Restriction-methylation in C. acnes strains

To understand host protective mechanisms in C. acnes we investigated the presence and activity of R-M systems in a selection of strains. We used curated HMM models of restriction-modification protein motifs found in PFAM and the dedicated tools available in REBASE to find potential R-M systems in all our C. acnes laboratory strains based on homology to available genome assemblies (for a full list of strains and accession numbers we refer to S3 Table).

Comparing genomes of S3 Table, three main potential R-M systems were found in C. acnes clades I and II which include R-M IIB, IIG and IIIB (Fig 1A).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. C. acnes KPA171202 (SLST H2) has a functional R-M system with a methylation motif in the AGCAGY sequence.

- (A) Genomic comparison of potential R-M systems in selected C. acnes strains using assemblies available in REBASE and comparing strain or clade level. Black represents the MTase while white represents the REase. (B) Sequence logo of the methylation motif from the reads with highest methylation score. (C) Fraction of methylated reads in the methylated adenine of the AGCAGY motif detected in the pMW535 plasmid after recombinant expression of H1 or H2 IIIB methyltransferase. (D) Fraction of methylated reads across the positions of the AGCAGY motif for the wild-type (red) and the type IIIB R-M system knock-out (blue) KPA171202 (H2) strain. (E) Transcriptional profile of restriction methylation locus and surroundings in C. acnes KPA171202 Wild Type (SLST H2 WT) and C. acnes restriction methylation knock-out (SLST H2 R-M KO). Expression levels are displayed by RNA-seq read counts per genomic position (mean of two replicates). R-M IIG corresponds to PPA1614 and R-M IIIB to PPA1611.

https://doi.org/10.1371/journal.ppat.1010420.g001

The R-M IIB system contains an orphan methylase with an ORF of 1251 bp. Interestingly, a S- adenosyl synthase gene is located just upstream of the methylase gene. Regarding type IIG R-M systems in C. acnes, differences have been observed depending on the clade. Type IIG has been described to be inactivated in C. acnes IB strains by the insertion of a 30 kb pro-phage between PPA1578 and PPA1614 and by a deletion of 4 genes in C. acnes clade II strains. C. acnes clade IA, on the other hand, have an intact reading frame or have mutations leading to a premature stop codon which generates two independent reading frames (Fig 1A) [14]. For example, one single frame is detected in SLST A1 while two frames are detected in SLST C1 (Fig 1A). R-M IIIB contains a methylase (Mod) and a restriction endonuclease (Res) as two independent ORFs. Our laboratory strain SLST H1 has a premature stop codon resulting from a two base pair deletion in the Mod gene and deletions in the Res gene resulting in an altered frame which probably compromises its functionality (Fig 1A). Interestingly, Clade IB (such as SLST H1 and H2) strains have three predicted restriction modification systems while clade IA (such as SLST A1 and C1) have only one (Fig 1A). This could be explained due to the evolution of clade IA which gained an increased benefit over other strains [14].

Sequence alignment of clade II C. acnes strains with the R-M type IIIB system in clade IB strains, show sequence similarities but also suggest that in type II C. acnes the type IIIB R-M system has been partially deleted (Fig 1A).

De novo motif discovery of representative C. acnes strains

To get an overview of the functionality of the different putative ORFs, we chose representatives from different clades (Fig 1A) and conducted ONT sequencing for de novo motif discovery. For clade IA we chose SLST A1 and C1, for clade IB we chose SLST H1 and H2 (KPA171202) [36], for clade II we chose SLST K1 (09–9) [12] and K2.

