁₂ and S₁₁ which were observed in eight, or nine different selections (Fig 2). By contrast, allele S₁₃ was only detected in one selection (Tulare Giant). A maximum of five alleles were found in one genotype (WN16.1). The average number of alleles per individual was three (Table 1).

Download:

Fig 2. PCR amplification of 36 dried prune cultivars and selections, obtained with the primers PruC2-PCER.

Assessment of the alleles was accomplished after individual band isolation, cloning and sequencing.

https://doi.org/10.1371/journal.pone.0251305.g002

We cloned and sequenced all bands amplified by primers PruC2-PCER to identify new alleles. Once all gel-band alleles were cloned and sequenced, a “blastn” analysis was conducted in order to find nucleotide sequence similarities with other S-alleles from Prunus species present in NCBI database. For all 17 alleles, we found high sequence similarities (≥95%) with S-RNase alleles from a range of species (Table 4).

Download:

Table 4. Size in base pairs (bp) of the new S alleles discovered in this study for RNase and SFB genes and sequence similarities with S-RNase alleles from a range of species in the genus Prunus.

https://doi.org/10.1371/journal.pone.0251305.t004

PCR amplification of the intron of the pollen SFB revealed a total of fourteen different alleles within the thirty-five P. domestica genotypes for both primer combinations. The size obtained for Fbox5’F/Fbox–IntronR ranged between 192 bp and 375 bp, with the allele size 235 bp being the most common (found in 9 samples). By contrast, the SFB alleles with a size of 201, 207 and 240 were only detected in one selection.

A S-RNase allele common to self-compatible phenotypes of P. domestica

As described earlier, the S₁₇ allele was present and common to all self-compatible phenotypes but was not detected in self-incompatible selections (Table 1). Sequences of three different cloned colonies for this band in multiple individuals of Improved French and Sutter showed a nucleotide match of 100%. Within the genus Prunus, the S₁₇ allele from P. domestica showed 94% similarity with the S₅-RNase allele described for P. virginiana (JQ627793.1). We designed specific primers to amplify this allele. The new molecular marker was then used to detect presence/absence in the remainder of the selections. The primer pair produced a single band, with a size of 205 bp (Fig 3), in all genotypes that were classified as SC according to our phenotypic analyses. As expected, this new marker did not amplify any band in the SI genotypes.

Download:

Fig 3. Example of efficacy of the new S₁₇ marker tested in three SC and three SI samples.

Improved French (1), Sutter (2), Muir Beauty (3), Tulare Giant (4), 18S-50 (5) and 6N-103 (6).

https://doi.org/10.1371/journal.pone.0251305.g003

Phylogenetic tree analysis and genetic relationship among the S-RNase alleles within the Rosaceae

We inferred evolutionary relationships among the S-RNase alleles of P. domestica, and among other Prunus species (P. salicina, P. avium, P. dulcis, P. armeniaca, P. spinosa and P. cerasifera), by constructing a ML phylogenetic tree of amino acid sequences (Fig 4). The P. domestica S-RNase alleles were widely dispersed in the ML phylogenetic tree, supporting previous reports of trans-specific origins. There was no evidence that P. domestica S-RNase-alleles clustered more frequently with S-RNase-alleles of putative hybrid parents, P. spinosa and P. cerasifera, than with alleles of any of the other Prunus species.

Download:

Fig 4. Phylogenetic relationships among S-RNase alleles from Prunus species including, the 17 alleles identified in this study.

Pyrus was used as an outgroup.

https://doi.org/10.1371/journal.pone.0251305.g004

3D modelling of S-RNase proteins

We constructed 3-D models of the SC-RNase alleles of P. dulcis, P. armeniaca, P. avium and P. salicina and compared these with the SI alleles of P. domestica, P. cerasifera and P. spinosa S₂₄-RNase as well as the P. domestica S₁₇ based on related known 3D structures derived from the Protein Database (PDB). The best template model chosen was the RNase MC1 mutant with accession 1J1G, with an identity between this template and the SC P. domestica S_f-RNase of 41% (E-value = 3e^-28). The similarity to the SI P. domestica S-RNase was 40% and E-value = 9e^-32. The MC1 protein sequence has 42% identity and E-value = 4e^-33. The similarity to the S_e-RNase, S₆-RNase and S_c-RNase was 40%., 38% and 37.2%, respectively (E-value = 3e^-28, E-value = 9e^-32 and E-value = 1e^-26). The similarity and identity to P. cerasifera S-RNase and the P. spinosa S₂₄-RNase were 39% and 39.5%, with E-value = 1e^-29 and E-value = 3e^-37.

Protein structures include secondary structural elements, with α-helices from the core regions of the molecule connected by loop regions (β-sheets) on the protein surface. Our S-RNases belonged to the α and β class, with six α helices and six β sheets connected by loops. The folding topologies of the main chains, found in the models analyzed here, were very similar to the topologies of the RNase T₂ family of enzymes. The MC1 protein sequence we used as a template has eight α-helices and eight β sheets, whereas protein structures generated for the SC P. salicina, P. avium, P. spinosa, P. armeniaca and the S₁₇ P. domestica alleles had 7 α-helices and between 2 and 6 β sheets (six for P. salicina and P. spinosa; four for P. domestica and P. avium; and two for P. armeniaca). The protein structure generated in P. cerasifera, SI P. domestica and SC P. dulcis S_f-RNase was 6 α-helices and 6 β sheets, with an overall molecular dimension for each S-RNase of approximately 40 Å x 50 Å x 30 Å.

Ramachandran plot statistics showed that 95.3% of amino acid residues were positioned in the favored regions. Structures that place 95–97% or more of the amino acid residues in the favored positions, are considered to be reliable in modelling experiments. Thus, these results indicate that our models were optimal.

When all S-RNases were super positioned, the P. domestica S₁₇-RNase structure contained an additional extended loop, which was either not present or was much shorter than in the remaining SI S-RNases. When we aligned the amino acid sequences of the P. domestica S₁₇-RNase and the SI P. domestica S-RNase, we found that this long loop was associated with 17 amino acid residues (magenta loop in Fig 5) located between the conserved domains RC4 and C5 and corresponding to the sequence KRHSAQTKSGPKPLLLH. Zooming in on this 3D model structure revealed a very small loop found in the SI RNase allele in P. domestica, which had only 7 amino acids in that region of the gene (cyan loop; Fig 5).

Download:

Fig 5.

Stereo representation (a), ribbon diagram (b) and Ramachandran plot (c) of modeled structure of P. domestica S₁₇-RNase (magenta), and P. domestica SI-RNase (cyan), showing secondary structural elements and surfaces.

https://doi.org/10.1371/journal.pone.0251305.g005

Discussion

In this work, we report phenotypic expression of SI/SC and the isolation and characterization of novel S-RNase alleles in thirty-five genotypes of the hexaploid P. domestica. Also, we report on allelic variation within the SFB pollen part gene in the same selections of P. domestica.

