Profiling serum immunodominance following SARS-CoV-2 primary and breakthrough infection reveals distinct variant-specific epitope usage and immune imprinting

Jeffrey Seow; George C. E. Jefferson; Michael D. Keegan; Yeuk Yau; Luke B. Snell; Katie J. Doores

doi:10.1371/journal.ppat.1012724

Abstract

Over the course of the COVID-19 pandemic, variants have emerged with increased mutations and immune evasive capabilities. This has led to breakthrough infections (BTI) in vaccinated individuals, with a large proportion of the neutralizing antibody response targeting the receptor binding domain (RBD) of the SARS-CoV-2 Spike glycoprotein. Immune imprinting, where prior exposure of the immune system to an antigen can influence the response to subsequent exposures, and its role in a population with heterogenous exposure histories has important implications in future vaccine design. Here, we develop an accessible approach to map epitope immunodominance of the neutralizing antibody response in sera. By using a panel of mutant Spike proteins in a pseudotyped virus neutralization assay, we observed distinct epitope usage in convalescent donors infected during wave 1, or infected with the Delta, or BA.1 variants, highlighting the antigenic diversity of the variant Spikes. Analysis of longitudinal serum samples taken spanning 3 doses of COVID-19 vaccine and subsequent breakthrough infection, showed the influence of immune imprinting from the ancestral-based vaccine, where reactivation of existing B cells elicited by the vaccine resulted in the enrichment of the pre-existing epitope immunodominance. However, subtle shifts in epitope usage in sera were observed following BTI by Omicron sub-lineage variants. Antigenic distance of Spike, time after last exposure, and number of vaccine boosters may play a role in the persistence of imprinting from the vaccine. This study provides insight into RBD neutralizing epitope usage in individuals with varying exposure histories and has implications for design of future SARS-CoV-2 vaccines.

Author summary

Throughout the COVID-19 pandemic, the continued emergence of new SARS-CoV-2 variants has resulted in a rise in breakthrough infections (BTIs). Infection with different variants has led to varying exposure histories in the general population. Although the neutralizing response to Spike has been thoroughly characterized, with several key epitopes identified, there is a lack of knowledge of the proportion each epitope contributes to the neutralizing response in sera and how this is affected by exposure history. Here, we use a panel of mutant Spike pseudotyped viruses to screen epitope usage and immunodominance in polyclonal sera. In a cohort of unvaccinated donors infected with different variants, distinct epitope usage was observed, highlighting the antigenic diversity between the variant Spikes. Furthermore, samples collected spanning multiple vaccine doses and BTI showed the influence of prior immunity from the vaccine on epitope usage. Although a large proportion of the immune response following BTI could be attributed to enrichment of pre-existing immunodominance from the vaccine, subtle shifts in epitope usage were observed with infection by more mutated variants. This work gives more detailed insight into differences in the neutralizing response of individuals with varying exposure histories that may inform next generation SARS-CoV-2 vaccines.

Citation: Seow J, Jefferson GCE, Keegan MD, Yau Y, Snell LB, Doores KJ (2024) Profiling serum immunodominance following SARS-CoV-2 primary and breakthrough infection reveals distinct variant-specific epitope usage and immune imprinting. PLoS Pathog 20(11): e1012724. https://doi.org/10.1371/journal.ppat.1012724

Editor: Julie Fox, National Institute of Allergy and Infectious Diseases Laboratory of Viral Diseases, UNITED STATES OF AMERICA

Received: July 12, 2024; Accepted: November 3, 2024; Published: November 18, 2024

Copyright: © 2024 Seow et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its Supporting Information files.

Funding: This work was funded by; MRC project grant ([MR/X009041/1] to KJD), MRC Genotype-to-Phenotype UK National Virology Consortium ([MR/W005611/1] and [MR/Y004205/1] to KJD), MRC grant number [MR/W025140/1] to LBS, and Wellcome funded consortium - Genotype-to-Phenotype Global ([226141/Z/22/Z] to KJD). Fondation Dormeur, Vaduz for funding equipment to KJD. KJD was supported by the Medical Research Foundation Emerging Leaders Prize 2021 (MRF-160-0016-ELP-DOOR-C0908). MK was supported by the MRC-KCL Doctoral Training Partnership in Biomedical Sciences [MR/N013700/1]. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

The SARS-CoV-2 Spike is the major target of neutralizing antibodies elicited following infection and vaccination [1]. Several distinct immunodominant epitopes have been identified on the receptor binding domain (RBD) [2–7], and to a lesser extent on the N-terminal domain (NTD) [2,8,9]. The selective pressure on the virus from the humoral immune response has driven the emergence of new variants over the course of the COVID-19 pandemic. These variants have evolved multiple mutations in Spike resulting in increased viral immune escape and enhanced transmission. For example, the recent XBB.1.5 and BA.2.75 variants have been shown to have greatly reduced neutralization by COVID-19 vaccinee sera [10,11]. Although neutralizing epitopes on Spike have been well characterized through structural analysis, the overall contribution to neutralizing activity of each epitope by antibodies in polyclonal sera have not been extensively studied [12]. The emergence of new SARS-CoV-2 variants, able to successfully evade antibody responses, has led to an increase in breakthrough infections (BTI) and a wide heterogeneity of SARS-CoV-2 exposure histories [13]. Determining the predominant neutralizing epitopes targeted on Spike (i.e. the epitope immunodominance) following different vaccination and infection histories is important for understanding the immune selective pressures on Spike and potential mutations that may arise in future SARS-CoV-2 variants of concern, as well as providing insights into potential population susceptibility to newly arising variants.

Immune imprinting is the phenomenon in which the prior exposure of the immune system to an antigen can influence the response to subsequent exposures to related antigens. Several studies have indicated that immune imprinting limits de novo antibody responses against an infecting SARS-CoV-2 variant in vaccinated donors. For example, recent studies have observed a high frequency of cross-reactive B cells and a low frequency of variant specific B cells in PBMC of individuals experiencing BTI suggesting that de novo responses specific for the infecting variant are suppressed [14–18]. Furthermore, antigenically distant variant booster vaccinations have been shown to reactivate existing B cell responses from WT vaccination, preventing the generation of variant-specific mAbs, potentially impeding immunity to emerging variants [17,19–22]. These observations are supported by an increase in antibody somatic hypermutation in donors experiencing BTI, implying continued affinity maturation of existing B cells [3,14,22,23]. Although these studies confirm the influence of immune imprinting from Wuhan-1-based vaccines on subsequent variant boosting or infection, further characterisation of this response is lacking in larger cohorts. Furthermore, how immune imprinting might be impacted by the SARS-CoV-2 variant at the time of first exposure has not been considered in great detail [24].

Several techniques have been employed to map the Spike epitopes targeted by neutralizing antibodies generated following infection and vaccination. Traditional epitope mapping by peptide array, although high-throughput, can only identify linear epitopes and therefore may miss quaternary epitopes [25]. More recent approaches include mAb isolation [2,3,23], electron microscopy polyclonal epitope mapping (EMPEM)[26], 10x genomics [14,22,27], and deep mutational scanning [28–31]. Although these approaches provide epitope mapping at high resolution, they are limited by the cohort size that can be examined, and some require access to peripheral blood mononuclear cells (PBMCs). Here, we have developed a more accessible approach to serum epitope mapping utilizing an engineered neutralization resistant Spike based on XBB.1.5 and a panel of mutated Spikes where selected epitopes were reverted back to the ancestral (wildtype, WT) sequences. Restoration of neutralization allowed identification and comparison of immunodominant epitopes targeted in sera from a primary infection cohort (including wave 1, Delta and BA.1 infections) and a longitudinal vaccination cohort (including three doses of BNT162b2 mRNA vaccine) where individuals also subsequently experienced a BTI. Using this approach, we show that primary infections with variants elicit distinct immunodominance profiles compared to a Wuhan-1 based vaccine. Additionally, the antibody response to BTI is imprinted by prior vaccination, resulting in maturation of pre-existing epitope usage. As the virus continues to evolve, understanding shifts in the immunodominant epitopes on Spike are crucial for predicting future variants and aid in the design of optimized vaccines.

Results

Design of highly immune evasive mutant XBB.1.5+Spike and virus revertant panel

Introduction of Spike mutations in the epitopes of known SARS-CoV-2 nAbs to WT Spike in pseudotyped neutralization assays has been used to identify epitopes of mAbs and map neutralization specificity in sera [20,32–34]. However, the polyclonal nature of the nAb response to SARS-CoV-2 can dampen the effect of individual point mutations on neutralization reduction. We therefore took an alternative approach where we used a highly neutralization resistant Spike as a template and generated a panel of virus Spike revertants where selected epitopes were mutated back to the ancestral strain. Rescue of serum neutralization against a revertant virus would indicate presence of neutralizing antibodies against this epitope that could be quantified.

In early 2023, XBB.1.5 was the dominant strain of SARS-CoV-2 in the UK. The Spike of XBB.1.5 differed from the ancestral Wuhan-1 Spike by 40 amino acid mutations, resulting in a large reduction (29-fold) in neutralization potency for fourth-dose monovalent mRNA vaccine sera [10,35,36]. Sequence alignment of other highly mutated endemic SARS-CoV-2 variants identified near to that time, BQ.1.1 and BA.2.75, showed similar Spike mutations to XBB.1.5 (Fig 1A) but these variants also encoded additional RBD mutations. To generate a more immune evasive strain, the K444T and L452R mutations present in BQ.1.1 and BA.2.75 were incorporated into the XBB.1.5 sequence and the Spike variant was named “XBB.1.5+”. To determine the neutralization resistance of XBB.1.5+, a small panel of vaccinee (3 doses of BNT162b2 vaccine) and BTI sera were tested against D614G, XBB.1.5 and XBB.1.5+. A 25-fold decrease in geometric mean ID₅₀ for XBB.1.5 compared to D614G was observed and further 2-fold decrease was observed for XBB.1.5+ compared to XBB.1.5 (Fig 1B).

Download:

Fig 1. Generation and validation of XBB.1.5+ mutant and virus revertant panel.

