Figures
Abstract
Camel milk is recognized as a functional food with significant economic value. Mastitis is one of the most common and costly diseases in the dairy industry. Mastitis, which is caused by pathogens such as bacteria, viruses, fungi, and algae, has an impact on the quality and quantity of milk produced as well as animal health and welfare. There is a paucity of data on the etiological factors that cause camel mastitis. This study reports the bacterial and fungal community involved in clinical camel mastitis using Illumina amplicon sequencing. A total of 25 milk samples were analyzed, including 9 samples with mastitis and 16 healthy samples. The bacterial community in healthy samples was significantly more diverse and abundant than in mastitis samples. The fungal population in mastitis samples, on the other hand, was more diverse and abundant. As compared to healthy samples, the genera Staphylococcus, Streptococcus, Schlegelella, unclassified Enterobacteriaceae, Lactococcus, Jeotgalicoccus. and Klebsiella were found to be abundant in mastitic milk. However, the genera Corynebacterium, Enteractinococcus, unclassified Sphingomonadaceae, Atopostipes, Paenibacillus, Pseudomonas, Lactobacillus, Sphingomonas, Pediococcus and Moraxella were reduced. In the fungal community, mastitis caused a significant increase in the relative abundance of the majority of taxa, including Candida, Phanerochaete, Aspergillus, Cladosporium and unclassified Pyronemataceae, while Penicillium and Alternaria showed a decline in relative abundance. In the bacterial and fungal communities, the discriminant analysis showed 19 and 5 differently abundant genera in healthy milk and mastitic milk, respectively. In conclusion, this study showed a microbiome dysbiosis linked to clinical camel mastitis, with opportunistic pathogens outgrowing commensal bacteria that were reduced. These findings are essential in designing an appropriate control program in the camel dairy herd, as well as in preventing and treating camel mastitis.
Citation: Rahmeh R, Akbar A, Alomirah H, Kishk M, Al-Ateeqi A, Shajan A, et al. (2022) Assessment of mastitis in camel using high-throughput sequencing. PLoS ONE 17(12): e0278456. https://doi.org/10.1371/journal.pone.0278456
Editor: Pierre Germon, INRAE Centre Val de Loire: Institut National de Recherche pour l’Agriculture l’Alimentation et l’Environnement Centre Val de Loire, FRANCE
Received: September 5, 2022; Accepted: November 17, 2022; Published: December 7, 2022
Copyright: © 2022 Rahmeh et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The high-throughput sequencing data have been deposited in the NCBI database under the Bioproject PRJNA814002.
Funding: This project was funded by Kuwait Foundation for the Advancement of Sciences (KFAS) under the project code PR18-12SL-16. This project was also funded by Kuwait Institute for Scientific Research (KISR) under the project code FB137C. RR received the funding for this work. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors declare that they have no competing interests.
Introduction
Dromedary camels are multipurpose animals having the ability to survive the harsh climate desert conditions. They represent about 95% of the camelid population [1]. Camels constitute an important source of milk in the world especially in Asian and African regions. The production of camel milk for human consumption was estimated to be 3.5 million tons. Camel milk is highly nutritional and deemed better than bovine milk. It is considered as functional food optimal for infant formula and for elderly. Beside its nutritional value, camel milk has therapeutic value against diabetes, asthma and jaundice [2, 3]. These traits increase the value of this milk and the local and international demand for it. As a result, camel dairy farms have been established worldwide with a steady integration into national and global economies [4, 5].
Mastitis is defined as the inflammation of the mammary gland and is considered the most critical disease in the dairy industry worldwide [6]. Mastitis can cause economic loss due to reducing milk production, deteriorated milk quality, lower probability of conception, higher treatment cost, and transmission of the disease to other species of animals [7]. Mastitis is usually epidemiologically categorized on the basis of source of infection into environmental mastitis caused by bacteria residing in the surrounding environment and contagious mastitis where the udders of the infected animal serve as a major reservoir of the pathogens which can spread from one animal to another during the milking process [8, 9].
Camels, like other dairy animals, can be affected by mastitis. This disease causes suffering for camels and poses a public health risk. According to the symptoms, mastitis in camels can also be classified as clinical or subclinical mastitis. Clinical mastitis is characterized by redness, heat and swelling of the mammary gland. However, subclinical mastitis is characterized by a lack of visible typical mastitis symptoms signs in the milk or in the udder [10, 11]. The major problems overwhelming the status of udder health in camels are tick infestation of the udder and thorny bushes, unhygienic practices, and cauterizations of the udder skin [12]. The occurrence of mastitis among lactating camels is being reported in some countries, including Somalia [13], Sudan [14], Kenya [15], and different parts of Ethiopia [16–18]. According to various studies, 45.66% of the world’s camel population suffers from mastitis, with an average prevalence of 43% in Saudi Arabia and 24% in the United Arab Emirates [19]. However, the prevalence of camel mastitis in Kuwait is not reported despite the existence of contributing risk factors of mastitis that have a strong correlation with mastitis occurrence. These factors include nomadic housing of camel and improper hygienic measures during the milking process [20].
Mastitis is a complex disease caused by infections of a variety of microorganisms. Bacterial infections are considered the primary cause of mastitis in domestic animals. However, mycotic mastitis has long been known to be caused by fungi such as Candida genus infecting the mammary gland. [21]. Mastitis-causing pathogens in dairy animals and humans were determined in several studies using culture-independent approaches. The major causes of bovine mastitis have been well-studied [6]. Furthermore, human milk microbial community in lactational mastitis has been reported [22]. However, little is known about pathogens involved in mastitis occurrence in camels using culture-independent approaches. The available information on clinical and subclinical mastitis-causing microorganisms was exclusively reported based on conventional bacteriological (culture-dependent) methods, mainly from Ethiopia [11, 16, 23–25]. Staphylococcus and Streptococcus species were shown to be the most common causes of mastitis in Ethiopia [16, 23] while Streptococcus agalactiae was the only bacterium isolated from gangrenous mastitis in dromedary camels in the United Arab Emirates [11]. Furthermore, a high prevalence of fungi was reported in camel mastitis in Saudi Arabia representing 10% of the microbial isolates including Candida, Cryptococcus, Trichosporon and Aspergillus [26]. Mycotic mastitis caused by Candida albicans has been reported in a she-camel in Ethiopia [27].