Out of all these strains, only H2 showed a significant methylation motif corresponding to the AGCAGY consensus sequence, in which the methylated base corresponds to the adenine in fourth position (Fig 2A). However, not all sites found in SLST H2 were detected as methylated. As the Tombo package does not suggest a fixed cut-off for classifying whether a base is modified or not, we inferred a cut-off based on the density of the modified fraction of reads for the methylated position in the motif. In order to do so, we calculated the mean of the right peak (0.67) and defined the cutoff as the mean minus two standard deviations, establishing it at 0.39. Using this criterion, the frequency of methylated motifs was 94%. Additionally, fine typing using a multi-label classification algorithm called Nanodisco showed the modification to be present at the N6 of the second adenine in the motif (AGCA(6mA)GY) (S1C Fig).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. R-M system IIIB of C. acnes KPA171202 affects PAD20 Phage infection properties and protects the bacteria from lysis.

- (A) Variation of infection properties of PAD20 phage propagated on either SLST A1, H1, H2 or H2 KO. (B) Fraction of methylated reads in the methylated adenine at 4th position of the AGCAGY motif in the PAD20 phage genome. Samples are named first after the infected strain where the phage was sequenced and second after the strain on which the phage was previously propagated (i.e, H2-H1 means a phage produced in H1 was used to infect H2 and then extracted for sequencing from H2) Significance was tested using ANOVA analysis (***, p < 0.001). (C) Selected killing of whole microbiome samples infected with PAD20 propagated on SLST A1 after 3 different time points. Samples were taken after 24, 48, 120 h of on-going PAD20 infection. Samples were amplified using SLST methodology and subjected to Illumina sequencing. Similarity to SLST alles is used to classify sequencing reads into clades IA, IB and II. Clade IA contains following SLST types: A1, A2, A3, A4, A7, A11, A13, A16, A17, A18, A21, A24, A27, A28, A29, A30, A31, A33, A34, A35, A38, A40, A42, A46, A47, A48, A49, A51, A52, C1, C5, F4, F6, F10, F15, F16, F17, F22, F24; Clade IB contains: H1, H2, H3, H4, H7, H8, H10, H11, H12; Clade II contains: K1, K2, K7, K9, K17, K19.

https://doi.org/10.1371/journal.ppat.1010420.g002

To further confirm the lack of methylation patterns, we performed SMRT sequencing in two of the tested strains corresponding to SLST A1 and H1. In accordance with our ONT sequencing data, none of these two strains showed a methylation motif (S1A and S1B Fig).

Linking IIIB Mod gene to MTase functionality

To understand the methylation properties of the IIIB methylases from H1 and H2 we recombinantly expressed those in E. coli dam- dcm- strain together with a plasmid pMW535 containing eight AGCAGY recognition sites [37]. In the case of SLST H2 MTase, the ONT sequencing on the plasmid revealed the same AGCAGY methylation pattern as found in the genome (Fig 1C). This confirms that the pattern observed at the genome level is due to the activity of this protein. However, the recombinant expression of the disrupted ORF proceeding from the H1 MTase did not show any clear methylation pattern nor the characteristic methylation at AGCAGY despite having potential homologies to the same type IIIB system as the H2 strain (Fig 1C and 1A).

On the other hand, we wanted to test the restriction properties of SLST A1, H1 and H2 strains in degrading the unmethylated plasmid in a cell extract. As expected, degradation of the plasmid occurred only with the H2 strain lysate. Neither A1 nor H1 lysates were able to digest the unmethylated plasmid, matching our previous analysis which predicts no active R-M system for these two strains (S1D Fig).

To further link the Mod gene to the methylation activity we created a C. acnes KPA171202 methylation deficient strain by deleting a 9 kb locus including both R-M IIIB and R-M IIG system and inserting an erythromycin resistance cassette for selection similarly to Sörensen et al. 2010 [37] (Fig 1A). We verified correct knockout by junction PCR and WGS followed by a functional characterization using ONT sequencing and RNA sequencing of WT vs. KO strain (Figs 1D and 1E and S2D). ONT sequencing verified the loss of methylated AGCAGY motifs in absence of MTase in comparison to the wildtype genome (Fig 1D). In addition, RNA sequencing showed no expression of the IIIB and IIG locus in the KO strain (Figs 1E and S2D). Also, we did not detect expression of the IIB and IIG R-M systems in the WT strain corresponding to our previous findings using ONT sequencing, where no specific patterns were detected and linked to those R-M systems (Fig 1E).