(A) Amino acid mutations present in the RBD of immune evasive SARS-CoV-2 variants Delta, BA.1, XBB.1.5, BQ.1.1 and BA.2.75, and RBD mutations present in engineered XBB.1.5+. (B) Comparison of serum neutralization ID₅₀s against D614G, XBB.1.5 and XBB.1.5+ pseudotyped virus. Sera are collected from individuals who had had 3 doses of BNT162b2 mRNA vaccine and a BTI (Kruskal-Wallis multiple comparison test, *P < 0.0332, **P < 0.0021, ***P < 0.0002, and ****P < 0.0001). Error bars indicate geometric mean (red) ± standard deviation (s.d.) (black). (C) Surface representation of the WT Spike RBD (pdb: 6XM0) with amino acids reverted back to WT indicated by coloured surface. Mutations shared in one revertant are coloured the same. A full list of mutations can be found in S2 Table. (D) Heatmap showing fold rescue of neutralization for reverted viruses compared to XBB.1.5+ for a panel SARS-CoV-2 mAbs isolated from convalescent and/or vaccinated donors [2,3,23] as well as therapeutic mAbs Sotrovimab, REGN10933 and REGN10987. mAbs were previously clustered using a competition binding ELISA into three RBD-specific competition groups [2,3,23].

https://doi.org/10.1371/journal.ppat.1012724.g001

Having identified a highly resistant Spike, primers were designed to mutate individual residues in the XBB.1.5+ template back to the amino acids present in the ancestral sequence (S1 Table). As the majority of the neutralizing activity in sera is directed against the RBD [37,38], the Spike revertants focused on mutations in RBD only. Overall, six mutated Spikes were generated by grouping together mutations in close proximity to widen the range of potential neutralization rescue whilst retaining resolution in epitope mapping (Fig 1C and S2 Table). Epitopes R-1 and R-2 were in the vicinity of the receptor binding motif (RBM) which binds to ACE2. I-1, I-2 and I-3 include epitopes on the interior face of the RBD, which are hidden when the RBD is positioned in the “down” conformation. The last epitope, O-1, was located on the outer face of RBD and is accessible when RBD is in both the “up” and “down” conformations.

Neutralization rescue of mAbs against virus revertant panel

To verify whether antibody neutralization can be rescued in the XBB.1.5+ virus revertant panel, and to gain insight into the types of serum antibodies that facilitate neutralization, monoclonal antibodies (mAbs) isolated and characterized from infected [2] and BTI [23] donors were tested (Fig 1D). This panel of mAbs have previously been categorized into epitope groups based upon competition binding assays [2,39,40]. Therapeutic mAbs Sotrovimab and Ronapreve (a cocktail containing REGN10987/Imdevimab and REGN10933/Casirivimab), whose epitopes have been defined using structural biology, were also tested. Neutralization rescue was observed for all mAbs for at least one revertant Spike. Group 3 mAbs, which have been previously shown to bind to the RBM and compete with ACE2 binding of Spike, had neutralization rescue with epitope revertant R1. This included therapeutic mAb REGN10933 for which rescue by R-1 and I-3 epitope reversions are supported by previous structural characterisation (S1A Fig) [39]. Group 1 mAbs, which bind to the interior face of RBD, were able to neutralize when interior epitopes I-1, I-2 and I-3 were reverted to WT. Group 4 mAbs, which are known to bind to the outer face of the RBD, were rescued by revertant mutant O-1.

Neutralization by REGN10987 was not rescued by any of the revertant spikes in the panel (S1B Fig), suggesting a different combination or additional reversions are needed to restore neutralization sensitivity. Sotrovimab, in contrast to the other mAbs tested, could weakly neutralize XBB.1.5+ (IC₅₀ of 0.31 μg/mL). Although Sotrovimab is known to bind the outer face of RBD (S1C Fig)[40], an increase in neutralization was observed with reversion of residues on the interior face I-1, I-2 and I-3. This suggests that the antigenic landscape of RBD and/or accessibility to neutralizing epitopes, may be influenced by mutations distal to the antibody binding site. This was also seen for several Group 3 RBM mAbs that showed neutralizing activity with reversion of residues in the distal I-1 epitope. To determine if these epitope reversions affected neutralization of mAbs binding to epitopes outside of the RBD, several NTD binding mAbs and a subdomain 1 (SD1) binding mAb [41] were tested against the revertant virus panel. Neutralization by NTD nAbs was uneffected by reversions in the RBD (S2 Fig). P008_60, an SD1 binding neutralizing antibody with modest cross-neutralization of SARS-CoV-2 variants [41] showed slightly improved neutralization when mutations on the interior of the RBD were reverted, suggesting that despite their distance from SD1, mutations occurring in XBB1.5 may impede accessibility to the SD1 epitope.

To investigate whether RBD reversion mutations influence ACE2 binding and therefore subsequent sensitivity to antibody-mediated neutralization, we determined IC₅₀ values for soluble ACE2 neutralization for the virus revertant panel (S3 Fig). A previous study has shown that higher neutralization by soluble ACE2 correlated with ACE2 binding affinity [28]. There was minimal variation in IC₅₀ values for the majority of the virus revertant panel when compared to D614G and XBB.1.5+, suggesting that similar levels of ACE2 binding between Spikes. I-3 revertant had reduced neutralization by soluble ACE2 which may be attributed to the reversion of Q498R and N501Y, both of which have been shown to increase ACE2 affinity in some variants [29]. However, all revertant Spikes gave high titres in the pseudotyped virus neutralization assay, suggesting that virus infectivity was not significantly impeded by ACE2 binding affinity.

Primary infection cohort

Having successfully generated a panel of XBB1.5+ revertant viruses we next used these as a tool to examine the epitope immunodominance following primary infection with different variants of concern (VOCs) in unvaccinated individuals (S3 Table). It has previously been observed that the variant an individual is first exposed to through infection can impact neutralization breadth of the resultant antibody response [42]. However, differences in epitope immunodominance elicited following different primary infections have not been extensively studied. Using sera from individuals infected in wave 1 or with the Delta or BA.1 variants (determined by viral sequencing), we examined differences in neutralization breadth against VOCs (Fig 2A) and the neutralization of the XBB.1.5+ revertant virus panel (Fig 2B). When considering neutralization breadth of convalescent sera against VOCs, ID₅₀ values were highest for the autologous infection variant (Fig 2A). Wave 1, and Delta convalescent sera showed a sharp drop in ID₅₀ against BA.1 highlighting the increase in antigenic distance between pre-Omicron variants and Omicron sub-lineages [43]. Equally, BA.1 convalescent sera had a 22- to 49-fold decrease in neutralization potency against pre-Omicron variants.

Download:

Fig 2. Epitope immunodominance in sera following primary infection with SARS-CoV-2 variants of concern.

(A) Cross-neutralizing activity in sera from individuals infected in either wave 1 or with Delta or BA.1. Sera were collected in the acute phase of infection (12–28 days post infection). Each dot represents one individual, and matched data points for neutralization of different VOCs by the same serum sample are connected by lines. Fold reduction in neutralization from the autologous virus is shown above each panel. (B) Fold change in ID₅₀ of revertant viruses compared to XBB.1.5+ for each individual (Fold change = ID₅₀ revertant/ID₅₀ XBB.1.5+). Individuals are grouped based on the vaccine status or infecting variant on the X-axis and divided by dotted lines. Neutralization rescue is defined by a fold change in ID₅₀ from XBB.1.5+ of greater than 2. Neutralization reduction is defined by a fold change in ID₅₀ from XBB.1.5+ less than 0.5. (Dose 3 (n = 17), wave 1 (n = 9), Delta (n = 11), BA.1 (n = 14); where n refers to number of individuals in each group). Error bars indicate geometric mean of the fold change (also shown in red above) ± s.d. (black lines) (C) Bar graph showing percentage frequency of donors showing neutralization rescue (solid fill, >2-fold change) and reduction (line pattern, <0.5-fold change).

https://doi.org/10.1371/journal.ppat.1012724.g002

To quantify and compare epitope usage in the convalescent sera, the fold change in ID₅₀ compared to XBB.1.5+ was determined for each revertant virus and these were compared to sera from individuals receiving 3-doses of BNT162b2 mRNA vaccine (Fig 2B). Comparing the geometric means of the fold change showed distinct immunodominance profiles were elicited following vaccination or primary infection by different variants. Of note, BA.1 sera showed higher neutralization of XBB.1.5+ mutant compared to the vaccinee, wave 1 and Delta groups (S4 Fig) which were reflected in lower absolute fold changes for each revertant. This was presumably due to reduced antigenic distance between XBB.1.5+ and BA.1 compared to the pre-omicron variants [43]. A fold change >1 would indicate a neutralizing epitope had been restored within the revertant Spike. This scenario is most relevant for sera from individuals vaccinated with a Wuhan-1 based vaccine or exposed to a variant more similar to Wuhan-1. In contrast, a fold-change <1 would indicate a neutralizing epitope had been removed from a revertant Spike. This scenario is most relevant for sera from individuals exposed to variants that are more similar to XBB.1.5 and was observed in BA.1 primary infection, where responses to I-3 and O-1 gave geometric mean fold changes of 0.5 and 0.6, respectively. To better capture both forms of epitope usage (i.e rescue and reduction), fold change values above 2 and below 0.5 were defined as neutralization rescue and neutralization reduction, respectively.

The percentage frequency of sera with neutralization rescue or reduction (i.e. >2 or <0.5-fold change) were grouped by epitope reversion for each variant primary infection and compared with 3-dose WT mRNA vaccine sera (Fig 2C). Each group showed distinct patterns of epitope usage. Vaccinee sera predominantly targeted the R1 and interior (I-1, I-2, and I-3) epitopes. Although the Spike sequences in wave 1 are almost identical to the vaccine strain, epitope immunodominance was skewed towards R-2 epitope instead of R-1. The reduced R-1 epitope usage in infection sera may suggest a difference in Spike/RBD presentation on the virus surface compared to the vaccine encoded Spike that may be attributed to the stabilising mutations introduced. A skewing towards R-2 and to a lesser extent R-1 and O-1 was observed in Delta convalescent sera with little response against interior epitopes (I-1, I-2 and I-3) suggesting a narrower response. Interestingly, neutralization reduction was seen for O-1 which reverts the mutation at position 452 which is naturally present in Delta Spike and may suggest presence of nAbs dependent on amino acid R452. Primary infection by the more antigenically distant BA.1 elicited an immune response primarily targeting the interior epitopes of RBD and to a lesser extent O-1. However, whilst I-2 showed increased neutralization, I-1, I-3 and O-1 showed decreased neutralization. The I-1, I-3 and O-1 revertants encode mutations at positions 417, 498/501/505, and 339/440, respectively that are naturally present in BA.1 and may therefore also indicate presence of antibodies targeting BA.1 specific residues/epitopes. Overall, the variant responsible for primary infection strongly influences the neutralizing epitopes targeted on Spike.