Currently, it is well-known that milk harbors a wide range of bacteria including many which cannot be identified by culturing, leaving those microorganisms undetectable [28]. Thus, metagenomics approaches have been applied to investigate the microbiome of healthy milk samples, as well as clinical and subclinical mastitis in human, bovine, and buffalo [22, 28, 29]. The application of a next-generation sequencing approach for profiling the bacterial community responsible for camel mastitis has an important impact on the clinical resolution of this disease and is essential for formulating strategies for controlling and preventing the development of this disease. Thus, the aim of this study was to identify the bacterial and fungal population involved in camel mastitis using Illumina amplicon sequencing.
Materials and methods
All experimental protocols were approved by the Center Proposal Evaluation Committee (PEC) of Kuwait Institute for scientific research. The project was approved by Kuwait Foundation for the Advancement of Sciences (KFAS) under the project code PR18-12SL-16. All methods were performed in accordance with relevant institutional guidelines and regulations in compliance with the standards of animal rights and with camel owners’ permission. Information about camels age, parity, and management are presented in S1 Table in S1 Appendix.
Sample collection
Camel milk samples were collected by manual milking of individual dromedary camels belonging to camel owners in Kuwait desert. After visual and manual examination of the camels by a certified veterinarian, based on local signs and symptoms of mastitis, sixteen samples were collected from healthy animals with no clinical signs of mastitis. Nine samples were collected from camels showing signs of mastitis (abnormal udder such as redness, heat, swelling and reduced milk yield with blood in some samples). After owner permission was given, disinfection with 70% ethylic alcohol of the udder and the teats was performed by physical scrubbing and the first drops of milk were discarded. The samples were collected into sterile containers, labeled and delivered in an icebox to the laboratory for Somatic Cell Count (SCC) and DNA extraction. The SCC for all milk samples was performed immediately upon arrival at the laboratory using a direct cell counter (DCC, DeLaval International AB). The optimum SCC threshold for healthy milk is estimated to be around 200,000 cells/ml [30, 31]. The milk samples with SCC less than 200,000 cells/ml were considered healthy milk samples.
DNA extraction
DNA extraction was performed at the same day of collection using GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich) following the manufacturer’s recommendations. Before extraction, 2 ml of milk was mixed and centrifuged at 10,000 × g for 10 min. Then, genomic DNA was extracted from the pellet. The quantity of the extracted DNA was measured using a Qubit 3.0 Fluorometer (Invitrogen).
Amplification of the 16S V3‒V4 and ITS2 regions and sequencing
Custom fusion primers were used to prepare the 16S V3‒V4 and ITS2 libraries. The custom primers included the appropriate P5/P7 Illumina adapter sequence, an 8-nt index sequence, and the gene-specific primer sequence for bacteria 341F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) or the gene-specific primer sequence for fungi ITS3 (GCATCGATGAAGAACGCAGC) and ITS4 (TCCTCCGCTTATTGATATGC). Agencourt AMPure XP beads (Beckman Coulter) were used to purify the libraries, which were validated with an Agilent Technologies 2100 bioanalyzer. Sequencing was carried out on Illumina HiSeq 2500 in 2 × 300 bp mode. The high-throughput sequencing data are available at the NCBI database under the Bioproject PRJNA814002.
Bioinformatics processing
Raw sequencing data were demultiplexed and amplicon sequence variants (ASVs) were determined with the DADA2 pipeline [32] implemented in R package dada2 v1.20.0. The BBTools package version 38.45 was used to identify and eliminate primer sequences from the 5’ and 3’ ends of input read pairs [33]. Forward and reverse reads with ≤ 2 and 4 expected errors, respectively, were retained. Contiguous sequences (contigs) were created by joining error-corrected reads with a minimum overlap of 20 base pairs. The "consensus" procedure used in DADA2 was employed to eliminate chimeric contigs that were consisted of two partial sequences of different origins. The IDTAXA approach [34] implemented in the R package DECIPHER v2.18.1 [35] was used to taxonomically classify the remaining contigs (ASVs) using the SILVA database SSU release 138 [36, 37]. ASVs with a classification confidence value ≥ 51% were retained. The R package DECIPHER was used to construct a neighbor-joining phylogenetic tree from aligned ASVs [38]. ASV copy numbers were inferred by hidden-state prediction in order to provide a better estimate of true ASV abundances, [39, 40]. Copy numbers were set to 1 for ASVs with a Nearest Sequenced Taxon Index (NSTI) > 2. ASV counts were normalized by dividing them by their respective copy numbers. To maintain the total count per sample, the result was multiplied by a sample-specific factor. Then, singletons were maintained while the counts were rounded to make them integers.
Statistical analysis
The effect of treatment on individual ASVs was tested for statistical significance by R package metagenome Seq v1.31.0 (Paulson et al., 2019) using a zero-inflated Gaussian mixture model (Paulson et al., 2013). ASVs with at least ten counts in two or more samples were considered. The effect size was expressed as log2(fold-change) of size-factor-normalized ASV counts. Log Odds Differential Abundance (log(ODA)) gives the log-odds that the abundance of the ASV differs according to the considered condition. P-values for tests within the same comparison level were adjusted using Benjamini-Hochberg correction (false discovery rate) [41].