Self-compatibility in P. domestica

To determine the status of self (in)compatibility in prunes, bagged branches and self-pollinations in the lab were conducted for three years. The phenotypes of the twelve selections were consistent using the two approaches. Pollen tube growth has been considered a clear indication of the compatibility of any pollination as it is independent of the environment where the study is done as in all cases the results have been unequivocal [51]. However, fruit set evaluation in the field is subject to many environmental hazards in spite of being the most natural approach to the real self-compatibility level of any genotype [2]. To our knowledge, this research represents the first study in P. domestica to evaluate self-compatibility for three years.

Pollen tube growth observations were robust during the three consecutive years, however, the overall number of fruit set was slightly lower in 2020 than in 2018 and 2019. It has been reported in other species such as almond and tomato, that environment may strongly affect fruit set [2, 52]. Although we observed a reduced fruit set in 2020, the sets obtained showed the ability of the flowers to set fruit with their own pollen. The studies conducted in the field show the most reliable response since they reflect the natural conditions for pollination.

Detection of S-RNase alleles

Self-incompatibility has been extensively studied in the most important diploid Prunus species, including Japanese plum, cherry, apricot and almond [19, 21, 22, 26, 41]. For initial S allele genotyping, we used SFB primers and consensus primers that amplified the S-RNase gene. These molecular markers of S-RNase and SFB loci have commonly been utilized to study the genetics of self-incompatibility in other Prunus species. For the S-RNase pistil component, we obtained reliable amplifications only with the PruC2-PCER primer combination that had been developed in sweet cherry [41]. Similar results were described by [36], where, out of all the primers tested, the PruC2-PCER primer combination was the most successful. Some of the other conserved primers were developed in almond, subgenus Amygdalus, suggesting possible low transferability to the subgenus Prunus. Although [33] suggested that primers spanning the 2^nd intron, such as PruC2, were not very informative in P. domestica due to a narrow range of amplification fragments, we were able to amplify up to five different fragments per sample. Our results agreed with previous S-genotyping analyses which revealed a high number of amplified fragments in prune by using the same primer combination [34].

We compared our S-genotyping results with phenotypical evaluations in the field and observations of pollen tube growth in pistils after self-pollinations under the microscope. In total, we detected seventeen different S-RNase alleles, one of which (S₁₇) was common and exclusive to all SC phenotypes among the thirty-five prune cultivars. The alleles we detected included the RNase of the three haplotypes (S₅, S₆ and S₉) reported by [33]. The most frequent alleles among our tested selections were S₄, S₁₁, S₁₂, S₁₄ and S₁₇ which, based on the blast analysis, had high similarities with alleles described in P. salicina, P. persica and P. virginiana. Although the similarity of our alleles was high when compared to other species (between 95% and 98%), we observed several indels and nucleotide differences. Thus, our results suggest that they can be considered as new alleles within the Rosaceae. Only the three alleles reported in P. domestica by [33] plus the alleles S₁ and S₂ that were 100% identical to S₁₇RNase and S₂₇RNase in P. salicina, have been previously published in the NCBI GenBank.

Self-compatibility in P. domestica

Approximately one third of the total cultivars and selections we analyzed (31.5%) were self-compatible and could be detected with a new molecular designed to amplify the S₁₇ allele (F11S-38, G5N-35, G16N-19, D3-39, 3-8E-46RR, Improved French, Sutter, F13S-46, Muir Beauty, 29C, and H13S-58). Many of these selections have their origin in Improved French, which is well known to be a SC variety and so these selections could have inherited the S₁₇ allele in common. Self (in)compatibility in polyploid species is likely to be considerably more complex than in diploids. The breakdown of SI in polyploid members of the Solanaceae results from competitive interaction among S alleles, such that heteroallelic pollen grains (those containing two different pollen S alleles) are compatible with stylar tissue regardless of its genetic composition [28]. However, a relationship between polyploidy and increased SC is not likely to be a general rule. Indeed, genotypic variation in SI/SC expression in the tetraploid P cerasus provides strong evidence that SC is not determined by ploidy in this species [30]. Our data with the hexaploid P. domestica, showing a mix of SI and SC genotypes, supports this latter observation that polyploidy per se is not the cause of SC in these polyploid Prunus species. The breakdown of SI in Improved French has not been investigated and could have several origins, including stylar S RNase, and pollen SFB mutations, or factors external to the S-locus. We found a 300bp fragment of the SFB intron that was associated with the SC selections and correlated with the S₁₇ RNase allele. Therefore, we cannot speculate whether the loss of SI among our selections of P. domestica may be caused by stylar or pollen mutations. Mutations in the SFB gene appear to be most common in SC diploid Prunus species e.g. P. armeniaca [17, 19], P. mume [53] and P. avium [18] whereas both stylar and pollen part mutations have been reported to cause breakdown of SI in the polyploid P. cerasus [54, 55]. SC may also be determined by a factor external to the S locus. This was suggested by [20] for the variety Cristobalina of P. avium and recent molecular studies have detected a putative modifier region. Interestingly, in Cristobalina, self-fertilized pollen tube growth is slower than cross-fertilized, suggesting a form of partial SC [20]. A modifier gene mediating the pollen part conferring SC has also been detected in Prunus armeniaca [24, 25] and in Prunus dulcis, where some genotypes lacking the SC allele had a self-compatible phenotype in the field [21].

S-RNase relationships among Prunus species including putative parents of hexaploid P. domestica

The sequence differences that we detected at the S-RNase locus agree with the hypothesis that new S-alleles may be generated by the accumulation of point mutations within the female component [56]. These genetic variations can arise from gene mutations, or from genetic recombination near introns, as suggested by [57], leading to alterations in gene activity or protein function. We found high sequence similarity (≥ 95%) for S-RNase alleles with a range of species in the genus Prunus, suggesting orthologous alleles. The ML phylogenetic tree showed no evidence that alleles detected in P. domestica were more closely associated with those of the putative parents, P. spinosa and P cerasifera than with any other of the Prunus species studied. The P. domestica alleles were spread across the phylogeny, consistent with trans-specific origins described by [58] and others [54, 55], although, as pointed out by [59], the allele origins in Prunus are not as ancient as in some other groups, such as the Solanaceae.