Immune imprinting from vaccination influences BTI immunodominance

We next sought to understand how prior vaccination might influence the immune response to variant infection. To study this, neutralization activity against the virus revertant panel was determined for longitudinal serum samples collected from individuals following their 2^nd and 3^rd doses of mRNA vaccine, as well as 3–4 weeks and 6 months post BTI (Fig 3A and S3 Table)[44]. Results were first assessed by examining the fold change in neutralization potency for each revertant virus compared to XBB.1.5+ over time (Fig 3A). The average fold rescue after two vaccine doses was generally low, with R-1, I-1 and I-2 showing the largest rescue (range 1.8–2.2). However, there was an increase in neutralization rescue between the 2^nd and 3^rd vaccine dose for all revertants, except O-1. The RBM revertant R-1 and all interior RBD revertants (I-1, I-2 and I-3) had neutralization rescue greater than 2-fold (geometric mean). Following BTI, there was increased heterogeneity in the responses between individuals. When considering the average fold change in neutralization for each revertant, the R-1 epitope was the most immunodominant with a geometric mean fold change of 4.5 after BTI. Epitopes R-2 and O-1 had the lowest neutralization rescue, suggesting these regions were not major targets of the neutralizing response after vaccination and BTI.

Download:

Fig 3. Epitope immunodominance and immune imprinting in sera following mRNA vaccination and BTI.

(A) Fold change in ID₅₀ of revertant viruses compared to XBB.1.5+ for sera collected following 2- and 3- vaccine doses and 3–4 weeks and 6 months following BTI. Grey lines are donor-matched ID₅₀ across four different time points. Geometric mean fold changes are shown at the top of each panel and as red lines. (B) Comparison of the fold change in ID₅₀ of revertant viruses compared to XBB.1.5+ for individuals grouped by presumed BTI variant or known vaccine status. Bars indicate geometric mean fold change across all individuals in the group. Error bars indicate geometric mean ± s.d. (Dose 2 (n = 17), Dose 3 (n = 17), Delta BTI (n = 8), BA.1 BTI (n = 10), BA.2 BTI (n = 6), BA.5 BTI (n = 5); where n refers to number of individuals in each group).

https://doi.org/10.1371/journal.ppat.1012724.g003

Antigenic distance and time post-exposure may override immune imprinting

As analysis of timepoints post BTI had shown increased heterogeneity, the cohort was regrouped based upon the variant that led to the BTI (determined based on date of positive COVID-19 test). This revealed distinct patterns of epitope usage between infecting variants (Fig 3B). The patterns of neutralization rescue following Delta and BA.1 BTI were similar to that of sera following 2- or 3- doses of vaccine. These sera had R-1 being the most immunodominant epitope and to a lesser extent I-1 and I-2. Sera from individuals with BTI from the more antigenically distant variants, BA.2 and BA.5, showed a shift in immunodominance compared to the vaccine groups (Dose 2 and Dose 3). The BA.2 group showed greatest rescue for R-1, I-1 and I-3 and the BA.5 group showed an immunodominance shift from R-1 towards I-3. These data suggest that a greater antigenic distance of a variant Spike may be better able to override initial immune imprinting from the vaccine. A factor that could also influence immune imprinting is the time between final vaccination and time of BTI [42]. Those presumed to be infected with BA.2 or BA.5 had a longer period between vaccination and BTI compared to Delta and BA.1 BTI groups (S3 Table).

Primary infection epitope usage differs from BTI

Next, we compared the epitope immunodominance between primary infection and BTI for Delta (Fig 4A) and BA.1 (Fig 4B). The percentage frequency of individuals showing a >2-fold increase (neutralization rescue) or <0.5-fold decrease (neutralization reduction) in ID₅₀ were plotted. Immunodominance in Delta and BA.1 BTI were similar to the response after 3 vaccine doses (Fig 3C) and were largely skewed towards R-1, I-1, I-2 and I-3 epitopes.

Download:

Fig 4. Comparison of immunodominance between primary infection and BTI.

Bar graph comparing percentage frequency of donors showing neutralization rescue (solid fill, >2-fold change) and reduction (line pattern, <0.5-fold change) for sera following either 3 vaccine doses, BTI or primary infection. (A) Shows data for Delta BTI and Delta primary infection. (Vaccine dose 3 (n = 17), Delta BTI (n = 8), Delta primary infection (n = 11); where n refers to number of individuals in each group). (B) Shows data for BA.1 BTI and BA.1 primary infection. (Vaccine dose 3 (n = 17), BA.1 BTI (n = 14), BA.1 primary infection (n = 10); where n refers to number of individuals in each group). Comparisons are grouped by reverted epitope on the X-axis and separated by vertical dotted lines.

https://doi.org/10.1371/journal.ppat.1012724.g004

Interestingly, the pattern of immunodominance in Delta and BA.1 primary infection sera differed from that in BTI. For Delta infection, there was a decrease in frequency of individuals with neutralization rescue in epitope R-1, I-1 and I-2 and there was a shift towards the R-2 epitope. However, both Delta BTI and primary Delta infection showed individuals with a reduced neutralization to the O-1 revertant. This suggests the O-1 epitope may be a target of variant specific antibodies, elicited by activation of naïve B-cells by Delta variant infection. Mutation at position 452 is present in the Delta variant (L452R) and the O-1 revertant and has been shown to be highly immune evasive [45]. This may suggest that a de novo response has been developed towards R452 following BTI, overriding the humoral immune imprinting from the vaccine.

For BA.1 infection, there was also a decrease in frequency of individuals with rescue of R-1 compared to BA.1 BTI. Interestingly, for I-1, I-3 and O-1 there were contrasting neutralization capabilities between BTI and primary infection sera. Whilst serum neutralization was rescued in these revertants following BA.1 BTI, the response elicited by BA.1 primary infection was predominantly attributed to neutralization reduction. This suggests that primary infection elicits a more BA.1-specific neutralizing response which may have been supressed in the BA.1 BTI group.

Discussion

Our resistant variant and virus revertant panel approach provides an accessible and potentially high-throughput method to map the epitopes targeted by neutralizing antibodies in sera. Furthermore, this approach can be quickly adapted to newly emerging variants of SARS-CoV-2. The ability to determine epitope immunodominance without the need to have access to PBMCs for mAb isolation allows for wider application across larger cohorts. Additionally, we can directly interpret the functional effects of Spike mutations by measuring neutralizing activity of sera as opposed to only binding. In the context of polyclonal serum this is an advantage as a notable proportion of antibodies in sera can bind but lack neutralizing activity [2,46].

Using our revertant virus panel we have mapped the immunodominant sites of RBD in sera following primary infection and across longitudinal time points following vaccination and BTI. When considering vaccinee sera alone, the mutations in XBB.1.5+ that facilitated neutralization rescue were found in 5 out of 6 revertant epitopes, including within both the RBM (R-1 and R-2) and inner face of RBD (I-1, I-2 and I-3). This shows the polyclonal nature of the antibody response to SARS-CoV-2 vaccination and the selective pressure these nAbs have on emergence of variants. By focusing on mutations derived from those naturally occurring in VOCs we can link immunodominance at a given time point to viral escape. Indeed, mutations in the R-1 revertant, that correspond to those that arose in Omicron and its sub-lineage variants, may have been driven by the high frequency of serum antibodies targeting the RBM following vaccination.

When the immunodominance profile for vaccine-induced antibody responses was compared to that following primary infection with different variants, distinct epitope usage was observed. Despite the BNT162b2 vaccine and wave 1 infections presenting almost identical Spikes, a narrower response primarily targeting R-2 was observed following primary infection. There was also a reduced response towards epitopes on the interior face (I-1, I-2, and I-3) compared to vaccine-induced antibodies. Similar results have previously been reported by Greaney et al, in which deep mutational scanning was utilized to compare specificity of serum antibodies from mRNA-1273 vaccination and SARS-CoV-2 infection [31]. Vaccine-induced antibodies were shown to target a broader range of epitopes on the RBD when compared to infection-induced serum antibodies. These results suggest that presentation and conformation of Spike expressed by mRNA vaccination may differ from Spike in its native conformation on the viral membrane. The interior face of the RBD is immunodominant in vaccinee sera, however, these epitopes are only accessible when RBD is in its “up”, conformation [47]. The addition of stabilising mutations (K986P and V987P) to mRNA vaccine Spike sequences, have been speculated to influence RBD conformation [48]. Whether these mutations influence immunodominance by modulating RBD conformation requires further investigation. Indeed, these stabilising mutations were not incorporated in the ChAdOx1 nCoV-19 vaccine and it is possible that the use of different vaccine platforms may also influence epitope immunodominance to RBD [49].

Several groups have shown, using antigen-specific B cell staining, that variant infection/boosting in vaccinated individuals preferentially re-engages pre-existing memory B cells and suppresses generation of de novo variant-specific responses [14,22,50]. Similarly, we show that immune imprinting from mRNA vaccines is persistent following multiple vaccine doses and BTI [14,51,52]. However, by further characterising imprinted responses, we reveal more subtle shifts in immunodominance following BTI. Antigenic distance and the waning antibody response over time seem to be factors in the persistence of immune imprinting. Indeed, BTI with later omicron sub-lineages (BA.2 and BA.5 variants) shifted immunodominance towards epitopes on the interior face of RBD. Similar to the vaccine strains, this may be explained by mutations in the omicron lineage stabilizing the spike in its RBD “up” conformation [53], hence increasing accessibility of the interior face to antibody binding.

Distinct epitope usage was also observed in convalescent sera from individuals infected with Delta and BA.1 variants, highlighting their antigenic distance from the Wuhan-1 strain. When compared to BTI with the matching variant, the influence of imprinting from the vaccine was apparent. Epitope immunodominance following BTI predominantly favoured the imprinted response elicited by the vaccine. However, some evidence of antibody responses to variant-specific epitopes was observed. The L452R mutation, present in the Delta variant seems to elicit a de novo antibody response able to override imprinting. Additionally, BA.1 mutations on the interior face of RBD were able to elicit a variant-specific response. These findings were supported at a monoclonal level, where individuals with Delta and BA.1 BTI had a higher frequency of antibodies targeting the group 4 epitope (located on the outer face of RBD and represented by mutations in the O-1 revertant) than individuals with primary infection during wave 1 (S5 Fig)[2,23]. A study by Guerra et al isolated a panel of monoclonal antibodies from a P.1 infected individual [54]. Interestingly, they identified a mAb, COVA309-03, that was specific for the 484K residue present in P.1 which supports our observation that there are nAbs targeting variant specific mutations in the sera of primary Delta and BA.1 infected individuals.