The indices calculated with R package vegan v2.6.0 were used to measure alpha diversity as follows: Observed ASVs; Chao1 richness; ACE (Abundance-based Coverage Estimator) richness, Shannon diversity; Simpson diversity; Inverse Simpson diversity; and Effective richness 1D [42]. Descriptive variables were used for sample grouping. Rarefaction curves were produced based on observed ASVs.
Beta diversity was evaluated. R package phyloSeq v1.37.0 was used to determine the extent of change in ASV abundances across samples. A Principal Component Analysis (PCoA) was performed on both unweighted and weighted UniFrac dissimilarities [43] derived from ASV counts and phylogenetic information. R package DESeq2 v1.30.1 was used to determine the extent of change in ASV abundances across samples explained by grouping variables [44]. ASV counts were normalized by library size and transformed using the variance-stabilizing transformation (VST) [45]. Redundancy Analysis implemented in R package vegan v2.6.0 was performed on VST-transformed normalized ASV counts (ASVtrans) [42].
Using R package microbiome Marker v0.0.1.9000 [46], ASVs counts aggregated at different taxonomic ranks were subjected to linear discriminant analysis Effect Size (LEfSe) [47]. ASVs with at least ten counts in two or more samples were considered.
Results
Sequencing summary
This study included 25 milk samples collected from dromedary camels in Kuwait desert, with 16 healthy with SCC less than 200,000 cells/ml and 9 mastitis samples. The samples were sequenced in the V3-V4 region of 16S rRNA gene, resulting in 2.35 million total read pairs. A total of 1.75 million high-quality 16S rRNA gene sequences (ASVs) were retained for the samples. Of the 1.75 million ASVs with taxonomy, 63.27% were attributed to the healthy samples and 36.73% for mastitis samples. Samples exhibited a median of 167 ASVs (inter-quartile range (IQR) = 107–243). The per-sample numbers of read pairs remaining after each pipeline step are summarized in S2 Table in S1 Appendix.
The sequencing of the ITS region of eighteen samples generated 2.31 million total read pairs. A total of 1.97 million high-quality sequences were retained for the samples. Samples exhibited a median of 32 ASVs (IQR = 22–59). Of the 1.97 million ASVs with taxonomy, 80.9% were attributed to the healthy samples and 19.1% for mastitis samples. The per-sample numbers of read pairs remaining after each pipeline step are summarized in S3 Table in S1 Appendix.
Camel milk microbiota in healthy and mastitis milk samples
The bacterial community in healthy camel milk samples were classified into 26 phyla while mastitis samples comprised 16 phyla. The healthy camel milk microbiota was dominated by the phyla Proteobacteria and Firmicutes accounting for 38.14% and 34.06% of the bacterial population, respectively, followed by Actinobacteria (20.54%) and Bacteroidota (5.71%) (Table 1). Although Fusobacteriota, Patescibacteria and Deinococcota were minor phyla, they accounted for more than 0.1% of the overall bacterial population. Mastitis milk samples were dominated by the phyla proteobacteria (37.97%) and Firmicutes (40.29%). As compared to healthy milk samples, mastitis samples showed an increase in Firmicutes (40.29% vs. 34.06%) and a decrease in Actinobacteria (17.46% vs. 20.54%) and Bacteroidota (3.69% vs. 5.71%). Uncultured bacteria (bacteria that cannot be cultured using standard methods) accounted for 0.2% and 0.01% of the total bacteria in healthy and mastitis milk samples, respectively. Rare taxa, which were defined as having a mean abundance of <1% across all samples, were summarized as “others” (Fig 1).
Rare taxa with a mean abundance of <1% across all samples are summarized as “Others”. M corresponds to the mastitis samples.
At the genus level, the microbiota of healthy camel milk was dominated by Glutamicibacter (6.98%) and Schlegelella (6.74%), followed by the genera Acinetobacter (6.48%), Pseudomonas (5.9%), Lactobacillus (5.29%), Staphylococcus (5.27%), Paenibacillus (4.53%), Corynebacterium (4.02%) and Streptococcus (3.21%) (Table 2). The microbiota of mastitis camel milk was dominated by the genera Streptococcus (12.21%) and Schlegelella (11.79%) followed by the genera Staphylococcus (9.97%), uncl. Enterobacteriaceae (8.18%), Glutamicibacter (7.75%), Acinetobacter (6.06%), Pseudomonas (3.51%) and Paenibacillus (3.83%). As compared to healthy milk samples, mastitis milk microbiota was enriched in Staphylococcus (9.97% vs. 5.27%), Streptococcus (12.21% vs. 3.21%), Schlegelella (11.79% vs. 6.74%), unclassified Enterobacteriaceae (8.18% vs. 0.75%), Lactococcus (3.24% vs. 0.01), and Jeotgalicoccus (2.33% vs. 1.48%). Mastitis -was also associated with the appearance of Klebsiella genus that was not detected in the healthy milk samples. Other genera, such as Brachybacterium and Glutamicibacter also increased slightly with mastitis. However, the genera Corynebacterium, Enteractinococcus, unclassified Sphingomonadaceae, Atopostipes, Paenibacillus and Pseudomonas decreased in the mastitis milk samples. As compared to healthy milk samples, some genera were present in low abundance in the mastitis samples; these genera included Lactobacillus (0.24% vs. 5.29%) Sphingomonas (0.16% vs. 2.16%), Pediococcus and Moraxella (0.4% vs. 2.6%) (Fig 2). Taxon frequencies of the most dominant bacterial population in healthy and mastitis camel milk samples at the phylum and genus level are presented in S4 and S5 Tables in S1 Appendix, respectively. Statistical differences of the effect of mastitis on individual ASVs are presented in S6 Table in S1 Appendix.
Rare taxa with a mean abundance of <1% across all samples are summarized as “Others”. M corresponds to the mastitis samples.