3-D structure of S-RNase alleles

We used PYMOL to visualize the 3-D structure of amino acid residues within the S-RNase gene. It has been proposed that loops in 3D structures serve to link α-helices and β-strands, and that longer loops could be susceptible to proteolytic degradation. The general functional differences among 3D almond SC and SI RNases involved an extended loop in the S_f-RNase [60, 61]. Furthermore, the main structural difference found in the three-dimensional models generated in this study between the SC and SI P. domestica proteins resided in the presence and length of the loop within the conserved domains RC4 and C5. When we analyzed the modeled SC proteins for the S_e-RNase of P. salicina, S_6’-RNase of P. avium and S_c-RNase of P. armeniaca, the three 3D structures also presented the same loop pattern and were similar in length to the SC P. domestica. The protein structure of the SI RNases of P. spinosa and P. cerasifera either lacked this loop., or the loop was shorter than that of the SC alleles in P. avium, P. armeniaca, P. dulcis or P. domestica. Variation in the number, lengths, and positions of α-helices, β sheets and loops seems to contribute to functional differences among S-RNases in Prunus. Although it is unknown if this long loop has a direct effect on autogamy in plants, it is interesting that all the SC S-RNases in Prunus share this unique feature.

Conclusion

This study describes for the first time a large number of S-RNase alleles in the hexaploid P. domestica. S-genotyping, cloning and sequencing allowed us to identify and characterize 17 S-RNase alleles, of which 13 are considered new and can be used for orchard design and selection of parental genotypes in prune breeding programs. In addition, our study describes for the first time the association and design of a molecular marker for self-compatibility in P. domestica. Our phylogenetic tree showed that the S-alleles, are spread across the phylogeny, indicating trans-specific origin. Three-dimensional S-RNase structures were analyzed for the first time in plum, cherry, apricot as well as in P. cerasifera and P. spinosa.

Supporting information

S1 Table. S alleles, species name and accession number for each sequence obtained from NCBI used for the construction of the phylogenetic tree in Fig 4.

https://doi.org/10.1371/journal.pone.0251305.s001

(DOCX)

S1 Raw images.

https://doi.org/10.1371/journal.pone.0251305.s002

(PDF)

Acknowledgments

AFM wants to dedicate this article to Dr. Socias i Company, who passed away last November 2020. Dr. Socias was one of the pioneers to discover the trait of SI in fruit trees, almost 50 years ago, and it is from him that AFM inherited this passion for working in tree breeding and genetics.