Although vaccines can be rapidly adapted to new variants that arise, a large proportion of the population was vaccinated with the Wuhan-1 SARS-CoV-2 Spike. Conversely, looking towards the future, new generations of naïve infants will likely not be exposed to the ancestral variant or past variants of SARS-CoV-2. This new generation will be imprinted with variant vaccines or the current circulating VOCs and therefore likely have a differently targeted neutralizing antibody response compared to those studied so far. The heterogeneity of exposure histories in the general population and the effects on immune imprinting by prime/boosting with new variant-based vaccines will need to be considered in the design of updated vaccines to ensure efficient protection.

Methods

Ethics statement

This study used human samples collected with written consent as part of a study entitled “Antibody responses following COVID-19 vaccination.” Ethical approval was obtained from the King’s College London Infectious Diseases Biobank (IBD) (KDJF-110121) under the terms of the IDB’s ethics permission (REC reference: 19/SC/0232) granted by the South Central Hampshire B Research Ethics Committee in 2019 and London Bridge Research Ethics Committee (reference: REC14/LO/1699). Collection of surplus serum samples at St Thomas Hospital, London, was approved by South Central-Hampshire B REC (20/SC/0310).

Description of human samples

Primary infection cohort: Surplus serum samples from 37 individuals with primary infection were collected at St. Thomas’ Hospital London. SARS-CoV-2 cases were diagnosed by RT-PCR of respiratory samples and infecting variants were confirmed using whole genome sequencing as previously described [42], or using MT-PCR [55]. The cohort were 54% male, 41% female and 5% undetermined with a median age of 57 (range 7–90 years) (S3 Table). Samples were collected at a median of 18 days (range 12–28 days) post onset of symptoms. 27% (9/34) individuals were infected during wave 1 (presumably with variants close to the ancestral Wuhan-1 strain), 32% (11/34) were infected with Delta variant and 41% (14/34) were infected with BA.1 variant.

Vaccine and BTI cohort: Sequential serum samples were collected from a cohort of 44 donors, spanning 3 doses of BNT162b2 mRNA vaccine and BTI with approval granted by South Central–Hampshire B (REC reference: 19/SC/0232). The cohort were 45% male and 55% female. SARS-CoV-2 infection was diagnosed by RT-PCR and/or lateral flow testing and confirmed by presence of IgG to nucleoprotein. Infecting variant was estimated by the dominant strain circulating in the UK at the time of infection. 18% (8/44) individuals were infected during the Delta wave, 32% (14/44), 18% (8/44) and 14% (6/44) were infected during BA.1, BA.2 and BA.5 waves, respectively. 7% (3/44) donors were infected during periods of transition between dominant variants, hence infecting variant was undetermined. 11% (5/44) individuals recorded no BTI. Samples were collected at a median of 22 days (range 15–34) post vaccination and 29 days (range 21–83) post BTI (S3 Table). The majority of donors had regular community PCR testing and information on previous SARS-CoV-2 infection exposures recorded at each blood draw. In addition, the presence of serum IgG to Nucleoprotein and Spike was utilized to identify and exclude individuals with previous asymptomatic infection [44,56]. Time post 3rd vaccine dose varied for each group with most of the Delta breakthrough infection occurring prior to the 3rd vaccine dose (median -61.5 days) (S3 Table). BA.1, BA.2, and BA.5 BTI occurred at a median of 90-, 136-, and 237-days post 3rd dose, respectively (S3 Table).

Spike mutagenesis

Spike mutants were generated with Q5 Site-Directed Mutagenesis Kit (NEB, E0554) following the manufacturer’s instructions. XBB.1.5+ was generated by introducing L452R (forward primer TACAATTACCGGTACCGGCTGTTC, reverse primer GTTGCCGCTGGGTTTGGA) and K444T (forward primer CTGGACTCCACACCCAGCGGC, reverse primer CTTGTTGCTGTTCCAGGCAATC) mutations into the XBB.1.5 spike sequence. Primer sequences for reversion mutations are shown in (S1 Table). Sanger sequencing was used to confirm presence of desired mutations.

Pseudotyped virus production

Pseudotyped HIV-1 virus incorporating each of the variants (D614G, Delta, BA.1 and XBB.1.5) and revertant SARS-CoV-2 (XBB.1.5+, R-1, R-2, I-1, I-2, I-3 and O-1) Spikes were generated by first seeding HEK293T/17 cells in 10 cm dishes at a density of 7x10⁵ cells/mL in Dulbecco’s Modified Eagle Medium (DMEM) with 10% fetal bovine serum (FBS), 100 U/mL penicillin and 100 μg/mL streptomycin. Following overnight culture, cells were co-transfected using 90 μg PEI-Max (1 mg/mL, Polysciences) with 15 μg HIV-luciferase plasmid, 10 μg HIV 8.91 gag/pol plasmid, and 5 μg SARS-CoV-2 Spike protein plasmid [57]. Transfected cells were incubated for 72 h at 37°C, and virus was harvested, sterile filtered, and stored at −80°C until required. Mutations present in each revertant variant Spike are shown in (S2 Table).

Human ACE2 expression

Recombinant human ACE2 containing a Twin-StrepTag was expressed in Expi293F cells (Invitrogen). 1000 μg of plasmid DNA was transfected with PEI-Max (1 mg/mL, Polysciences), at a 1: 3 ratio, in 1 L of cells at 1.5x10⁶ cells/mL density. Supernatant was harvested and protein was purified with SrepTactinXT Superflow high-capacity 50% suspension (IBA Life Sciences) according to the manufacturer’s protocol by gravity flow.

Pseudotyped virus neutralization assays

In half-well 96 well plates, sera, mAb or soluble ACE2 was serially diluted in DMEM (10% FBS, 100 U/mL penicillin and 100 μg/mL streptomycin) with a starting serum dilution of 1: 10 dilution or mAb concentration 25 μg/mL. Pseudotyped D614G or XBB.1.5+ variant viruses was added and incubated for 1 hr at 37°C. Hela-ACE2 cells were added at a density of 4x10⁵ cells/mL and incubated for 72 hr at 37°C. Levels of pseudotyped virus transduction and expression of the luciferase gene were measured by luminescence with Bright-Glo luciferase kit (Promega) on a Victor X3 multilabel reader (Perkin Elmer). Samples were run in duplicate to determine IC₅₀ and ID₅₀ values. Fold change in neutralization against reverted mutants was calculated as a fold change of IC₅₀ or ID₅₀ from XBB.1.5+. Statistical analyses were performed using GraphPad Prism v.10.2.1.

Supporting information

S1 Table. Primer sequences for XBB.1.5+ Spike mutagenesis.

https://doi.org/10.1371/journal.ppat.1012724.s001

(XLSX)

S2 Table. Mutations present in each reverted XBB1.5+ Spike variant.

https://doi.org/10.1371/journal.ppat.1012724.s002

(XLSX)

S3 Table. Cohort descriptions for primary infection cohort and Longitudinal vaccine/infection cohort.

N/A: not applicable.

https://doi.org/10.1371/journal.ppat.1012724.s003

(XLSX)

S1 Fig.

Structures of therapeutic monoclonal antibodies in complex with RBD; (A) REGN10933 (PDB: 6XDG), (B) REGN10987 (PDB: 6XDG) and (C) Sotrovimab (PDB: 6WPS). Fabs (cartoon representation) are binding to SARS-CoV-2 RBD (surface representation) with revertant residues coloured as in Fig 1C and S2 Table.

https://doi.org/10.1371/journal.ppat.1012724.s004

(TIF)

S2 Fig. Heatmap showing fold rescue of neutralization for reverted viruses compared to XBB.1.5+ for a panel of NTD-specific mAbs (Group 5 and 6) and SD1-specific mAb (Group 7) [Refs 2, 23, 41].

https://doi.org/10.1371/journal.ppat.1012724.s005

(TIF)

S3 Fig. Neutralization of pseudotyped viruses with variant and epitope reverted Spikes by soluble monomeric ACE2.

Spikes with higher binding affinity are neutralized more efficiently by soluble ACE2 Ref 28. A table of ACE2 IC₅₀ values for each spike is included in the legend.

https://doi.org/10.1371/journal.ppat.1012724.s006

(TIF)

S4 Fig. ID₅₀ of sera from longitudinal vaccine and primary infection cohorts against the XBB.1.5+ neutralization resistant mutant pseudotyped virus (Kruskal-Wallis multiple comparison test, P < 0.0332, P < 0.0021, P < 0.0002, and ****P < 0.0001).

Geometric mean ID₅₀ are indicated by horizontal bars and the fold change compared to BA.1 primary infection sera is shown in red text. Error bars indicate geometric mean ± s.d.

https://doi.org/10.1371/journal.ppat.1012724.s007

(TIF)

S5 Fig. Pie charts showing epitope usage by mAbs isolated from individuals with primary infection during wave 1 [Ref 2] and BTI with either Delta and BA.1 variants [Ref 23].

Total number of mAbs analysed is shown within the pie chart. RBD groups have been defined previously in Graham et al. [Ref 2] and matching RBD epitope classes have defined by Barnes et al. [Ref 5].

https://doi.org/10.1371/journal.ppat.1012724.s008

(TIF)

S1 Data. Raw data files for figures.

https://doi.org/10.1371/journal.ppat.1012724.s009

(XLSX)

Acknowledgments

We thank Wendy Barclay for providing the Beta, Delta, BA.1, BA.2, and XBB.1.5 Spike plasmids, Peter Cherepanov for providing the ACE2 expression plasmid, and James Voss for providing the HeLa-ACE2 cells.