LefSe was next used to explain differences between classes in healthy and mastitis groups. LEfSe analysis identified 19 differentially abundant genera in healthy and mastitis. The genera Lactobacillus, Moraxella, Pediococcus, Sphingomonas, Cutibacterium, Novosphingobium, Cnuella, unclassified Burkholderiales, Methylobacterium-Methylorubrum, Tepidimonas, Bacillus, Enterococcus, unclassified Streptococcaceae, Bergeyella, Lysobacter, TM7a, Dolosigranulum, and Clostridium sensu stricto 9 were significantly more enriched in the healthy group (P< 0.05). Alternatively, the genus Exiguobacterium was significantly more enriched in mastitis (Table 3). The effect size and statistical significance of the top ten marker taxa per sample group between healthy and mastitis groups is shown in Fig 3 and a Cladogram that represents differentially abundant microbiota at the class, order, family, and genus level between healthy and mastitis groups is shown in Fig 4.
The fungal community in healthy and mastitis camel milk samples was classified into 3 phyla, Ascomycota, Basidiomycota and Mucoromycota (Fig 5). As compared to healthy milk samples, mastitis milk microbiota was enriched in Basidiomycota (16.48% vs. 2.35%) while a decrease in the relative abundance of Ascomycota (83.44% vs. 97.3%) was observed (Table 4). At the genus level, the fungal population of healthy camel milk was dominated by the genus Penicillium (76.93%), followed by Cladosporium (4.05%) and Candida (3.89%) (Table 5). The fungal population of mastitis camel milk was dominated by the genera Penicillium (36.82%), followed by Candida (13.6%), Phanerochaete (13.32%), Cladosporium (5.15%), and Aspergillus (5.33%). In mastitic milk, a remarkable increase in the relative abundance of the majority of the genera including Candida, Phanerochaete, Aspergillus, Cladosporium and unclassified Pyronemataceae was shown. However, a decrease in the relative abundance of Penicillium and Alternaria was observed (Fig 6).
Rare taxa with a mean abundance of <1% across all samples are summarized as “Others”. M corresponds to the mastitis milk samples.
Rare taxa with a mean abundance of <1% across all samples are summarized as “Others”. M corresponds to the mastitis samples.
LEfSe analysis identified one differentially abundant genera in healthy samples while four were identified in mastitis. The genera Acremonium, Chaetomium, Wallemia, and unclassified Pleosporaceae were significantly more enriched in the mastitis group (P< 0.05). Alternatively, the genus Tylospora was significantly more enriched in the healthy group Table 6. The effect size and statistical significance of the top ten marker taxa per sample group between healthy and mastitis groups is shown in Fig 7 and a Cladogram that represents differentially abundant microbiota at the class, order, family, and genus level between healthy and mastitis groups is shown in Fig 8.
Microbial richness and diversity in healthy and mastitis milk samples
The median values of the alpha diversity indices for healthy and mastitis samples are presented in Table 7. For the bacterial population, the median values of the six indices were higher in healthy samples than in mastitis samples. Shannon and Simpson diversity indices were higher in healthy samples, indicating that the healthy samples had higher bacterial diversity compared to mastitis samples. The bacterial richness was also compared by sample group, as estimated by the Chao1 richness index. Compared to mastitis milk samples, the healthy milk samples showed greater bacterial richness. The distribution of alpha diversity measures in relation to sample groups are shown in Fig 9. However, for the fungal population, the median values of the alpha diversity indices were higher in mastitis samples indicating a high diversity and richness in mastitis samples (Fig 10). Bacterial and fungal richness were also evaluated by rarefaction curves in sample groups. For healthy and mastitis groups, the rarefaction curves for all samples were saturated and reached a plateau, suggesting that the sequencing depth was enough to capture the majority of the bacteria and fungus present in healthy and mastitis camel milk samples. Furthermore, the bacterial richness in healthy milk samples was higher compared to mastitis milk samples (Fig 11A), in contrast to the fungal population (Fig 11B).
Rarefaction curves (median values) with interquartile ranges according to sample groups for the 16S rRNA (A) and for the ITS (B).
The beta diversity analysis was then conducted to compare healthy and mastitis milk samples. The extent of change in ASVs abundances across samples was determined using unweighted and weighted UniFrac distance metrics. For the bacterial population, PCoA for unweighted UniFrac bundled 30.9% of the total variance in the first three principal coordinates. The first principal coordinate (axis 1) explained the 15.2% of the variability and the second principal coordinate (axis 2) explained the 9.2% (Fig 12A). For weighted UniFrac, PCoA bundled 63.1% of the total variance in the first three principal coordinates. Axis 1 explained the 30.7% of the variability and axis 2 explained the 15.9% (Fig 12B). For unweighted and weighted UniFrac, axis 1 and 2 separated healthy from mastitis milk samples, although with some overlaps. For the fungal population, PCoA for unweighted UniFrac bundled 47.8% of the total variance in the first three principal coordinates (Fig 12C). For weighted UniFrac, PCoA bundled 86.1% of the total variance in the first three principal coordinates (Fig 12D).
A: unweighted UniFrac for the 16S rRNA, B: weighted UniFrac the 16S rRNA. C: unweighted UniFrac for the ITS, D: weighted UniFrac the ITS.
To study the statistical effect of mastitis on the milk microbial community, a Redundancy Analysis (RDA) was performed on VST-transformed normalized ASV counts. The resulting RDA model explained 2.7% of the total variance in ASVtrans. Given the study’s small sample size, a 90% confidence interval was considered; milk bacterial community was significantly different in mastitis (RDA test; P = 0.056).
Discussion
Camel milk has nutritional value and medicinal properties against a range of diseases; hence it is gaining international recognition. Camel mastitis is a complex disease that affects the amount and quality of milk produced. Bacterial and/or fungal infections are among the etiological agents of camel mastitis. Metagenomics approaches have been applied to investigate the microbiome of healthy milk samples, as well as clinical and subclinical mastitis in human, bovine, and buffalo [22, 28, 29]. However, knowledge regarding the pathogens responsible for camel milk mastitis is limited and exclusively based on conventional bacteriological methods. Till date there are no studies reporting the microbial population associated with camel mastitis through culture-independent approaches. This study reports the first detailed characterization of milk microbiota in camel milk with mastitis as determined by 16S rRNA gene sequencing.