References

1. de Nettancourt D. Incompatibility and incongruity in wild and cultivated plants. Springer-Verlag Berlin Heidelberg. 2001.
2. Socias i Company R, Alonso JM, and Gómez-Aparisi J. Fruit set and productivity in almond as related to self-compatibility flower morphology and bud density. J Hort Sci Biotechnol. 2004. 79: 754–758.
- View Article
- Google Scholar
3. Kao TH, and Tsukamoto T. The molecular and genetic bases of S-RNase-based self-incompatibility. Plant Cell. 2004. 16: 72–3. pmid:15010517
- View Article
- PubMed/NCBI
- Google Scholar
4. de Nettancourt D. Incompatibility in angiosperms. Springer-Verlag Berlin Heidelberg New York.1977. https://doi.org/10.1007/BF00276804 pmid:24407607
5. McClure BA, Mou B. Canevascini S. and Bernatzky R. A small asparagine-rich protein required for S-allele specific pollen rejection in Nicotiana. Proc Natl Sci USA. 1999. 96:13548–13553. pmid:10557358
- View Article
- PubMed/NCBI
- Google Scholar
6. Tao R, Yamane H, Sassa H, Mori H, Gradziel TM, Dandekar AM, et al. Identification of stylar RNases associated with gametophytic self-incompatibility in almond Prunus dulcis. Plant Cell Physiol. 1997. 38: 304–311. pmid:9150603
- View Article
- PubMed/NCBI
- Google Scholar
7. Ushijima K, Sassa H, Dandekar MA, Gradziel TM, Tao R, Hirano H. Structural and transcriptional analysis of the self-incompatibility locus of almond identification of a pollen-expressed F-box gene with haplotype-specific polymorphism. Plant Cell. 2003. 15:771–781. pmid:12615948
- View Article
- PubMed/NCBI
- Google Scholar
8. Entani T, Iwano M Shiba H, Che FS, Isogai A, Takayama S. Comparative analysis of the self-incompatibility S-locus region of Prunus mune Identification of a pollen-expressed F-box gene with allelic diversity. Genes Cells. 2003. 8: 203–213. pmid:12622718
- View Article
- PubMed/NCBI
- Google Scholar
9. Ikeda K, Ushijima K, Yamane H, Tao R, Hauck NR, Sebolt AM, et al. Linkage and physical distances between the S-haplotype S-RNase and SFB genes in sweet cherry. Sex Plant Reproduction. 2005. 17: 289–296.
- View Article
- Google Scholar
10. Sutherland G, Tobutt R, and Robbins P. Trans-specific S-RNase and SFB alleles in Prunus self-incompatibility haplotypes. Mol Genet Genomics. 2008. 279: 95–106. pmid:17989997
- View Article
- PubMed/NCBI
- Google Scholar
11. Vaughan SP, Russell K, Sargent DJ, and Tobutt KR. Isolation of S-locus F-box alleles in Prunus avium and their application in a novel method to determine self-incompatibility genotype. Theor Appl Genet. 2006. 112: 856–66. pmid:16365757
- View Article
- PubMed/NCBI
- Google Scholar
12. Igic B, and Kohn JR. Evolutionary relationships among self-incompatibility RNases. Proc Natl Acad Sci USA. 2001. 98: 13167–13171. pmid:11698683
- View Article
- PubMed/NCBI
- Google Scholar
13. Kipreos E and Pagano M. The F-box protein family. Genome Biology. 2000, 1(5) pmid:11178263
- View Article
- PubMed/NCBI
- Google Scholar
14. Kubo K, Paape T, Hatakeyama M, Entani T, Takara A, Kajihara K. et al. Gene duplication and genetic exchange drive the evolution of S-RNase-based self-incompatibility in Petunia. Nat Plants. 2015. 1: 14005. pmid:27246052
- View Article
- PubMed/NCBI
- Google Scholar
15. Akagi T, Henry IM, Morimoto T, Tao R. Insights into the Prunus-specific S-RNase-based self-incompatibility system from a genome-wide analysis of the evolutionary radiation of S locus-related F-box genes. Plant Cell Physiol. 2016. 57: 1281–1294. pmid:27081098
- View Article
- PubMed/NCBI
- Google Scholar
16. Xu G, Ma H, Nei M, and Kong H. Evolution of F-box genes in plants Different modes of sequence divergence and their relationships with functional diversification. PNAS. 2009. 106: 835–840. pmid:19126682
- View Article
- PubMed/NCBI
- Google Scholar
17. Halász J, Pedryc A, and Hegedűs A. Origin and dissemination of the pollen-part mutated S C-haplotype that confers self-compatibility in apricot Prunus armeniaca. New Phytol. 2007. 176: 793–803.
- View Article
- Google Scholar
18. Marchese A, Boskovic RI, Caruso T, Raimondo A, Cutuli M, and Tobutt KR. A new self-compatibility haplotype in the sweet cherry ‘Kronio’ S5’ attributable to a pollen-part mutation in the SFB gene. J Exp Bot. 2007. 58: 4347–4356. pmid:18182436
- View Article
- PubMed/NCBI
- Google Scholar
19. Vilanova S, Badenes ML, Burgos L, Martínez-Calvo J, Llácer G, and Romero C. Self-compatibility of two apricot selections is associated with two pollen part mutations of different nature. Plant Physiol. 2006. 142: 629–641. pmid:16920873
- View Article
- PubMed/NCBI
- Google Scholar
20. Cachi AM, Hedhly A, Hormza JI, Wünsch A. Pollen tube growth in the self-compatible sweet cherry genotype ‘Cristobalina’ is slowed down after self-pollination. Ann Appl Biol.2014. 164: 73–84.
- View Article
- Google Scholar
21. Fernández i Martí A Hanada T Alonso JM Yamane H Tao R Socias i Company R. A modifier locus affecting the expression of the S-RNase gene could be the cause of breakdown of self-incompatibility in almond. Sex Plant Reprod. 2009. 22: 179–186. pmid:20033438
- View Article
- PubMed/NCBI
- Google Scholar
22. Wünsch A, and Hormaza JI. Genetic and molecular analysis in Cristobalina sweet cherry a spontaneous self-compatible mutant. Sex Plant Reprod. 2004. 17: 203–210.
- View Article
- Google Scholar
23. Wünsch A, Tao R, and Hormaza JI. Self-compatibility in ‘Cristobalina’ sweet cherry is not associated with duplications or modified transcription levels of S-locus genes. Plant Cell report. 2010. 29: 715–721.
- View Article
- Google Scholar
24. Zuriaga E, Molina L, Badenes ML, Romero C. Physical mapping of a pollen modifier locus controlling self-incompatibility in apricot and synteny analysis within the Rosaceae. Plant Mol Biol. 2012. 79: 229–242. pmid:22481163
- View Article
- PubMed/NCBI
- Google Scholar
25. Zuriaga E, Munoz-Sanz JV, Molina L, Gisbert AD, Badenes ML, Romero C. An S-locus independent pollen factor confers self-compatibility in ‘Katy’ apricot. PLoS One. 2013. 8: e53947. pmid:23342044
- View Article
- PubMed/NCBI
- Google Scholar
26. Watari A, Hanada T, Yamane H, Esumi T, Tao R, Yaegaki H et al. A low transcriptional level of Se-RNase in the Se-haplotype confers self-compatibility in Japanese plum. J Am Soc Hort Sci. 2007. 132: 396–406.
- View Article
- Google Scholar
27. Fernández i Martí A, Gradziel T, and Socias i Company R. Methylation of the S_f allele in almond is associated with S-RNase loss of function. Plant Mol Biol. 2014. 86: 681–689. pmid:25326263
- View Article
- PubMed/NCBI
- Google Scholar
28. Golz JF, Su V, Clarke AE, Newbigin E. A molecular description of mutations affecting the pollen component of the Nicotiana alata S locus. Genetics. 1999. 152: 1123–1135. pmid:10388830
- View Article
- PubMed/NCBI
- Google Scholar
29. Huang S-X, Wu H-Q, Li Y-R, Wu J, S-J Heng W, and Zhang S-L. Competitive interaction between two functional S-haplotypes confer self-compatibility on tetraploid Chinese cherry Prunus pseudocerasus LindlCV Nanjing Chuisi. Plant Cell Reports. 2008. 27:1075–1085. pmid:18327590
- View Article
- PubMed/NCBI
- Google Scholar
30. Hauck NR, Yamane H, Tao R, Iezzoni AF. Accumulation of nonfunctional S-haplotypes results in the breakdown of gametophytic self-incompatibility in tetraploid Prunus. Genetics. 2006. 172: 1191–1198. pmid:16219786
- View Article
- PubMed/NCBI
- Google Scholar
31. Tsukamoto T, Potter D, Tao R, Vieira J, and Iezzoni AF. Genetic and molecular characterization of three novel S-haplotypes in sour cherry Prunus cerasus L. Journal of Experimental Botany2008. 59: 3169–3185. pmid:18617504
- View Article
- PubMed/NCBI
- Google Scholar
32. Sutherland BG, Cerovic R Robbins TP, and Tobutt KR. The myrobolan: a useful diploid model for studying the molecular genetics of self-incompatibility in plums. Euphytica. 2009. 385–389.
- View Article
- Google Scholar
33. Sutherland BG, Robbins TP, and Tobutt KR. Primers amplifying a range of Prunus S-alleles. Plant Breed. 2004. 123: 582–584.
- View Article
- Google Scholar
34. Kota-Dombrovska I, and cis G. Evaluation of self-incompatibility locus diversity of domestic plum Prunus domestica L using DNA-based S-genotyping. Proc Latv Acad Sci B. 2013. 672–683: 109–115.
- View Article
- Google Scholar
35. Makovicss N, and Halász J. Self-incompatibility system in polyploid fruit tree species- A review. The International Journal of Plant Reproductive Biology. 2016. 8; 1.
- View Article
- Google Scholar
36. Abdallah D, Baraket G, Perez V, Ben Mustapha S, Salhi Hannachi A, Hormaza I. Analysis of self-incompatibility and genetic diversity in diploid and hexaploid plum genotypes. Front Plant Sci, 2019. pmid:31354768
- View Article
- PubMed/NCBI
- Google Scholar
37. Felipe AJ. Almendro estados fenológicos. Inf Técn Econ Agrar.1977. 27: 8–9.
- View Article
- Google Scholar
38. Linskens H. F., and Esser K. L. Über eine spezifische anfärbung der pollenschläuche im griffel und die zahl der kallosepfropfen nach selbstung und fremdung. 1957. Naturwissenschaften 44: 16.
- View Article
- Google Scholar
39. Grasselly C, Crossa-Raynaud P, Olivier G, Gall H. Transmission du caractère d’autocompatibilité chez l’amandier Amygdalus communis. Options Méditerr CIHEAM/IAMZ. 1981. 81: I71–75.
- View Article
- Google Scholar
40. Tao R, Yamane H, Sugiura A, Murayama H, Sassa H, et al. Molecular typing of S-alleles through identification characterization and cDNA cloning for S-RNases in sweet cherry. J Am Soc Hortic Sci 1999. 124: 224–233.
- View Article
- Google Scholar
41. Yamane H, and Tao R. Molecular basis of self-incompatibility and current status of S-genotyping in rosaceous fruit trees. J Jpn Soc Hortic Sci. 2009. 78:137–157.
- View Article
- Google Scholar
42. Vaughan SP, Russell K, Sargent DJ and Tobutt KR. Isolation of S-locus F-box alleles in Prunus avium and their application in a novel method to determine self-incompatibility genotype. Theor. Appl. Genet. 2006. 112, 856–66. pmid:16365757
- View Article
- PubMed/NCBI
- Google Scholar
43. Koressaar T, Lepamets M, Kaplinski L, Raime K, Andreson R, and Remm M. Primer3 marker integrating masking of template sequence with primer design software. Bioinformatics. 2018. 3411: 1937–1938.
- View Article
- Google Scholar
44. Zhebentyayeva T, Shankar V, Scorza R et al. Genetic characterization of worldwide Prunus domestica plum germplasm using sequence-based genotyping. Hortic Res. 2019. 6: 12. pmid:30603097
- View Article
- PubMed/NCBI
- Google Scholar
45. Shi S, Li J, Sun J, Yu J, and Zhou S. Phylogeny and classification of Prunus sensu lato Rosaceae. J Integr Plant Biol. 2013. 55: 1069–1079. pmid:23945216
- View Article
- PubMed/NCBI
- Google Scholar
46. Stamatakis A. RAxML version 8 a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014. 30: 1312–1313. pmid:24451623
- View Article
- PubMed/NCBI
- Google Scholar
47. Šali A. and Blundell TL. Comparative protein modelling by satisfaction of spatial restraints. J Mol Biol. 199. 234: 779–81. pmid:8254673
- View Article
- PubMed/NCBI
- Google Scholar
48. Sippl MJ. Recognition of errors in three-dimensional structures of proteins. Proteins. 1993. 17: 355–62. pmid:8108378
- View Article
- PubMed/NCBI
- Google Scholar
49. Laskowski RA, MacArthur MW, Moss DS, Thornton JM. PROCHECK—a program to check the stereochemical quality of protein structures. J Applied Crystallogr. 1993. 26: 283–91.
- View Article
- Google Scholar
50. Matsuura T., Sakai H., Unno M., Ida K., Sato M., Sakiyama F., et al. Crystal structure at 1.5 Å resolution of Pyrus pyrifolia pistil ribonuclease responsible for gametophytic self-incompatibility. J. Biol. Chem. 2001; 276:45261–45269 pmid:11577107
- View Article
- PubMed/NCBI
- Google Scholar
51. Socias i Company R, Gómez Aparisi J, and Alonso JM. Year and enclosure effects on fruit set in an autogamous almond. Scientia Horticulturae. 2005. 104: 369–377.
- View Article
- Google Scholar
52. Ganeva D, Grozeva S, and Pevicharova G. Effect of reduced irrigation on flowering fruit set and yield of indeterminate tomato. International Journal of Recent Technology and Engineering. 2014. 8: 2277–3878.
- View Article
- Google Scholar
53. Vieira J, Fonseca NA, Santos RM, Habu T, Tao R, and Vieira CP. The number age sharing and relatedness of S-locus specificities in Prunu.s Genet Res. 2008. 90: 17–26.
- View Article
- Google Scholar
54. Tsukamoto T., Hauck N.R., Tao R., Jiang N., and Iezzoni A.F. (2006). Molecular characterization of three non-functional S-haplotypes in sour cherry (Prunus cerasus). Plant Molecular Biology 62, 371. pmid:16915517
- View Article
- PubMed/NCBI
- Google Scholar
55. Tsukamoto T., Potter D., Tao R., Vieira J., and Iezzoni AF (2008). Genetic and molecular characterization of three novel S-haplotypes in sour cherry (Prunus cerasus L.). Journal of Experimental Botany 59, 3169–3185. pmid:18617504
- View Article
- PubMed/NCBI
- Google Scholar
56. Després C, Saba-El-Leil M, Rivard SR, Morse D, and Cappadocia M. Molecular cloning of two Solanum chacoense S-alleles and a hypothesis concerning their evolution. Sexual Plant Reproduction. 1994. 7: 169–176.
- View Article
- Google Scholar
57. Ortega E, Bošković R, Sargent DJ, Tobutt KR. Analysis of S-RNase alleles of almond Prunus dulcis characterization of new sequences resolution of synonyms and evidence of intragenic recombination. Mol Gen Genomics. 2006. 276: 413–426. pmid:16924547
- View Article
- PubMed/NCBI
- Google Scholar
58. Richman AD, and Kohn JR. Evolutionary genetics of self-incompatibility in the Solanaceae. Plant Molecular Biology. 2000. 42: 169–179. pmid:10688135
- View Article
- PubMed/NCBI
- Google Scholar
59. Vieira J, Fonseca NA, Santos RM, Habu T, Tao R, and Vieira CP. The number age sharing and relatedness of S-locus specificities in Prunu.s Genet Res. 2008. 90: 17–26.
- View Article
- Google Scholar
60. Fernández i Martí A, Hanada T, Alonso JM, Yamane H, Tao R, Socias i Company R. The almond S_f haplotype shows a double expression despite its comprehensive genetic identity. Scientia Hortic. 2010. 125: 685–691.
- View Article
- Google Scholar
61. Goonetilleke SN, Croxford AE, March T, Wirthensohn M, Hrmova M, and Diane E. Variation among S-locus haplotypes and among stylar RNases in almond. Scientific Reports. 2020. 10: 583. pmid:31953457
- View Article
- PubMed/NCBI
- Google Scholar
62. Sonneveld T, Tobutt KR, Vaughan P, and Robbins TP. Loss of pollen-S function in two self-compatible selections of Prunus avium is associated with deletion/mutation of a S-haplotype specific F-box gene. Plant Cell. 2006. 17, 37–51
- View Article
- Google Scholar