Identification of host range specificity of PAD20 phage propagated on various strains

After identifying a functional R-M system in SLST H2 (KPA171202), we hypothesized a link between phage infection properties and the availability of active R-M systems in C. acnes. In this study, we propagated PAD20 C. acnes phage on SLST strains A1, H1, H2 and H2 KO. We used those phages from different origins to infect a representative selection of C. acnes strains of every clade and measured its ability to form lysis plaques. Those belonging to clade IA, in particular SLST A1, A5, F4, C1, C3, were lysed by all four versions of the PAD20 phages (Figs 2A and S1E). Notably, clade IB strains followed different patterns of infection.

PAD20 A1 showed the least infection properties by only being able to lyse clade IA and SLST H2 KO but leaving SLST H1 and H2 unaffected. Interestingly, SLST H2 KO became sensitive to PAD20 A1 infection which might be linked to the loss of protection due to the knocked-out R-M IIG system since SLST H1 still having R-M IIG was not sensitive to PAD20 A1. PAD20 H1 had a broader lysis profile by lysing clade IA, SLST H2 KO, SLST K1 and itself. PAD20 H2 showed extended lysis potential by lysing all clade IA and clade IB strains and one clade II strain, SLST K1 (Figs 2A and S1E). PAD20 H2 KO showed the same phenotype in infection as PAD20 H1, which verifies the loss of protective properties linked to the R-M IIIB system. On the other side, it became sensitive to PAD20 A1 which could be linked to the lost R-M IIG system. Furthermore, SLST K2 strain (clade II) was not able to be lysed by any of the three phages even though the phage originally was extracted from clade II (Figs 2A and S1E). This is probably due to the existence of CRISPR spacers against PAD20 phages found in its genomic DNA. From 13 spacers found in K2, 6 aligned against PAD20 (S1 Table). Additionally, we showed expression of the complete CRISPR/Cas type I-E locus in K1 and K2 by RNAseq analysis (S2A and S2B Fig) and verified expression levels of genes belonging to the CRISPR system by comparing threshold cycle (C_t) obtained by each candidate gene in both strains tested (S2C Fig).

Restriction-methylation modulates infection potential of PAD20 phages

In order to validate our observation and hypothesis that epigenetic imprinting of phage genomic DNA leads to differences in host infectivity we tested if the PAD20 phage inherited the methylation pattern after infection. PAD20 genomic DNA contains 20 sites with the recognition motif AGCAGY. We extracted the phage DNA after infection of different strains and sequenced them using ONT sequencing. As expected, only phages propagated in H2 showed the characteristic AGCAGY motif methylated conversely to phage produced in other strains (Fig 2B). Additionally, we observed that phages initially propagated on H1, followed by a propagation on H2 had detectable AGCAGY methylation patterns (Fig 2B).

Selective killing of acne-prone strains in a whole microbiome sample

Since we observed that the phage origin plays a role in the ability of lysis, we wondered if we could take advantage of this effect to selectively target certain strains in a complex sample. We cultured together two C. acnes isolates SLST A1 and H1 and infected them with phage PAD20 propagated on SLST A1. We randomly selected 10 single colonies and sequenced those using the SLST scheme. We verified that all tested colonies showed the same SLST type H1, proving A1 was selectively lysed in the co-culture.