Many pathogens live in large communities alongside other microbes, all of which participate in intricate interactions that might influence or drive disease processes [48–50]. Some commensal bacteria might become pathogenic under the impact of several conditions, such as the actions of other microorganisms or antibiotics that cause shifts in microbiome composition [51]. As exemplified by several metagenomics studies, the microbiome of healthy individuals includes pathogenic bacteria, and a relationship was found between resident microbes and the development of disease [28, 50]. As our results indicated, the genera Staphylococcus and Streptococcus, alongside other opportunistic bacteria were also found in healthy camel milk, suggesting that the development of mastitis in camels is mainly due to an imbalance or shift in the microbial population, rather than a primary infection. We observed an increase in the abundance of Staphylococcus, Streptococcus, Schlegelella, and unclassified Enterobacteriaceae, Klebsiella, and Jeotgalicoccus associated with mastitis. These results are consistent with previous culture-based studies on camel milk microbiota where Staphylococcus and Streptococcus were shown to be the most common causes of mastitis in Ethiopia [16, 23]. Streptococcus agalactiae was the only bacterium isolated from gangrenous mastitis in dromedary camels in the United Arab Emirates [11]. Staphylococcus and Streptococcus have been also known to be the main cause of human and bovine mastitis. Staphylococcus aureus has long been thought to be the main causative agent of mastitis; nevertheless, Staphylococcus epidermidis is becoming a leading cause of subacute and acute mastitis in both humans and animals [52]. In accordance to our study, an assessment of the microbial community in human milk showed that genera including Staphylococcus and Klebsiella were significantly enriched in mastitis samples. As opposed to mastitis human milk, the genus Pseudomonas decreased in camel mastitis with no change in the Acinetobacter relative abundance [22]. Pseudomonas genus present in healthy camel milk with a relative abundance (5.9%) was also found in the core microbiota of healthy bovine and buffalo milk, with a lower relative abundance than in bovine milk (18.75%) and a higher relative abundance than in buffalo milk (1.5%) [28, 53]. The genera Jeotgalicoccus was present in the majority of the mastitis samples, this genus along with Schlegelella were found for the first time in mastitis camel milk. The genus Exiguobacterium was identified as differentially abundant genera in mastitis samples by LefSe analysis. The enriched genus Exiguobacterium was found in a previous study among the bacteria identified from subclinical mastitis milk samples of Kankrej cows in India using pyrosequencing [54]. In addition, the presence of this halophilic bacteria was previously associated with goat and sheep milk [55, 56]. It is noteworthy that this study demonstrates a diversity in camel mastitis etiology. The increase in the abundance of Staphylococcus and Streptococcus is mainly associated to two samples CM-69M and CM-70M originating from camels suffering from severe clinical mastitis. To fully understand the mastitis-causing pathogens in camels, additional investigations are required, including a large number of mastitic milk samples along with bacterial culturing.
In parallel to an increase in the opportunistic bacteria, a significant decrease in the commensal beneficial bacteria such as lactic acid bacteria (Lactobacillus, Pediococcus, Enterococcus) was observed in mastitis. These lactic acid bacteria were identified as differentially abundant genera in healthy samples by LefSe analysis. However, an increase in the Lactococcus genus was observed. Similarly, an increase in this genus was observed in water buffalo milk during mastitis [28]. Lactic acid bacteria have therapeutic properties, making them potential candidates for inclusion in a probiotic cocktail to prevent and/or treat infectious mastitis in camels [57]. The use of probiotics has piqued the curiosity of veterinarians. To treat cow mastitis, a bacteriocin-producing Lactococcus lactis was proven equally effective in vivo as a standard antibiotic treatment [58].
Fungal-related mastitis was reported previously in several studies. The incidence of this type of mastitis is usually low in dairy herds, but it has significantly increased during the last decade. Teat injuries may predispose to establishment of a fungal infection [21]. The fungal genera identified in this study, Candida, Aspergillus and Cladosporium have also been described in a previous study conducted on cows suffering from mastitis in Poland. Among fungi, Candida is the predominant cause of mycotic mastitis. Seven species of Candida were suggested as etiological agents of bovine mastitis in Poland [21]. Candida species played a pathogenic role in mycotic mastitis of cows in China [59]. Pal et al., 2015 suggested a role of Candida in mastitis of one humped camel in Ethiopia by applying standard mycological techniques [27]. The genus Aspergillus was the most predominant fungi followed by Candida in she camel mastitis in Egypt in a culture-dependent study [60]. These two genera were also isolated from goat subclinical and clinical mastitis [61–63]. Cladosporium was detected among the mycotic causes of subclinical bovine mastitis in Egypt, ovine and caprine mastitis in Nigeria, and goat mastitis in Iraq [61, 64, 65]. However, Phanerochaete genus was not previously reported in dairy animal mastitis.
The diversity and richness of the bacterial community in healthy milk samples was considerably greater than that of mastitis milk samples, according to rarefaction curves and alpha diversity indices. Our findings are consistent with previous studies that showed that the microbiome of bovine and buffalo milk in healthy samples is more diverse than that reported in mastitis [6, 28, 29]. However, we observed increased diversity and richness of the fungal population of milk from mastitis samples in comparison to healthy samples. According to the literature, in comparison to bacterial biodiversity, knowledge of fungal diversity in raw milk is limited. The beta diversity analysis showed that the percentage of variance in the first three principal coordinate for the weighted Unifrac was greater than unweighted UniFrac, suggesting that the diversity could have probably resulted from the abundance, rather than the presence/absence of ASVs.