[ref1] 1. de Nettancourt D. Incompatibility and incongruity in wild and cultivated plants. Springer-Verlag Berlin Heidelberg. 2001.

[ref2] 2. Socias i Company R, Alonso JM, and Gómez-Aparisi J. Fruit set and productivity in almond as related to self-compatibility flower morphology and bud density. J Hort Sci Biotechnol. 2004. 79: 754–758.
View Article
Google Scholar

[3] View Article

[4] Google Scholar

[ref3] 3. Kao TH, and Tsukamoto T. The molecular and genetic bases of S-RNase-based self-incompatibility. Plant Cell. 2004. 16: 72–3. pmid:15010517
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref4] 4. de Nettancourt D. Incompatibility in angiosperms. Springer-Verlag Berlin Heidelberg New York.1977. https://doi.org/10.1007/BF00276804 pmid:24407607

[ref5] 5. McClure BA, Mou B. Canevascini S. and Bernatzky R. A small asparagine-rich protein required for S-allele specific pollen rejection in Nicotiana. Proc Natl Sci USA. 1999. 96:13548–13553. pmid:10557358
View Article
PubMed/NCBI
Google Scholar

[11] View Article

[12] PubMed/NCBI

[13] Google Scholar

[ref6] 6. Tao R, Yamane H, Sassa H, Mori H, Gradziel TM, Dandekar AM, et al. Identification of stylar RNases associated with gametophytic self-incompatibility in almond Prunus dulcis. Plant Cell Physiol. 1997. 38: 304–311. pmid:9150603
View Article
PubMed/NCBI
Google Scholar