References

1. Seow J, Graham C, Merrick B, Acors S, Pickering S, Steel KJA, et al. Longitudinal observation and decline of neutralizing antibody responses in the three months following SARS-CoV-2 infection in humans. Nat Microbiol. 2020;5: 1598–1607. pmid:33106674
- View Article
- PubMed/NCBI
- Google Scholar
2. Graham C, Seow J, Huettner I, Khan H, Kouphou N, Acors S, et al. Neutralization potency of monoclonal antibodies recognizing dominant and subdominant epitopes on SARS-CoV-2 Spike is impacted by the B.1.1.7 variant. Immunity. 2021;54: 1276–1289.e6. pmid:33836142
- View Article
- PubMed/NCBI
- Google Scholar
3. Seow J, Graham C, Hallett SR, Lechmere T, Maguire TJA, Huettner I, et al. ChAdOx1 nCoV-19 vaccine elicits monoclonal antibodies with cross-neutralizing activity against SARS-CoV-2 viral variants. Cell Rep. 2022;39: 110757. pmid:35477023
- View Article
- PubMed/NCBI
- Google Scholar
4. Gaebler C, Wang Z, Lorenzi JCC, Muecksch F, Finkin S, Tokuyama M, et al. Evolution of antibody immunity to SARS-CoV-2. Nature. 2021;591: 639–644. pmid:33461210
- View Article
- PubMed/NCBI
- Google Scholar
5. Barnes CO, Jette CA, Abernathy ME, Dam KMA, Esswein SR, Gristick HB, et al. SARS-CoV-2 neutralizing antibody structures inform therapeutic strategies. Nature. 2020;588: 682–687. pmid:33045718
- View Article
- PubMed/NCBI
- Google Scholar
6. Jiang J, Boughter CT, Ahmad J, Natarajan K, Boyd LF, Meier-Schellersheim M, et al. SARS-CoV-2 antibodies recognize 23 distinct epitopic sites on the receptor binding domain. Commun Biol. 2023;6. pmid:37726484
- View Article
- PubMed/NCBI
- Google Scholar
7. Hastie KM, Li H, Bedinger D, Schendel SL, Moses Dennison S, Li K, et al. Defining variant-resistant epitopes targeted by SARS-CoV-2 antibodies: A global consortium study. Science (80-). 2021;374: 478–472. pmid:34554826
- View Article
- PubMed/NCBI
- Google Scholar
8. Wang Z, Muecksch F, Cho A, Gaebler C, Hoffmann HH, Ramos V, et al. Analysis of memory B cells identifies conserved neutralizing epitopes on the N-terminal domain of variant SARS-Cov-2 spike proteins. Immunity. 2022;55: 998–1012.e8. pmid:35447092
- View Article
- PubMed/NCBI
- Google Scholar
9. Cerutti G, Guo Y, Zhou T, Gorman J, Lee M, Rapp M, et al. Potent SARS-CoV-2 neutralizing antibodies directed against spike N-terminal domain target a single supersite. Cell Host Microbe. 2021;29: 819–833.e7. pmid:33789084
- View Article
- PubMed/NCBI
- Google Scholar
10. Tamura T, Irie T, Deguchi S, Yajima H, Tsuda M, Nasser H, et al. Virological characteristics of the SARS-CoV-2 Omicron XBB.1.5 variant. Nat Commun. 2024;15: 1–17. pmid:38332154
- View Article
- PubMed/NCBI
- Google Scholar
11. Saito A, Tamura T, Zahradnik J, Deguchi S, Tabata K, Anraku Y, et al. Virological characteristics of the SARS-CoV-2 Omicron BA.2.75 variant. Cell Host Microbe. 2022;30: 1540–1555.e15. pmid:36272413
- View Article
- PubMed/NCBI
- Google Scholar
12. Liang C, Raju S, Liu Z, Li Y, Asthagiri Arunkumar G, Case JB, et al. Imprinting of serum neutralizing antibodies by Wuhan-1 mRNA vaccines. Nature. 2024; 0–1. pmid:38749479
- View Article
- PubMed/NCBI
- Google Scholar
13. UKHSA. SARS-CoV-2 variants of concern and variants under investigation in England: Technical briefing 48. 2022. Available: https://assets.publishing.service.gov.uk/media/6380c85ce90e0723490b0cbf/technical-briefing-48-25-november-2022-final.pdf
- View Article
- Google Scholar
14. Cao Y, Jian F, Wang J, Yu Y, Song W, Yisimayi A, et al. Imprinted SARS-CoV-2 humoral immunity induces convergent Omicron RBD evolution. Nature. 2023;614: 521–529. pmid:36535326
- View Article
- PubMed/NCBI
- Google Scholar
15. Park YJ, Pinto D, Walls AC, Liu Z, De Marco A, Benigni F, et al. Imprinted antibody responses against SARS-CoV-2 Omicron sublineages. Science (80-). 2022;378: 619–627. pmid:36264829
- View Article
- PubMed/NCBI
- Google Scholar
16. Johnston TS, Li SH, Painter MM, Atkinson RK, Douek NR, Reeg DB, et al. Immunological imprinting shapes the specificity of human antibody responses against SARS-CoV-2 variants. medRxiv Prepr Serv Heal Sci. 2024.
- View Article
- Google Scholar
17. Pušnik J, Zorn J, Monzon-Posadas WO, Peters K, Osypchuk E, Blaschke S, et al. Vaccination impairs de novo immune response to omicron breakthrough infection, a precondition for the original antigenic sin. Nat Commun. 2024;15: 1–13. pmid:38600072
- View Article
- PubMed/NCBI
- Google Scholar
18. Wang Q, Guo Y, Tam AR, Valdez R, Gordon A, Liu L, et al. Deep immunological imprinting due to the ancestral spike in the current bivalent COVID-19 vaccine. Cell Reports Med. 2023;4: 101258. pmid:37909042
- View Article
- PubMed/NCBI
- Google Scholar
19. Tortorici MA, Addetia A, Seo AJ, Brown J, Sprouse KKR, Logue J, et al. Persistent immune imprinting occurs after vaccination with the COVID-19 XBB.1.5 mRNA booster in humans. Immunity. 2024;57: 2023.11.28.569129. pmid:38490197
- View Article
- PubMed/NCBI
- Google Scholar
20. Röltgen K, Nielsen SCA, Silva O, Younes SF, Zaslavsky M, Costales C, et al. Immune imprinting, breadth of variant recognition, and germinal center response in human SARS-CoV-2 infection and vaccination. Cell. 2022;185: 1025–1040.e14. pmid:35148837
- View Article
- PubMed/NCBI
- Google Scholar
21. Reynolds CJ, Pade C, Gibbons JM, Otter AD, Lin KM, Sandoval DM, et al. Immune boosting by B.1.1.529 (Omicron) depends on previous SARS-CoV-2 exposure. Science (80-). 2022;377. pmid:35699621
- View Article
- PubMed/NCBI
- Google Scholar
22. Yisimayi A, Song W, Wang J, Jian F, Yu Y, Chen X, et al. Repeated Omicron exposures override ancestral SARS-CoV-2 immune imprinting. Nature. 2024;625: 148–156. pmid:37993710
- View Article
- PubMed/NCBI
- Google Scholar
23. Seow J, Shalim ZA, Graham C, Kimuda S, Pillai A, Lechmere T, et al. Broad and potent neutralizing antibodies are elicited in vaccinated individuals following Delta/BA.1 breakthrough infection. Ackerman ME, editor. MBio. 2023;14: 1–22. pmid:37747187
- View Article
- PubMed/NCBI
- Google Scholar
24. Reynolds CJ, Gibbons JM, Pade C, Lin KM, Sandoval DM, Pieper F, et al. Heterologous infection and vaccination shapes immunity against SARS-CoV-2 variants. Science (80-). 2022;375: 183–192. pmid:34855510
- View Article
- PubMed/NCBI
- Google Scholar
25. Haynes WA, Kamath K, Bozekowski J, Baum-Jones E, Campbell M, Casanovas-Massana A, et al. High-resolution epitope mapping and characterization of SARS-CoV-2 antibodies in large cohorts of subjects with COVID-19. Commun Biol. 2021;4: 1–14. pmid:34811480
- View Article
- PubMed/NCBI
- Google Scholar
26. Bangaru S, Antanasijevic A, Kose N, Sewall LM, Jackson AM, Suryadevara N, et al. Structural mapping of antibody landscapes to human betacoronavirus spike proteins. Sci Adv. 2022;8: 1–11. pmid:35507649
- View Article
- PubMed/NCBI
- Google Scholar
27. Zost SJ, Gilchuk P, Chen RE, Case JB, Reidy JX, Trivette A, et al. Rapid isolation and profiling of a diverse panel of human monoclonal antibodies targeting the SARS-CoV-2 spike protein. Nat Med. 2020;26: 1422–1427. pmid:32651581
- View Article
- PubMed/NCBI
- Google Scholar
28. Dadonaite B, Brown J, McMahon TE, Farrell AG, Asarnow D, Stewart C, et al. Full-spike deep mutational scanning helps predict the evolutionary success of SARS-CoV-2 clades. bioRxiv. 2023; 2023.11.13.566961. Available: https://www.biorxiv.org/content/10.1101/2023.11.13.566961v1%0Ahttps://www.biorxiv.org/content/10.1101/2023.11.13.566961v1.abstract pmid:38014024
- View Article
- PubMed/NCBI
- Google Scholar
29. Starr TN, Greaney AJ, Hilton SK, Ellis D, Crawford KHD, Dingens AS, et al. Deep Mutational Scanning of SARS-CoV-2 Receptor Binding Domain Reveals Constraints on Folding and ACE2 Binding. Cell. 2020;182: 1295–1310.e20. pmid:32841599
- View Article
- PubMed/NCBI
- Google Scholar
30. Kugathasan R, Sukhova K, Moshe M, Kellam P, Barclay W. Deep mutagenesis scanning using whole trimeric SARS-CoV-2 spike highlights the importance of NTD-RBD interactions in determining spike phenotype. PLoS Pathog. 2023;19: 1–21. pmid:37535672
- View Article
- PubMed/NCBI
- Google Scholar
31. Greaney AJ, Loes AN, Gentles LE, Crawford KHD, Starr TN, Malone KD, et al. Antibodies elicited by mRNA-1273 vaccination bind more broadly to the receptor binding domain than do those from SARS-CoV-2 infection. Sci Transl Med. 2021;13: 1–12. pmid:34103407
- View Article
- PubMed/NCBI
- Google Scholar
32. Alenquer M, Ferreira F, Lousa D, Valério M, Medina-Lopes M, Bergman ML, et al. Signatures in SARS-CoV-2 spike protein conferring escape to neutralizing antibodies. PLoS Pathog. 2021;17: 1–25. pmid:34352039
- View Article
- PubMed/NCBI
- Google Scholar
33. Pastorio C, Zech F, Noettger S, Jung C, Jacob T, Sanderson T, et al. Determinants of Spike infectivity, processing, and neutralization in SARS-CoV-2 Omicron subvariants BA.1 and BA.2. Cell Host Microbe. 2022;30: 1255–1268.e5. pmid:35931073
- View Article
- PubMed/NCBI
- Google Scholar
34. Kuzmina A, Wattad S, Engel S, Rosenberg E, Taube R. Functional Analysis of Spike from SARS-CoV-2 Variants Reveals the Role of Distinct Mutations in Neutralization Potential and Viral Infectivity. Viruses. 2022;14. pmid:35458533
- View Article
- PubMed/NCBI
- Google Scholar
35. Mannar D, Saville JW, Poloni C, Zhu X, Bezeruk A, Tidey K, et al. Altered receptor binding, antibody evasion and retention of T cell recognition by the SARS-CoV-2 XBB.1.5 spike protein. Nat Commun. 2024;15. pmid:38424106
- View Article
- PubMed/NCBI
- Google Scholar
36. Qu P, Faraone JN, Evans JP, Zheng YM, Carlin C, Anghelina M, et al. Enhanced evasion of neutralizing antibody response by Omicron XBB.1.5, CH.1.1, and CA.3.1 variants. Cell Rep. 2023;42: 112443. pmid:37104089
- View Article
- PubMed/NCBI
- Google Scholar
37. Dejnirattisai W, Zhou D, Ginn HM, Duyvesteyn HME, Supasa P, Case JB, et al. The antigenic anatomy of SARS-CoV-2 receptor binding domain. Cell. 2021;184: 2183–2200.e22. pmid:33756110
- View Article
- PubMed/NCBI
- Google Scholar
38. Brouwer PJM, Caniels TG, van der Straten K, Snitselaar JL, Aldon Y, Bangaru S, et al. Potent neutralizing antibodies from COVID-19 patients define multiple targets of vulnerability. Science (80-). 2020;369: 643–650. pmid:32540902
- View Article
- PubMed/NCBI
- Google Scholar
39. Hansen J, Baum A, Pascal KE, Russo V, Giordano S, Wloga E, et al. Studies in humanized mice and convalescent humans yield a SARS-CoV-2 antibody cocktail. Science (80-). 2020;369: 1010–1014. pmid:32540901
- View Article
- PubMed/NCBI
- Google Scholar
40. Pinto D, Park YJ, Beltramello M, Walls AC, Tortorici MA, Bianchi S, et al. Cross-neutralization of SARS-CoV-2 by a human monoclonal SARS-CoV antibody. Nature. 2020;583: 290–295. pmid:32422645
- View Article
- PubMed/NCBI
- Google Scholar
41. Seow J, Khan H, Rosa A, Calvaresi V, Graham C, Pickering S, et al. A neutralizing epitope on the SD1 domain of SARS-CoV-2 spike targeted following infection and vaccination. Cell Rep. 2022;40: 111276. pmid:35981534
- View Article
- PubMed/NCBI
- Google Scholar
42. Dupont L, Snell LB, Graham C, Seow J, Merrick B, Lechmere T, et al. Neutralizing antibody activity in convalescent sera from infection in humans with SARS-CoV-2 and variants of concern. Nat Microbiol. 2021;6: 1433–1442. pmid:34654917
- View Article
- PubMed/NCBI
- Google Scholar
43. Rössler A, Netzl A, Knabl L, Bante D, Wilks SH, Borena W, et al. Characterizing SARS-CoV-2 neutralization profiles after bivalent boosting using antigenic cartography. Nat Commun. 2023;14: 1–9. pmid:37633965
- View Article
- PubMed/NCBI
- Google Scholar
44. Graham C, Lechmere T, Rehman A, Seow J, Kurshan A, Huettner I, et al. The effect of Omicron breakthrough infection and extended BNT162b2 booster dosing on neutralization breadth against SARS-CoV-2 variants of concern. PLoS Pathog. 2022;18: 1–21. pmid:36191037
- View Article
- PubMed/NCBI
- Google Scholar
45. Motozono C, Toyoda M, Zahradnik J, Saito A, Nasser H, Tan TS, et al. SARS-CoV-2 spike L452R variant evades cellular immunity and increases infectivity. Cell Host Microbe. 2021;29: 1124–1136.e11. pmid:34171266
- View Article
- PubMed/NCBI
- Google Scholar
46. Kaplonek P, Deng Y, Shih-Lu Lee J, Zar HJ, Zavadska D, Johnson M, et al. Hybrid immunity expands the functional humoral footprint of both mRNA and vector-based SARS-CoV-2 vaccines. Cell Reports Med. 2023;4: 101048. pmid:37182520
- View Article
- PubMed/NCBI
- Google Scholar
47. Zhou D, Duyvesteyn HME, Chen CP, Huang CG, Chen TH, Shih SR, et al. Structural basis for the neutralization of SARS-CoV-2 by an antibody from a convalescent patient. Nat Struct Mol Biol. 2020;27: 950–958. pmid:32737466
- View Article
- PubMed/NCBI
- Google Scholar
48. Hsieh C, Goldsmith JA, Schaub JM, DiVenere AM, Kuo H, Javanmardi K, et al. Structure-based design of prefusion-stabilized SARS-CoV-2 spikes. Science (80-). 2020;369: 1501–1505. pmid:32703906
- View Article
- PubMed/NCBI
- Google Scholar
49. Kaku CI, Champney ER, Normark J, Garcia M, Johnson CE, Ahlm C, et al. Broad anti–SARS-CoV-2 antibody immunity induced by heterologous ChAdOx1/mRNA-1273 vaccination. Science (80-). 2022;375: 1041–1047. pmid:35143256
- View Article
- PubMed/NCBI
- Google Scholar
50. Alsoussi WB, Malladi SK, Zhou JQ, Liu Z, Ying B, Kim W, et al. SARS-CoV-2 Omicron boosting induces de novo B cell response in humans. Nature. 2023;617: 592–598. pmid:37011668
- View Article
- PubMed/NCBI
- Google Scholar
51. Addetia A, Piccoli L, Case JB, Park YJ, Beltramello M, Guarino B, et al. Neutralization, effector function and immune imprinting of Omicron variants. Nature. 2023;621: 592–601. pmid:37648855
- View Article
- PubMed/NCBI
- Google Scholar
52. Kaku CI, Starr TN, Zhou P, Dugan HL, Khalifé P, Song G, et al. Evolution of antibody immunity following Omicron BA.1 breakthrough infection. Nat Commun. 2023;14: 1–13. pmid:37173311
- View Article
- PubMed/NCBI
- Google Scholar
53. Zhao Z, Zhou J, Tian M, Huang M, Liu S, Xie Y, et al. Omicron SARS-CoV-2 mutations stabilize spike up-RBD conformation and lead to a non-RBM-binding monoclonal antibody escape. Nat Commun. 2022;13. pmid:36002453
- View Article
- PubMed/NCBI
- Google Scholar
54. Guerra D, Beaumont T, Radić L, Kerster G, van der Straten K, Yuan M, et al. Broad SARS-CoV-2 neutralization by monoclonal and bispecific antibodies derived from a Gamma-infected individual. iScience. 2023;26. pmid:37841584
- View Article
- PubMed/NCBI
- Google Scholar
55. Hale R, Crowley P, Dervisevic S, Coupland L, Cliff PR, Ebie S, et al. Development of a multiplex tandem pcr (Mt-pcr) assay for the detection of emerging sars-cov-2 variants. Viruses. 2021;13. pmid:34696458
- View Article
- PubMed/NCBI
- Google Scholar
56. Pickering S, Betancor G, Galão RP, Merrick B, Signell AW, Wilson HD, et al. Comparative assessment of multiple COVID-19 serological technologies supports continued evaluation of point-of-care lateral flow assays in hospital and community healthcare settings. PLoS Pathog. 2020;16: e1008817. pmid:32970782
- View Article
- PubMed/NCBI
- Google Scholar
57. Zufferey R, Nagy D, Mandel RJ, Naldini L, Trono D. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol. 1997;15: 871–5. pmid:9306402
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Seow J, Graham C, Merrick B, Acors S, Pickering S, Steel KJA, et al. Longitudinal observation and decline of neutralizing antibody responses in the three months following SARS-CoV-2 infection in humans. Nat Microbiol. 2020;5: 1598–1607. pmid:33106674
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Graham C, Seow J, Huettner I, Khan H, Kouphou N, Acors S, et al. Neutralization potency of monoclonal antibodies recognizing dominant and subdominant epitopes on SARS-CoV-2 Spike is impacted by the B.1.1.7 variant. Immunity. 2021;54: 1276–1289.e6. pmid:33836142
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. Seow J, Graham C, Hallett SR, Lechmere T, Maguire TJA, Huettner I, et al. ChAdOx1 nCoV-19 vaccine elicits monoclonal antibodies with cross-neutralizing activity against SARS-CoV-2 viral variants. Cell Rep. 2022;39: 110757. pmid:35477023
View Article
PubMed/NCBI
Google Scholar