Regarding the potential origin of the microbiota detected in camel milk of healthy and mastitis groups, the majority of the detected genera are most probably originating from the dairy environment. An extensive study was conducted to link the bacteria discovered in cow milk to their locations on the farm [66]. The genera Streptococcus, Acinetobacter, Pseudomonas, Staphylococcus, Sphingomonas, Enterobacter, Brachybacterium, Corynebacterium detected in milk, were also found in various locations throughout the farm, including teat surfaces, milking parlors, hay, air, and dust. These findings showed that intramammary infection with these bacteria is mostly induced by crossing the teat canal from extramammary sites. However, Lactococcus and Lactobacillus, two technologically important bacteria, were found in cow milk but not in the dairy environment. Other factors such as improper hygiene practices and tick infestation may predispose camels to mastitis. Tick infestation is considered one of the primary causes of bacterial pathogenicity. The genera Pseudomonas, Staphylococcus, and Jeotgalicoccus were among the wide diversity of microorganisms residing within ticks associated with camels in Saudi Arabia, highlighting the medical importance of ticks (H. dromedarii) as reservoir of pathogenic, opportunistic and symbiotic microorganisms [67].
In conclusion, this study provided an insight into the bacterial and fungal communities associated with camel mastitis. The results indicate that an imbalance or shift in the microbial population, as evidenced by an increase in the opportunistic bacteria and a considerable decrease in the commensal bacteria, is the primary cause of the development of camel mastitis. Additionally, higher bacterial diversity and richness and lower fungal diversity and richness are linked to camel mastitis. Future studies are needed to determine the fungal and bacterial pathogenesis in camel mastitis as well as the relationship between the microbiota and the factors predisposing camels to mastitis. Furthermore,
Acknowledgments
The technical assistance of omics2view in sequencing and bioinformatics analysis is gratefully acknowledged.
References
- 1. Bornstein S, Younan M. Significant veterinary research on the dromedary camels of Kenya: Past and present. J.Camelid Sci. 2013;6: 1–48.
- 2. Kumar D, Verma AK, Chatli MK, Singh R, Kumar P, Mehta N, et al. Camel milk: alternative milk for human consumption and its health benefits. Nutr Food Sci. 2016.
- 3. Swelum AA, El-Saadony MT, Abdo M, Ombarak RA, Hussein EOS, Suliman G, et al. Nutritional, antimicrobial and medicinal properties of Camel’s milk: A review. Saudi Journal of Biological Sciences. 2021;28: 3126–3136. pmid:34025186
- 4. Gossner C, Danielson N, Gervelmeyer A, Berthe F, Faye B, Kaasik Aaslav K, et al. Human–dromedary camel interactions and the risk of acquiring zoonotic Middle East respiratory syndrome coronavirus infection. Zoonoses and public health. 2016;63: 1–9. pmid:25545147
- 5. Faye B. The enthusiasm for camel production. Emirates Journal of Food and Agriculture. 2018: 249–250.
- 6. Oikonomou G, Bicalho ML, Meira E, Rossi RE, Foditsch C, Machado VS, et al. Microbiota of cow’s milk; distinguishing healthy, sub-clinically and clinically diseased quarters. PLoS One. 2014;9: e85904. pmid:24465777
- 7. Hertl JA, Grohn YT, Leach JD, Bar D, Bennett GJ, Gonzalez RN, et al. Effects of clinical mastitis caused by gram-positive and gram-negative bacteria and other organisms on the probability of conception in New York State Holstein dairy cows. J Dairy Sci. 2010;93: 1551–1560. pmid:20338432
- 8. Cervinkova D, Vlkova H, Borodacova I, Makovcova J, Babak V, Lorencova A, et al. Prevalence of mastitis pathogens in milk from clinically healthy cows. Vet Med. 2013;58: 567–575.
- 9. Klaas IC, Zadoks RN. An update on environmental mastitis: Challenging perceptions. Transboundary and emerging diseases. 2018;65: 166–185. pmid:29083115
- 10. Barbour EK, Nabbut NH, Frerichs WM, Al-Nakhli HM, Al-Mukayel AA. Mastitis in Camelus dromedarius in Saudi Arabia. Trop Anim Health Prod. 1985;17: 173–179. pmid:4060241
- 11. El Tigani-Asil, E T A, Abdelwahab GE, Veedu J T V P, Khalafalla AI, Mohamed ZSA, Ishag HZA, et al. Gangrenous mastitis in dromedary camels in UAE caused by Streptococcus agalactiae. BMC Vet Res. 2020;16: 174–8. pmid:32493341
- 12. Abdurahman O. Udder health and milk quality among camels in the Errer valley of eastern Ethiopia. Livestock Res Rural Dev. 2006;18: 32–38.