[15] View Article

[16] PubMed/NCBI

[17] Google Scholar

[ref7] 7. Ushijima K, Sassa H, Dandekar MA, Gradziel TM, Tao R, Hirano H. Structural and transcriptional analysis of the self-incompatibility locus of almond identification of a pollen-expressed F-box gene with haplotype-specific polymorphism. Plant Cell. 2003. 15:771–781. pmid:12615948
View Article
PubMed/NCBI
Google Scholar

[19] View Article

[20] PubMed/NCBI

[21] Google Scholar

[ref8] 8. Entani T, Iwano M Shiba H, Che FS, Isogai A, Takayama S. Comparative analysis of the self-incompatibility S-locus region of Prunus mune Identification of a pollen-expressed F-box gene with allelic diversity. Genes Cells. 2003. 8: 203–213. pmid:12622718
View Article
PubMed/NCBI
Google Scholar

[23] View Article

[24] PubMed/NCBI

[25] Google Scholar

[ref9] 9. Ikeda K, Ushijima K, Yamane H, Tao R, Hauck NR, Sebolt AM, et al. Linkage and physical distances between the S-haplotype S-RNase and SFB genes in sweet cherry. Sex Plant Reproduction. 2005. 17: 289–296.
View Article
Google Scholar

[27] View Article

[28] Google Scholar

[ref10] 10. Sutherland G, Tobutt R, and Robbins P. Trans-specific S-RNase and SFB alleles in Prunus self-incompatibility haplotypes. Mol Genet Genomics. 2008. 279: 95–106. pmid:17989997
View Article
PubMed/NCBI
Google Scholar

[30] View Article

[31] PubMed/NCBI

[32] Google Scholar

[ref11] 11. Vaughan SP, Russell K, Sargent DJ, and Tobutt KR. Isolation of S-locus F-box alleles in Prunus avium and their application in a novel method to determine self-incompatibility genotype. Theor Appl Genet. 2006. 112: 856–66. pmid:16365757
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref12] 12. Igic B, and Kohn JR. Evolutionary relationships among self-incompatibility RNases. Proc Natl Acad Sci USA. 2001. 98: 13167–13171. pmid:11698683
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref13] 13. Kipreos E and Pagano M. The F-box protein family. Genome Biology. 2000, 1(5) pmid:11178263
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref14] 14. Kubo K, Paape T, Hatakeyama M, Entani T, Takara A, Kajihara K. et al. Gene duplication and genetic exchange drive the evolution of S-RNase-based self-incompatibility in Petunia. Nat Plants. 2015. 1: 14005. pmid:27246052
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref15] 15. Akagi T, Henry IM, Morimoto T, Tao R. Insights into the Prunus-specific S-RNase-based self-incompatibility system from a genome-wide analysis of the evolutionary radiation of S locus-related F-box genes. Plant Cell Physiol. 2016. 57: 1281–1294. pmid:27081098
View Article
PubMed/NCBI
Google Scholar

[50] View Article

[51] PubMed/NCBI

[52] Google Scholar

[ref16] 16. Xu G, Ma H, Nei M, and Kong H. Evolution of F-box genes in plants Different modes of sequence divergence and their relationships with functional diversification. PNAS. 2009. 106: 835–840. pmid:19126682
View Article
PubMed/NCBI
Google Scholar

[54] View Article

[55] PubMed/NCBI

[56] Google Scholar

[ref17] 17. Halász J, Pedryc A, and Hegedűs A. Origin and dissemination of the pollen-part mutated S C-haplotype that confers self-compatibility in apricot Prunus armeniaca. New Phytol. 2007. 176: 793–803.
View Article
Google Scholar

[58] View Article

[59] Google Scholar

[ref18] 18. Marchese A, Boskovic RI, Caruso T, Raimondo A, Cutuli M, and Tobutt KR. A new self-compatibility haplotype in the sweet cherry ‘Kronio’ S5’ attributable to a pollen-part mutation in the SFB gene. J Exp Bot. 2007. 58: 4347–4356. pmid:18182436
View Article
PubMed/NCBI
Google Scholar

[61] View Article

[62] PubMed/NCBI

[63] Google Scholar

[ref19] 19. Vilanova S, Badenes ML, Burgos L, Martínez-Calvo J, Llácer G, and Romero C. Self-compatibility of two apricot selections is associated with two pollen part mutations of different nature. Plant Physiol. 2006. 142: 629–641. pmid:16920873
View Article
PubMed/NCBI
Google Scholar

[65] View Article

[66] PubMed/NCBI

[67] Google Scholar

[ref20] 20. Cachi AM, Hedhly A, Hormza JI, Wünsch A. Pollen tube growth in the self-compatible sweet cherry genotype ‘Cristobalina’ is slowed down after self-pollination. Ann Appl Biol.2014. 164: 73–84.
View Article
Google Scholar

[69] View Article

[70] Google Scholar

[ref21] 21. Fernández i Martí A Hanada T Alonso JM Yamane H Tao R Socias i Company R. A modifier locus affecting the expression of the S-RNase gene could be the cause of breakdown of self-incompatibility in almond. Sex Plant Reprod. 2009. 22: 179–186. pmid:20033438
View Article
PubMed/NCBI
Google Scholar

[72] View Article

[73] PubMed/NCBI

[74] Google Scholar

[ref22] 22. Wünsch A, and Hormaza JI. Genetic and molecular analysis in Cristobalina sweet cherry a spontaneous self-compatible mutant. Sex Plant Reprod. 2004. 17: 203–210.
View Article
Google Scholar

[76] View Article

[77] Google Scholar

[ref23] 23. Wünsch A, Tao R, and Hormaza JI. Self-compatibility in ‘Cristobalina’ sweet cherry is not associated with duplications or modified transcription levels of S-locus genes. Plant Cell report. 2010. 29: 715–721.
View Article
Google Scholar

[79] View Article

[80] Google Scholar

[ref24] 24. Zuriaga E, Molina L, Badenes ML, Romero C. Physical mapping of a pollen modifier locus controlling self-incompatibility in apricot and synteny analysis within the Rosaceae. Plant Mol Biol. 2012. 79: 229–242. pmid:22481163
View Article
PubMed/NCBI
Google Scholar

[82] View Article

[83] PubMed/NCBI

[84] Google Scholar

[ref25] 25. Zuriaga E, Munoz-Sanz JV, Molina L, Gisbert AD, Badenes ML, Romero C. An S-locus independent pollen factor confers self-compatibility in ‘Katy’ apricot. PLoS One. 2013. 8: e53947. pmid:23342044
View Article
PubMed/NCBI
Google Scholar