[10] View Article

[11] PubMed/NCBI

[12] Google Scholar

[ref4] 4. Gaebler C, Wang Z, Lorenzi JCC, Muecksch F, Finkin S, Tokuyama M, et al. Evolution of antibody immunity to SARS-CoV-2. Nature. 2021;591: 639–644. pmid:33461210
View Article
PubMed/NCBI
Google Scholar

[14] View Article

[15] PubMed/NCBI

[16] Google Scholar

[ref5] 5. Barnes CO, Jette CA, Abernathy ME, Dam KMA, Esswein SR, Gristick HB, et al. SARS-CoV-2 neutralizing antibody structures inform therapeutic strategies. Nature. 2020;588: 682–687. pmid:33045718
View Article
PubMed/NCBI
Google Scholar

[18] View Article

[19] PubMed/NCBI

[20] Google Scholar

[ref6] 6. Jiang J, Boughter CT, Ahmad J, Natarajan K, Boyd LF, Meier-Schellersheim M, et al. SARS-CoV-2 antibodies recognize 23 distinct epitopic sites on the receptor binding domain. Commun Biol. 2023;6. pmid:37726484
View Article
PubMed/NCBI
Google Scholar

[22] View Article

[23] PubMed/NCBI

[24] Google Scholar

[ref7] 7. Hastie KM, Li H, Bedinger D, Schendel SL, Moses Dennison S, Li K, et al. Defining variant-resistant epitopes targeted by SARS-CoV-2 antibodies: A global consortium study. Science (80-). 2021;374: 478–472. pmid:34554826
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref8] 8. Wang Z, Muecksch F, Cho A, Gaebler C, Hoffmann HH, Ramos V, et al. Analysis of memory B cells identifies conserved neutralizing epitopes on the N-terminal domain of variant SARS-Cov-2 spike proteins. Immunity. 2022;55: 998–1012.e8. pmid:35447092
View Article
PubMed/NCBI
Google Scholar