- 13. Abdurahman OA, Agab H, Abbas B, Astrom G. Relations between udder infection and somatic cells in camel (camelus dromedarius) milk. Acta Vet Scand. 1995;36: 423–431. pmid:8669370
- 14. Obied AI, Bagadi HO, Mukhtar MM. Mastitis in Camelus dromedarius and the somatic cell content of camels’ milk. Res Vet Sci. 1996;61: 55–58. pmid:8819195
- 15. Younan M, Ali Z, Bornstein S, Muller W. Application of the California mastitis test in intramammary Streptococcus agalactiae and Staphylococcus aureus infections of camels (Camelus dromedarius) in Kenya. Prev Vet Med. 2001;51: 307–316. pmid:11535287
- 16. Abera M, Abdi O, Abunna F, Megersa B. Udder health problems and major bacterial causes of camel mastitis in Jijiga, Eastern Ethiopia: implication for impacting food security. Trop Anim Health Prod. 2010;42: 341–347. pmid:19731066
- 17. Bekele T, Molla B. Mastitis in lactating camels (Camelus dromedarius) in Afar Region, north-eastern Ethiopia. Berl Munch Tierarztl Wochenschr. 2001;114: 169–172. pmid:11413707
- 18. Abdel Gadir Atif E, Hildebrandt G, Kleer JN, Molla B, Kyule MN, Baumann MP. Comparison of California Mastitis Test (CMT), Somatic Cell Counts (SCC) and bacteriological examinations for detection of camel (Camelus dromedarius) mastitis in Ethiopia. Berl Munch Tierarztl Wochenschr. 2006;119: 45–49. pmid:16450708
- 19. Aqib AI, Muzammil I, Naseer MA, Shoaib M, Bakht P, Zaheer T, et al. Pathological insights into camel mastitis. Acta Trop. 2022: 106415. pmid:35421382
- 20. Ahmad S, Yaqoob M, Bilal MQ, Khan MK, Muhammad G, Yang LG, et al. Factors affecting yield and composition of camel milk kept under desert conditions of central Punjab, Pakistan. Trop Anim Health Prod. 2012;44: 1403–1410. pmid:22270241
- 21. Dworecka-Kaszak B, Krutkiewicz A, Szopa D, Kleczkowski M, Biegańska M. High prevalence of Candida yeast in milk samples from cows suffering from mastitis in poland. The Scientific World Journal. 2012;2012.
- 22. Patel SH, Vaidya YH, Patel RJ, Pandit RJ, Joshi CG, Kunjadiya AP. Culture independent assessment of human milk microbial community in lactational mastitis. Sci Rep. 2017;7: 7804–7. pmid:28798374
- 23. Alebie A, Molla A, Adugna W, Tesfaye A, Ejo M. Prevalence, Isolation, Identification, and Risk Factors of Major Bacterial Cause of Camel Subclinical Mastitis. Biomed Res Int. 2021;2021: 5522331. pmid:34307655
- 24. Seligsohn D, Nyman AK, Younan M, Sake W, Persson Y, Bornstein S, et al. Subclinical mastitis in pastoralist dairy camel herds in Isiolo, Kenya: Prevalence, risk factors, and antimicrobial susceptibility. J Dairy Sci. 2020;103: 4717–4731. pmid:32171518
- 25. Geresu MA, Abera Leliso S, Liben GW. Camel Mastitis: Prevalence, Risk Factors, and Isolation of Major Bacterial Pathogens in Gomole District of Borena Zone, Southern Ethiopia. Vet Med Int. 2021;2021: 9993571. pmid:34567508
- 26. Al-Dughaym AM, Fadlelmula A. Prevalence, etiology and its seasonal prevalence of clinical and subclinical camel mastitis in Saudi Arabia. British Journal of Applied Science & Technology. 2015;9: 441–449.
- 27. Pal Mahendra. First Record of Camel Mastitis due to Candida albicans in Ethiopia. Indian Journal of Comparative Microbiology, Immunology and Infectious Diseases. 2015;36: 32–34.
- 28. Catozzi C, Sanchez Bonastre A, Francino O, Lecchi C, De Carlo E, Vecchio D, et al. The microbiota of water buffalo milk during mastitis. PLoS One. 2017;12: e0184710. pmid:28926595
- 29. Taponen S, McGuinness D, Hiitio H, Simojoki H, Zadoks R, Pyorala S. Bovine milk microbiome: a more complex issue than expected. Vet Res. 2019;50: 44-y. pmid:31171032
- 30. Karzis J, Donkin EF, Webb EC, Etter EM, Petzer I. Somatic cell count thresholds in composite and quarter milk samples as indicator of bovine intramammary infection status. Onderstepoort J Vet Res. 2017;84: 1–10. pmid:28397516
- 31. Schepers AJ, Lam T, Schukken YH, Wilmink J, Hanekamp W. Estimation of variance components for somatic cell counts to determine thresholds for uninfected quarters. J Dairy Sci. 1997;80: 1833–1840. pmid:9276824
- 32. Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJ, Holmes SP. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods. 2016;13: 581–583. pmid:27214047
- 33. Bushnell B. BBTools. 2019. Available: https://jgi.doe.gov/data-and-tools/bbtools/.
- 34. Murali A, Bhargava A, Wright ES. IDTAXA: a novel approach for accurate taxonomic classification of microbiome sequences. Microbiome. 2018;6: 140–5. pmid:30092815
- 35. Wright ES. Using DECIPHER v2.0 to Analyze Big Biological Sequence Data in R. The R Journal. 2016;8: 352–359.
- 36. Parks DH, Chuvochina M, Waite DW, Rinke C, Skarshewski A, Chaumeil PA, et al. A standardized bacterial taxonomy based on genome phylogeny substantially revises the tree of life. Nat Biotechnol. 2018;36: 996–1004. pmid:30148503
- 37. Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 2013;41: 590. pmid:23193283
- 38. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution. 1987;4: 406–425. pmid:3447015
- 39. Douglas GM, Maffei VJ, Zaneveld JR, Yurgel SN, Brown JR, Taylor CM, et al. PICRUSt2 for prediction of metagenome functions. Nat Biotechnol. 2020;38: 685–688. pmid:32483366
- 40. Louca S, Doebeli M. Efficient comparative phylogenetics on large trees. Bioinformatics. 2018;34: 1053–1055. pmid:29091997
- 41. Benjamini Y, Hochberg Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal statistical society: series B (Methodological). 1995;57: 289–300.
- 42. Oksanen J F. Blanchet Guillaume, Friendly Michael, Kindt Roeland, Legendre Pierre, McGlinn Dan, et al. vegan: Community Ecology Package. 2018. Available: https://github.com/vegandevs/vegan.
- 43. Lozupone CA, Hamady M, Kelley ST, Knight R. Quantitative and qualitative beta diversity measures lead to different insights into factors that structure microbial communities. Appl Environ Microbiol. 2007;73: 1576–1585. pmid:17220268
- 44. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15: 550–8. pmid:25516281
- 45. Anders S, Huber W. Differential expression analysis for sequence count data. Nature Precedings. 2010: 1. pmid:20979621
- 46. Cao Y. microbiomeMarker: Microbiome biomarker analysis. 2020. Available: https://github.com/yiluheihei/microbiomeMarker.