[86] View Article

[87] PubMed/NCBI

[88] Google Scholar

[ref26] 26. Watari A, Hanada T, Yamane H, Esumi T, Tao R, Yaegaki H et al. A low transcriptional level of Se-RNase in the Se-haplotype confers self-compatibility in Japanese plum. J Am Soc Hort Sci. 2007. 132: 396–406.
View Article
Google Scholar

[90] View Article

[91] Google Scholar

[ref27] 27. Fernández i Martí A, Gradziel T, and Socias i Company R. Methylation of the S_f allele in almond is associated with S-RNase loss of function. Plant Mol Biol. 2014. 86: 681–689. pmid:25326263
View Article
PubMed/NCBI
Google Scholar

[93] View Article

[94] PubMed/NCBI

[95] Google Scholar

[ref28] 28. Golz JF, Su V, Clarke AE, Newbigin E. A molecular description of mutations affecting the pollen component of the Nicotiana alata S locus. Genetics. 1999. 152: 1123–1135. pmid:10388830
View Article
PubMed/NCBI
Google Scholar

[97] View Article

[98] PubMed/NCBI

[99] Google Scholar

[ref29] 29. Huang S-X, Wu H-Q, Li Y-R, Wu J, S-J Heng W, and Zhang S-L. Competitive interaction between two functional S-haplotypes confer self-compatibility on tetraploid Chinese cherry Prunus pseudocerasus LindlCV Nanjing Chuisi. Plant Cell Reports. 2008. 27:1075–1085. pmid:18327590
View Article
PubMed/NCBI
Google Scholar

[101] View Article

[102] PubMed/NCBI

[103] Google Scholar

[ref30] 30. Hauck NR, Yamane H, Tao R, Iezzoni AF. Accumulation of nonfunctional S-haplotypes results in the breakdown of gametophytic self-incompatibility in tetraploid Prunus. Genetics. 2006. 172: 1191–1198. pmid:16219786
View Article
PubMed/NCBI
Google Scholar

[105] View Article

[106] PubMed/NCBI

[107] Google Scholar

[ref31] 31. Tsukamoto T, Potter D, Tao R, Vieira J, and Iezzoni AF. Genetic and molecular characterization of three novel S-haplotypes in sour cherry Prunus cerasus L. Journal of Experimental Botany2008. 59: 3169–3185. pmid:18617504
View Article
PubMed/NCBI
Google Scholar

[109] View Article

[110] PubMed/NCBI

[111] Google Scholar

[ref32] 32. Sutherland BG, Cerovic R Robbins TP, and Tobutt KR. The myrobolan: a useful diploid model for studying the molecular genetics of self-incompatibility in plums. Euphytica. 2009. 385–389.
View Article
Google Scholar

[113] View Article

[114] Google Scholar

[ref33] 33. Sutherland BG, Robbins TP, and Tobutt KR. Primers amplifying a range of Prunus S-alleles. Plant Breed. 2004. 123: 582–584.
View Article
Google Scholar

[116] View Article

[117] Google Scholar

[ref34] 34. Kota-Dombrovska I, and cis G. Evaluation of self-incompatibility locus diversity of domestic plum Prunus domestica L using DNA-based S-genotyping. Proc Latv Acad Sci B. 2013. 672–683: 109–115.
View Article
Google Scholar

[119] View Article

[120] Google Scholar

[ref35] 35. Makovicss N, and Halász J. Self-incompatibility system in polyploid fruit tree species- A review. The International Journal of Plant Reproductive Biology. 2016. 8; 1.
View Article
Google Scholar

[122] View Article

[123] Google Scholar

[ref36] 36. Abdallah D, Baraket G, Perez V, Ben Mustapha S, Salhi Hannachi A, Hormaza I. Analysis of self-incompatibility and genetic diversity in diploid and hexaploid plum genotypes. Front Plant Sci, 2019. pmid:31354768
View Article
PubMed/NCBI
Google Scholar

[125] View Article

[126] PubMed/NCBI

[127] Google Scholar

[ref37] 37. Felipe AJ. Almendro estados fenológicos. Inf Técn Econ Agrar.1977. 27: 8–9.
View Article
Google Scholar

[129] View Article

[130] Google Scholar

[ref38] 38. Linskens H. F., and Esser K. L. Über eine spezifische anfärbung der pollenschläuche im griffel und die zahl der kallosepfropfen nach selbstung und fremdung. 1957. Naturwissenschaften 44: 16.
View Article
Google Scholar

[132] View Article

[133] Google Scholar

[ref39] 39. Grasselly C, Crossa-Raynaud P, Olivier G, Gall H. Transmission du caractère d’autocompatibilité chez l’amandier Amygdalus communis. Options Méditerr CIHEAM/IAMZ. 1981. 81: I71–75.
View Article
Google Scholar

[135] View Article

[136] Google Scholar

[ref40] 40. Tao R, Yamane H, Sugiura A, Murayama H, Sassa H, et al. Molecular typing of S-alleles through identification characterization and cDNA cloning for S-RNases in sweet cherry. J Am Soc Hortic Sci 1999. 124: 224–233.
View Article
Google Scholar

[138] View Article

[139] Google Scholar

[ref41] 41. Yamane H, and Tao R. Molecular basis of self-incompatibility and current status of S-genotyping in rosaceous fruit trees. J Jpn Soc Hortic Sci. 2009. 78:137–157.
View Article
Google Scholar

[141] View Article

[142] Google Scholar

[ref42] 42. Vaughan SP, Russell K, Sargent DJ and Tobutt KR. Isolation of S-locus F-box alleles in Prunus avium and their application in a novel method to determine self-incompatibility genotype. Theor. Appl. Genet. 2006. 112, 856–66. pmid:16365757
View Article
PubMed/NCBI
Google Scholar

[144] View Article

[145] PubMed/NCBI

[146] Google Scholar

[ref43] 43. Koressaar T, Lepamets M, Kaplinski L, Raime K, Andreson R, and Remm M. Primer3 marker integrating masking of template sequence with primer design software. Bioinformatics. 2018. 3411: 1937–1938.
View Article
Google Scholar

[148] View Article

[149] Google Scholar

[ref44] 44. Zhebentyayeva T, Shankar V, Scorza R et al. Genetic characterization of worldwide Prunus domestica plum germplasm using sequence-based genotyping. Hortic Res. 2019. 6: 12. pmid:30603097
View Article
PubMed/NCBI
Google Scholar

[151] View Article

[152] PubMed/NCBI

[153] Google Scholar

[ref45] 45. Shi S, Li J, Sun J, Yu J, and Zhou S. Phylogeny and classification of Prunus sensu lato Rosaceae. J Integr Plant Biol. 2013. 55: 1069–1079. pmid:23945216
View Article
PubMed/NCBI
Google Scholar