[30] View Article

[31] PubMed/NCBI

[32] Google Scholar

[ref9] 9. Cerutti G, Guo Y, Zhou T, Gorman J, Lee M, Rapp M, et al. Potent SARS-CoV-2 neutralizing antibodies directed against spike N-terminal domain target a single supersite. Cell Host Microbe. 2021;29: 819–833.e7. pmid:33789084
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref10] 10. Tamura T, Irie T, Deguchi S, Yajima H, Tsuda M, Nasser H, et al. Virological characteristics of the SARS-CoV-2 Omicron XBB.1.5 variant. Nat Commun. 2024;15: 1–17. pmid:38332154
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref11] 11. Saito A, Tamura T, Zahradnik J, Deguchi S, Tabata K, Anraku Y, et al. Virological characteristics of the SARS-CoV-2 Omicron BA.2.75 variant. Cell Host Microbe. 2022;30: 1540–1555.e15. pmid:36272413
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref12] 12. Liang C, Raju S, Liu Z, Li Y, Asthagiri Arunkumar G, Case JB, et al. Imprinting of serum neutralizing antibodies by Wuhan-1 mRNA vaccines. Nature. 2024; 0–1. pmid:38749479
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref13] 13. UKHSA. SARS-CoV-2 variants of concern and variants under investigation in England: Technical briefing 48. 2022. Available: https://assets.publishing.service.gov.uk/media/6380c85ce90e0723490b0cbf/technical-briefing-48-25-november-2022-final.pdf
View Article
Google Scholar

[50] View Article

[51] Google Scholar

[ref14] 14. Cao Y, Jian F, Wang J, Yu Y, Song W, Yisimayi A, et al. Imprinted SARS-CoV-2 humoral immunity induces convergent Omicron RBD evolution. Nature. 2023;614: 521–529. pmid:36535326
View Article
PubMed/NCBI
Google Scholar

[53] View Article

[54] PubMed/NCBI

[55] Google Scholar

[ref15] 15. Park YJ, Pinto D, Walls AC, Liu Z, De Marco A, Benigni F, et al. Imprinted antibody responses against SARS-CoV-2 Omicron sublineages. Science (80-). 2022;378: 619–627. pmid:36264829
View Article
PubMed/NCBI
Google Scholar

[57] View Article

[58] PubMed/NCBI

[59] Google Scholar

[ref16] 16. Johnston TS, Li SH, Painter MM, Atkinson RK, Douek NR, Reeg DB, et al. Immunological imprinting shapes the specificity of human antibody responses against SARS-CoV-2 variants. medRxiv Prepr Serv Heal Sci. 2024.
View Article
Google Scholar

[61] View Article

[62] Google Scholar

[ref17] 17. Pušnik J, Zorn J, Monzon-Posadas WO, Peters K, Osypchuk E, Blaschke S, et al. Vaccination impairs de novo immune response to omicron breakthrough infection, a precondition for the original antigenic sin. Nat Commun. 2024;15: 1–13. pmid:38600072
View Article
PubMed/NCBI
Google Scholar

[64] View Article

[65] PubMed/NCBI

[66] Google Scholar

[ref18] 18. Wang Q, Guo Y, Tam AR, Valdez R, Gordon A, Liu L, et al. Deep immunological imprinting due to the ancestral spike in the current bivalent COVID-19 vaccine. Cell Reports Med. 2023;4: 101258. pmid:37909042
View Article
PubMed/NCBI
Google Scholar

[68] View Article

[69] PubMed/NCBI

[70] Google Scholar

[ref19] 19. Tortorici MA, Addetia A, Seo AJ, Brown J, Sprouse KKR, Logue J, et al. Persistent immune imprinting occurs after vaccination with the COVID-19 XBB.1.5 mRNA booster in humans. Immunity. 2024;57: 2023.11.28.569129. pmid:38490197
View Article
PubMed/NCBI
Google Scholar

[72] View Article

[73] PubMed/NCBI

[74] Google Scholar

[ref20] 20. Röltgen K, Nielsen SCA, Silva O, Younes SF, Zaslavsky M, Costales C, et al. Immune imprinting, breadth of variant recognition, and germinal center response in human SARS-CoV-2 infection and vaccination. Cell. 2022;185: 1025–1040.e14. pmid:35148837
View Article
PubMed/NCBI
Google Scholar

[76] View Article

[77] PubMed/NCBI

[78] Google Scholar

[ref21] 21. Reynolds CJ, Pade C, Gibbons JM, Otter AD, Lin KM, Sandoval DM, et al. Immune boosting by B.1.1.529 (Omicron) depends on previous SARS-CoV-2 exposure. Science (80-). 2022;377. pmid:35699621
View Article
PubMed/NCBI
Google Scholar

[80] View Article

[81] PubMed/NCBI

[82] Google Scholar

[ref22] 22. Yisimayi A, Song W, Wang J, Jian F, Yu Y, Chen X, et al. Repeated Omicron exposures override ancestral SARS-CoV-2 immune imprinting. Nature. 2024;625: 148–156. pmid:37993710
View Article
PubMed/NCBI
Google Scholar

[84] View Article

[85] PubMed/NCBI

[86] Google Scholar

[ref23] 23. Seow J, Shalim ZA, Graham C, Kimuda S, Pillai A, Lechmere T, et al. Broad and potent neutralizing antibodies are elicited in vaccinated individuals following Delta/BA.1 breakthrough infection. Ackerman ME, editor. MBio. 2023;14: 1–22. pmid:37747187
View Article
PubMed/NCBI
Google Scholar

[88] View Article

[89] PubMed/NCBI

[90] Google Scholar

[ref24] 24. Reynolds CJ, Gibbons JM, Pade C, Lin KM, Sandoval DM, Pieper F, et al. Heterologous infection and vaccination shapes immunity against SARS-CoV-2 variants. Science (80-). 2022;375: 183–192. pmid:34855510
View Article
PubMed/NCBI
Google Scholar

[92] View Article

[93] PubMed/NCBI

[94] Google Scholar

[ref25] 25. Haynes WA, Kamath K, Bozekowski J, Baum-Jones E, Campbell M, Casanovas-Massana A, et al. High-resolution epitope mapping and characterization of SARS-CoV-2 antibodies in large cohorts of subjects with COVID-19. Commun Biol. 2021;4: 1–14. pmid:34811480
View Article
PubMed/NCBI
Google Scholar

[96] View Article

[97] PubMed/NCBI

[98] Google Scholar

[ref26] 26. Bangaru S, Antanasijevic A, Kose N, Sewall LM, Jackson AM, Suryadevara N, et al. Structural mapping of antibody landscapes to human betacoronavirus spike proteins. Sci Adv. 2022;8: 1–11. pmid:35507649
View Article
PubMed/NCBI
Google Scholar

[100] View Article

[101] PubMed/NCBI

[102] Google Scholar

[ref27] 27. Zost SJ, Gilchuk P, Chen RE, Case JB, Reidy JX, Trivette A, et al. Rapid isolation and profiling of a diverse panel of human monoclonal antibodies targeting the SARS-CoV-2 spike protein. Nat Med. 2020;26: 1422–1427. pmid:32651581
View Article
PubMed/NCBI
Google Scholar

[104] View Article

[105] PubMed/NCBI

[106] Google Scholar

[ref28] 28. Dadonaite B, Brown J, McMahon TE, Farrell AG, Asarnow D, Stewart C, et al. Full-spike deep mutational scanning helps predict the evolutionary success of SARS-CoV-2 clades. bioRxiv. 2023; 2023.11.13.566961. Available: https://www.biorxiv.org/content/10.1101/2023.11.13.566961v1%0Ahttps://www.biorxiv.org/content/10.1101/2023.11.13.566961v1.abstract pmid:38014024
View Article
PubMed/NCBI
Google Scholar

[108] View Article

[109] PubMed/NCBI

[110] Google Scholar

[ref29] 29. Starr TN, Greaney AJ, Hilton SK, Ellis D, Crawford KHD, Dingens AS, et al. Deep Mutational Scanning of SARS-CoV-2 Receptor Binding Domain Reveals Constraints on Folding and ACE2 Binding. Cell. 2020;182: 1295–1310.e20. pmid:32841599
View Article
PubMed/NCBI
Google Scholar

[112] View Article

[113] PubMed/NCBI

[114] Google Scholar

[ref30] 30. Kugathasan R, Sukhova K, Moshe M, Kellam P, Barclay W. Deep mutagenesis scanning using whole trimeric SARS-CoV-2 spike highlights the importance of NTD-RBD interactions in determining spike phenotype. PLoS Pathog. 2023;19: 1–21. pmid:37535672
View Article
PubMed/NCBI
Google Scholar

[116] View Article

[117] PubMed/NCBI

[118] Google Scholar

[ref31] 31. Greaney AJ, Loes AN, Gentles LE, Crawford KHD, Starr TN, Malone KD, et al. Antibodies elicited by mRNA-1273 vaccination bind more broadly to the receptor binding domain than do those from SARS-CoV-2 infection. Sci Transl Med. 2021;13: 1–12. pmid:34103407
View Article
PubMed/NCBI
Google Scholar

[120] View Article

[121] PubMed/NCBI

[122] Google Scholar

[ref32] 32. Alenquer M, Ferreira F, Lousa D, Valério M, Medina-Lopes M, Bergman ML, et al. Signatures in SARS-CoV-2 spike protein conferring escape to neutralizing antibodies. PLoS Pathog. 2021;17: 1–25. pmid:34352039
View Article
PubMed/NCBI
Google Scholar

[124] View Article

[125] PubMed/NCBI

[126] Google Scholar

[ref33] 33. Pastorio C, Zech F, Noettger S, Jung C, Jacob T, Sanderson T, et al. Determinants of Spike infectivity, processing, and neutralization in SARS-CoV-2 Omicron subvariants BA.1 and BA.2. Cell Host Microbe. 2022;30: 1255–1268.e5. pmid:35931073
View Article
PubMed/NCBI
Google Scholar

[128] View Article

[129] PubMed/NCBI

[130] Google Scholar

[ref34] 34. Kuzmina A, Wattad S, Engel S, Rosenberg E, Taube R. Functional Analysis of Spike from SARS-CoV-2 Variants Reveals the Role of Distinct Mutations in Neutralization Potential and Viral Infectivity. Viruses. 2022;14. pmid:35458533
View Article
PubMed/NCBI
Google Scholar

[132] View Article

[133] PubMed/NCBI

[134] Google Scholar

[ref35] 35. Mannar D, Saville JW, Poloni C, Zhu X, Bezeruk A, Tidey K, et al. Altered receptor binding, antibody evasion and retention of T cell recognition by the SARS-CoV-2 XBB.1.5 spike protein. Nat Commun. 2024;15. pmid:38424106
View Article
PubMed/NCBI
Google Scholar

[136] View Article

[137] PubMed/NCBI

[138] Google Scholar

[ref36] 36. Qu P, Faraone JN, Evans JP, Zheng YM, Carlin C, Anghelina M, et al. Enhanced evasion of neutralizing antibody response by Omicron XBB.1.5, CH.1.1, and CA.3.1 variants. Cell Rep. 2023;42: 112443. pmid:37104089
View Article
PubMed/NCBI
Google Scholar