- 47. Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS, et al. Metagenomic biomarker discovery and explanation. Genome Biol. 2011;12: R60–r60. pmid:21702898
- 48. Chow J, Mazmanian SK. A pathobiont of the microbiota balances host colonization and intestinal inflammation. Cell Host Microbe. 2010;7: 265–276. pmid:20413095
- 49. Chow J, Tang H, Mazmanian SK. Pathobionts of the gastrointestinal microbiota and inflammatory disease. Curr Opin Immunol. 2011;23: 473–480. pmid:21856139
- 50. Vayssier-Taussat M, Albina E, Citti C, Cosson JF, Jacques MA, Lebrun MH, et al. Shifting the paradigm from pathogens to pathobiome: new concepts in the light of meta-omics. Front Cell Infect Microbiol. 2014;4: 29. pmid:24634890
- 51. Stecher B, Denzler R, Maier L, Bernet F, Sanders MJ, Pickard DJ, et al. Gut inflammation can boost horizontal gene transfer between pathogenic and commensal Enterobacteriaceae. Proc Natl Acad Sci U S A. 2012;109: 1269–1274. pmid:22232693
- 52. Delgado S, Arroyo R, Jimenez E, Marin ML, del Campo R, Fernandez L, et al. Staphylococcus epidermidis strains isolated from breast milk of women suffering infectious mastitis: potential virulence traits and resistance to antibiotics. BMC Microbiol. 2009;9: 82–82. pmid:19422689
- 53. Kuehn JS, Gorden PJ, Munro D, Rong R, Dong Q, Plummer PJ, et al. Bacterial community profiling of milk samples as a means to understand culture-negative bovine clinical mastitis. PLoS One. 2013;8: e61959. pmid:23634219
- 54. Bhanderi BB, Jhala MK, Ahir VB, Bhatt VD, Joshi CG. Cultural and metagenomic based identification of a microbiome from subclinical mastitis in cows. Veterinarski arhiv. 2014;84: 215–228.
- 55. Alegria A, Szczesny P, Mayo B, Bardowski J, Kowalczyk M. Biodiversity in Oscypek, a traditional Polish cheese, determined by culture-dependent and -independent approaches. Appl Environ Microbiol. 2012;78: 1890–1898. pmid:22247135
- 56. Callon C, Duthoit F, Delbes C, Ferrand M, Le Frileux Y, De Cremoux R, et al. Stability of microbial communities in goat milk during a lactation year: molecular approaches. Syst Appl Microbiol. 2007;30: 547–560. pmid:17604934
- 57. Bouchard DS, Seridan B, Saraoui T, Rault L, Germon P, Gonzalez-Moreno C, et al. Lactic Acid Bacteria Isolated from Bovine Mammary Microbiota: Potential Allies against Bovine Mastitis. PLoS One. 2015;10: e0144831. pmid:26713450
- 58. Klostermann K, Crispie F, Flynn J, Ross RP, Hill C, Meaney W. Intramammary infusion of a live culture of Lactococcus lactis for treatment of bovine mastitis: comparison with antibiotic treatment in field trials. J Dairy Res. 2008;75: 365–373. pmid:18680622
- 59. Du J, Wang X, Luo H, Wang Y, Liu X, Zhou X. Epidemiological investigation of non-albicans Candida species recovered from mycotic mastitis of cows in Yinchuan, Ningxia of China. BMC veterinary research. 2018;14: 1–9.
- 60. Abo Hashem M, Ibrahim S, Goda AS, Enany M. Diversity of Microorganisms Associated to She Camels’ Subclinical and Clinical Mastitis in South Sinai, Egypt. Suez Canal Veterinary Medical Journal.SCVMJ. 2020;25: 307–319.
- 61. Hasan KAM, Yassein SN. Prevalence and type of fungi in milk from goats with sub clinical mastitis. Online Journal of Veterinary Research. 2018;22: 669–674.
- 62. Carmo Priscila Maria Silva do, Uzal FA, Pedroso PM, Riet-Correa F. Conidiobolomycosis, cryptococcosis, and aspergillosis in sheep and goats: a review. Journal of Veterinary Diagnostic Investigation. 2020;32: 826–834. pmid:32921278
- 63. Jensen HE, De Los Monteros, Espinosa A, Carrasco L. Caprine mastitis due to aspergillosis and zygomycosis: a pathological and immunohistochemical study. J Comp Pathol. 1996;114: 183–191. pmid:8920218
- 64. Enany ME, EL-Attar AA, Khafagy A, EL-Gammal AM. Bacterial and mycotic causes of subclinical bovine mastitis. Suez Canal Veterinary Medicine Journal. 2007;12: 107–133.
- 65. Anueyiagu KN, Audu SK, Joshua BD, Pelumi OE, Haji SA. Prevalence and antibiogram of coliform bacteria, and occurrence of fungi in subclinical mastitis in small ruminants in Plateau State, Nigeria. Journal of Animal Science and Veterinary Medicine. 2020;5: 83–91.
- 66. Vacheyrou M, Normand AC, Guyot P, Cassagne C, Piarroux R, Bouton Y. Cultivable microbial communities in raw cow milk and potential transfers from stables of sixteen French farms. Int J Food Microbiol. 2011;146: 253–262. pmid:21429612
- 67. Alreshidi MM, Veettil VN, Noumi E, Del Campo R, Snoussi M. Description of microbial diversity associated with ticks Hyalomma dromedarii (Acari: Ixodidae) isolated from camels in Hail region (Saudi Arabia) using massive sequencing of 16S rDNA. Bioinformation. 2020;16: 602. pmid:33214748