[155] View Article

[156] PubMed/NCBI

[157] Google Scholar

[ref46] 46. Stamatakis A. RAxML version 8 a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014. 30: 1312–1313. pmid:24451623
View Article
PubMed/NCBI
Google Scholar

[159] View Article

[160] PubMed/NCBI

[161] Google Scholar

[ref47] 47. Šali A. and Blundell TL. Comparative protein modelling by satisfaction of spatial restraints. J Mol Biol. 199. 234: 779–81. pmid:8254673
View Article
PubMed/NCBI
Google Scholar

[163] View Article

[164] PubMed/NCBI

[165] Google Scholar

[ref48] 48. Sippl MJ. Recognition of errors in three-dimensional structures of proteins. Proteins. 1993. 17: 355–62. pmid:8108378
View Article
PubMed/NCBI
Google Scholar

[167] View Article

[168] PubMed/NCBI

[169] Google Scholar

[ref49] 49. Laskowski RA, MacArthur MW, Moss DS, Thornton JM. PROCHECK—a program to check the stereochemical quality of protein structures. J Applied Crystallogr. 1993. 26: 283–91.
View Article
Google Scholar

[171] View Article

[172] Google Scholar

[ref50] 50. Matsuura T., Sakai H., Unno M., Ida K., Sato M., Sakiyama F., et al. Crystal structure at 1.5 Å resolution of Pyrus pyrifolia pistil ribonuclease responsible for gametophytic self-incompatibility. J. Biol. Chem. 2001; 276:45261–45269 pmid:11577107
View Article
PubMed/NCBI
Google Scholar

[174] View Article

[175] PubMed/NCBI

[176] Google Scholar

[ref51] 51. Socias i Company R, Gómez Aparisi J, and Alonso JM. Year and enclosure effects on fruit set in an autogamous almond. Scientia Horticulturae. 2005. 104: 369–377.
View Article
Google Scholar

[178] View Article

[179] Google Scholar

[ref52] 52. Ganeva D, Grozeva S, and Pevicharova G. Effect of reduced irrigation on flowering fruit set and yield of indeterminate tomato. International Journal of Recent Technology and Engineering. 2014. 8: 2277–3878.
View Article
Google Scholar

[181] View Article

[182] Google Scholar

[ref53] 53. Vieira J, Fonseca NA, Santos RM, Habu T, Tao R, and Vieira CP. The number age sharing and relatedness of S-locus specificities in Prunu.s Genet Res. 2008. 90: 17–26.
View Article
Google Scholar

[184] View Article

[185] Google Scholar

[ref54] 54. Tsukamoto T., Hauck N.R., Tao R., Jiang N., and Iezzoni A.F. (2006). Molecular characterization of three non-functional S-haplotypes in sour cherry (Prunus cerasus). Plant Molecular Biology 62, 371. pmid:16915517
View Article
PubMed/NCBI
Google Scholar

[187] View Article

[188] PubMed/NCBI

[189] Google Scholar

[ref55] 55. Tsukamoto T., Potter D., Tao R., Vieira J., and Iezzoni AF (2008). Genetic and molecular characterization of three novel S-haplotypes in sour cherry (Prunus cerasus L.). Journal of Experimental Botany 59, 3169–3185. pmid:18617504
View Article
PubMed/NCBI
Google Scholar

[191] View Article

[192] PubMed/NCBI

[193] Google Scholar

[ref56] 56. Després C, Saba-El-Leil M, Rivard SR, Morse D, and Cappadocia M. Molecular cloning of two Solanum chacoense S-alleles and a hypothesis concerning their evolution. Sexual Plant Reproduction. 1994. 7: 169–176.
View Article
Google Scholar

[195] View Article

[196] Google Scholar

[ref57] 57. Ortega E, Bošković R, Sargent DJ, Tobutt KR. Analysis of S-RNase alleles of almond Prunus dulcis characterization of new sequences resolution of synonyms and evidence of intragenic recombination. Mol Gen Genomics. 2006. 276: 413–426. pmid:16924547
View Article
PubMed/NCBI
Google Scholar

[198] View Article

[199] PubMed/NCBI

[200] Google Scholar

[ref58] 58. Richman AD, and Kohn JR. Evolutionary genetics of self-incompatibility in the Solanaceae. Plant Molecular Biology. 2000. 42: 169–179. pmid:10688135
View Article
PubMed/NCBI
Google Scholar

[202] View Article

[203] PubMed/NCBI

[204] Google Scholar

[ref59] 59. Vieira J, Fonseca NA, Santos RM, Habu T, Tao R, and Vieira CP. The number age sharing and relatedness of S-locus specificities in Prunu.s Genet Res. 2008. 90: 17–26.
View Article
Google Scholar

[206] View Article

[207] Google Scholar

[ref60] 60. Fernández i Martí A, Hanada T, Alonso JM, Yamane H, Tao R, Socias i Company R. The almond S_f haplotype shows a double expression despite its comprehensive genetic identity. Scientia Hortic. 2010. 125: 685–691.
View Article
Google Scholar

[209] View Article

[210] Google Scholar

[ref61] 61. Goonetilleke SN, Croxford AE, March T, Wirthensohn M, Hrmova M, and Diane E. Variation among S-locus haplotypes and among stylar RNases in almond. Scientific Reports. 2020. 10: 583. pmid:31953457
View Article
PubMed/NCBI
Google Scholar

[212] View Article

[213] PubMed/NCBI

[214] Google Scholar

[ref62] 62. Sonneveld T, Tobutt KR, Vaughan P, and Robbins TP. Loss of pollen-S function in two self-compatible selections of Prunus avium is associated with deletion/mutation of a S-haplotype specific F-box gene. Plant Cell. 2006. 17, 37–51
View Article
Google Scholar

[216] View Article

[217] Google Scholar

Figures

Abstract

Introduction

Material and methods

Plant material

Pollen tube growth and fruit set

Isolation of genomic DNA

S-locus fragment analysis

Cloning, sequencing, primer design and analysis of the S-RNase alleles

Diversity analysis and evolutionary phylogenetic analysis of S-RNase alleles

Three-dimensional modelling of S-RNase proteins

Results

Phenotypic expression

Genotyping, cloning and sequencing analysis of the SI alleles in P. domestica

A S-RNase allele common to self-compatible phenotypes of P. domestica

Phylogenetic tree analysis and genetic relationship among the S-RNase alleles within the Rosaceae

3D modelling of S-RNase proteins

Discussion

Self-compatibility in P. domestica

Detection of S-RNase alleles

Self-compatibility in P. domestica

S-RNase relationships among Prunus species including putative parents of hexaploid P. domestica

3-D structure of S-RNase alleles

Conclusion

Supporting information

S1 Table. S alleles, species name and accession number for each sequence obtained from NCBI used for the construction of the phylogenetic tree in Fig 4.

S1 Raw images.

Acknowledgments

References