[140] View Article

[141] PubMed/NCBI

[142] Google Scholar

[ref37] 37. Dejnirattisai W, Zhou D, Ginn HM, Duyvesteyn HME, Supasa P, Case JB, et al. The antigenic anatomy of SARS-CoV-2 receptor binding domain. Cell. 2021;184: 2183–2200.e22. pmid:33756110
View Article
PubMed/NCBI
Google Scholar

[144] View Article

[145] PubMed/NCBI

[146] Google Scholar

[ref38] 38. Brouwer PJM, Caniels TG, van der Straten K, Snitselaar JL, Aldon Y, Bangaru S, et al. Potent neutralizing antibodies from COVID-19 patients define multiple targets of vulnerability. Science (80-). 2020;369: 643–650. pmid:32540902
View Article
PubMed/NCBI
Google Scholar

[148] View Article

[149] PubMed/NCBI

[150] Google Scholar

[ref39] 39. Hansen J, Baum A, Pascal KE, Russo V, Giordano S, Wloga E, et al. Studies in humanized mice and convalescent humans yield a SARS-CoV-2 antibody cocktail. Science (80-). 2020;369: 1010–1014. pmid:32540901
View Article
PubMed/NCBI
Google Scholar

[152] View Article

[153] PubMed/NCBI

[154] Google Scholar

[ref40] 40. Pinto D, Park YJ, Beltramello M, Walls AC, Tortorici MA, Bianchi S, et al. Cross-neutralization of SARS-CoV-2 by a human monoclonal SARS-CoV antibody. Nature. 2020;583: 290–295. pmid:32422645
View Article
PubMed/NCBI
Google Scholar

[156] View Article

[157] PubMed/NCBI

[158] Google Scholar

[ref41] 41. Seow J, Khan H, Rosa A, Calvaresi V, Graham C, Pickering S, et al. A neutralizing epitope on the SD1 domain of SARS-CoV-2 spike targeted following infection and vaccination. Cell Rep. 2022;40: 111276. pmid:35981534
View Article
PubMed/NCBI
Google Scholar

[160] View Article

[161] PubMed/NCBI

[162] Google Scholar

[ref42] 42. Dupont L, Snell LB, Graham C, Seow J, Merrick B, Lechmere T, et al. Neutralizing antibody activity in convalescent sera from infection in humans with SARS-CoV-2 and variants of concern. Nat Microbiol. 2021;6: 1433–1442. pmid:34654917
View Article
PubMed/NCBI
Google Scholar

[164] View Article

[165] PubMed/NCBI

[166] Google Scholar

[ref43] 43. Rössler A, Netzl A, Knabl L, Bante D, Wilks SH, Borena W, et al. Characterizing SARS-CoV-2 neutralization profiles after bivalent boosting using antigenic cartography. Nat Commun. 2023;14: 1–9. pmid:37633965
View Article
PubMed/NCBI
Google Scholar

[168] View Article

[169] PubMed/NCBI

[170] Google Scholar

[ref44] 44. Graham C, Lechmere T, Rehman A, Seow J, Kurshan A, Huettner I, et al. The effect of Omicron breakthrough infection and extended BNT162b2 booster dosing on neutralization breadth against SARS-CoV-2 variants of concern. PLoS Pathog. 2022;18: 1–21. pmid:36191037
View Article
PubMed/NCBI
Google Scholar

[172] View Article

[173] PubMed/NCBI

[174] Google Scholar

[ref45] 45. Motozono C, Toyoda M, Zahradnik J, Saito A, Nasser H, Tan TS, et al. SARS-CoV-2 spike L452R variant evades cellular immunity and increases infectivity. Cell Host Microbe. 2021;29: 1124–1136.e11. pmid:34171266
View Article
PubMed/NCBI
Google Scholar

[176] View Article

[177] PubMed/NCBI

[178] Google Scholar

[ref46] 46. Kaplonek P, Deng Y, Shih-Lu Lee J, Zar HJ, Zavadska D, Johnson M, et al. Hybrid immunity expands the functional humoral footprint of both mRNA and vector-based SARS-CoV-2 vaccines. Cell Reports Med. 2023;4: 101048. pmid:37182520
View Article
PubMed/NCBI
Google Scholar

[180] View Article

[181] PubMed/NCBI

[182] Google Scholar

[ref47] 47. Zhou D, Duyvesteyn HME, Chen CP, Huang CG, Chen TH, Shih SR, et al. Structural basis for the neutralization of SARS-CoV-2 by an antibody from a convalescent patient. Nat Struct Mol Biol. 2020;27: 950–958. pmid:32737466
View Article
PubMed/NCBI
Google Scholar

[184] View Article

[185] PubMed/NCBI

[186] Google Scholar

[ref48] 48. Hsieh C, Goldsmith JA, Schaub JM, DiVenere AM, Kuo H, Javanmardi K, et al. Structure-based design of prefusion-stabilized SARS-CoV-2 spikes. Science (80-). 2020;369: 1501–1505. pmid:32703906
View Article
PubMed/NCBI
Google Scholar

[188] View Article

[189] PubMed/NCBI

[190] Google Scholar

[ref49] 49. Kaku CI, Champney ER, Normark J, Garcia M, Johnson CE, Ahlm C, et al. Broad anti–SARS-CoV-2 antibody immunity induced by heterologous ChAdOx1/mRNA-1273 vaccination. Science (80-). 2022;375: 1041–1047. pmid:35143256
View Article
PubMed/NCBI
Google Scholar

[192] View Article

[193] PubMed/NCBI

[194] Google Scholar

[ref50] 50. Alsoussi WB, Malladi SK, Zhou JQ, Liu Z, Ying B, Kim W, et al. SARS-CoV-2 Omicron boosting induces de novo B cell response in humans. Nature. 2023;617: 592–598. pmid:37011668
View Article
PubMed/NCBI
Google Scholar

[196] View Article

[197] PubMed/NCBI

[198] Google Scholar

[ref51] 51. Addetia A, Piccoli L, Case JB, Park YJ, Beltramello M, Guarino B, et al. Neutralization, effector function and immune imprinting of Omicron variants. Nature. 2023;621: 592–601. pmid:37648855
View Article
PubMed/NCBI
Google Scholar

[200] View Article

[201] PubMed/NCBI

[202] Google Scholar

[ref52] 52. Kaku CI, Starr TN, Zhou P, Dugan HL, Khalifé P, Song G, et al. Evolution of antibody immunity following Omicron BA.1 breakthrough infection. Nat Commun. 2023;14: 1–13. pmid:37173311
View Article
PubMed/NCBI
Google Scholar

[204] View Article

[205] PubMed/NCBI

[206] Google Scholar

[ref53] 53. Zhao Z, Zhou J, Tian M, Huang M, Liu S, Xie Y, et al. Omicron SARS-CoV-2 mutations stabilize spike up-RBD conformation and lead to a non-RBM-binding monoclonal antibody escape. Nat Commun. 2022;13. pmid:36002453
View Article
PubMed/NCBI
Google Scholar

[208] View Article

[209] PubMed/NCBI

[210] Google Scholar

[ref54] 54. Guerra D, Beaumont T, Radić L, Kerster G, van der Straten K, Yuan M, et al. Broad SARS-CoV-2 neutralization by monoclonal and bispecific antibodies derived from a Gamma-infected individual. iScience. 2023;26. pmid:37841584
View Article
PubMed/NCBI
Google Scholar

[212] View Article

[213] PubMed/NCBI

[214] Google Scholar

[ref55] 55. Hale R, Crowley P, Dervisevic S, Coupland L, Cliff PR, Ebie S, et al. Development of a multiplex tandem pcr (Mt-pcr) assay for the detection of emerging sars-cov-2 variants. Viruses. 2021;13. pmid:34696458
View Article
PubMed/NCBI
Google Scholar

[216] View Article

[217] PubMed/NCBI

[218] Google Scholar

[ref56] 56. Pickering S, Betancor G, Galão RP, Merrick B, Signell AW, Wilson HD, et al. Comparative assessment of multiple COVID-19 serological technologies supports continued evaluation of point-of-care lateral flow assays in hospital and community healthcare settings. PLoS Pathog. 2020;16: e1008817. pmid:32970782
View Article
PubMed/NCBI
Google Scholar

[220] View Article

[221] PubMed/NCBI

[222] Google Scholar

[ref57] 57. Zufferey R, Nagy D, Mandel RJ, Naldini L, Trono D. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol. 1997;15: 871–5. pmid:9306402
View Article
PubMed/NCBI
Google Scholar

[224] View Article

[225] PubMed/NCBI

[226] Google Scholar

Figures

Abstract

Author summary

Introduction

Results

Design of highly immune evasive mutant XBB.1.5+Spike and virus revertant panel

Neutralization rescue of mAbs against virus revertant panel

Primary infection cohort

Immune imprinting from vaccination influences BTI immunodominance

Antigenic distance and time post-exposure may override immune imprinting

Primary infection epitope usage differs from BTI

Discussion

Methods

Ethics statement

Description of human samples

Spike mutagenesis

Pseudotyped virus production

Human ACE2 expression

Pseudotyped virus neutralization assays

Supporting information

S1 Table. Primer sequences for XBB.1.5+ Spike mutagenesis.

S2 Table. Mutations present in each reverted XBB1.5+ Spike variant.

S3 Table. Cohort descriptions for primary infection cohort and Longitudinal vaccine/infection cohort.

S1 Fig.

S2 Fig. Heatmap showing fold rescue of neutralization for reverted viruses compared to XBB.1.5+ for a panel of NTD-specific mAbs (Group 5 and 6) and SD1-specific mAb (Group 7) [Refs 2, 23, 41].

S3 Fig. Neutralization of pseudotyped viruses with variant and epitope reverted Spikes by soluble monomeric ACE2.

S4 Fig. ID50 of sera from longitudinal vaccine and primary infection cohorts against the XBB.1.5+ neutralization resistant mutant pseudotyped virus (Kruskal-Wallis multiple comparison test, *P < 0.0332, **P < 0.0021, ***P < 0.0002, and ****P < 0.0001).

S5 Fig. Pie charts showing epitope usage by mAbs isolated from individuals with primary infection during wave 1 [Ref 2] and BTI with either Delta and BA.1 variants [Ref 23].

S1 Data. Raw data files for figures.

Acknowledgments

References

S4 Fig. ID₅₀ of sera from longitudinal vaccine and primary infection cohorts against the XBB.1.5+ neutralization resistant mutant pseudotyped virus (Kruskal-Wallis multiple comparison test, P < 0.0332, P < 0.0021, P < 0.0002, and ****P < 0.0001).