To further test our hypothesis, we extended the previous experiment to a whole microbiome culture extracted from human skin. The complex bacterial population was cultured together with PAD20 A1 phage and the progressive change in proportion of different strains through illumina sequencing at 3 different time points (24, 48, 120 h) was analyzed. We compared changes on clade level, since phages propagated on A1 had similar lysis profiles on all tested members of the same clade (S1E Fig). Comparing the changes in proportion of certain clades over time, we observed a clear decrease in Clade IA, while Clade IB gained in proportion (Fig 2C). In case of type II strains, differences on strain level within the clade were expected since spacers against PAD20 phages were identified previously in diverse type II isolates (S1 Table) [13,26]. A slight decrease of C. acnes clade II strains could be observed but overall stayed quite stable over time. This resistance to phage infection is potentially due to the presence of active type I-E CRISPR systems with matching spacers against PAD20 phage in some of the strains in the clade II population (Fig 2C).

Homology-based search of potential restriction methylation systems

In order to identify the potential R-M systems present in C. acnes, we first retrieved from the REBASE database all the predicted ORFs corresponding to either methyltransferases or restriction enzymes from those strains of which complete genome assembly was available. For the strains with no information available, we retrieved their respective genomes from the NCBI Genome database and performed protein-protein BLAST with the annotated coding sequences to identify the potential R-M homologs. To further assess the difference between systems across strains, we performed pairwise comparisons between ORFs belonging to the same putative system by sequence alignment using the Clustal Omega algorithm available at EMBL-EBI portal [40]. Refer to S3 Table for a complete list of strains and accession numbers used in this study.

Additionally, we used dedicated HMM models for well-known phage-defense systems using DefenseFinder[41,42] as well as manual HMMER (v3.3) hmmsearch queries with downloaded models from PFAM database[43]. In the case of K2, we used CRISPR-CAS Finder (https://crisprcas.i2bc.paris-saclay.fr/CrisprCasFinder/Index) to further characterize the CRISPR genes and locus identified. The obtained spacers were aligned against the reference genome of PAD20 with blastn.

Genomic DNA extraction

C. acnes SLST (single locus sequence typing) A1, C1, H1, H2, K1, K2 were grown on Brucella agar plates for 3 days. Bacteria were collected with a sterile cotton swab and inoculated in 1 mL BHI media, spun down 3 min 8000xg and resuspended in 1 mL lysis buffer (9,4 parts TE buffer pH 8,0 and 0,6 parts 10% SDS). All content was transferred to tubes prefilled with 0.1 mm silica beads and lysed in a mechanical homogenizer (Savant Bio 101 FastPrep FP120 Cell disruption system) for 25 sec at 6,5 speed. Samples were placed on ice for 1 min and the cycle was repeated once more. Next, 6 ul Proteinase K (20 mg/mL) and 5 ul RNAse (1 mg/mL) were added and incubated 1 h at 37°C water bath. Equal volume Phenol/Chloroform was added, mixed and spun down at max speed for 5 min. Then, the aqueous phase was collected and the previous step repeated. Equal volume of chloroform was added, mixed and spun down at max speed for 5 min. The aqueous phase was collected and 2,5 volumes of 100% ice-cold EtOH was added to precipitate DNA. Samples were kept for at least 1 h at -20°C. Then, they were spun down at max speed for 15 min at 4°C. Supernatant was discarded and the pellet was washed with 70°C EtOH. After, the sample was spun down for 2 min at max speed. Once dried, the pellet was resuspended in 50 ul H20 and DNA concentration was measured using Qubit HS DNA kit (Thermo Fisher).

Bacterial lysate preparation

C. acnes strains were pre-cultured in 20 ml BHI broth with 180 rpm shaking at 37°C during 24 hours under anaerobic conditions. Then, they were re-inoculated in 1 L of fresh BHI with 1200 rpm of stirring, maintaining the same conditions. After 72h, cells were harvested by centrifugation at 5000 xg for 20 minutes and the bacterial pellet was washed twice with 20 ml of cold K₂PO₄ 50mM, pH 7.4. Then, 0.33 ml of S30 buffer (10 mM Tris(CH₃COO) (pH 8.2), 14 mM Mg(CH₃COO)₂, 10 mM K(CH₃COO) and 4 mM DTT) were added per gram of wet cell mass and the suspension was transferred into 2ml microtubes prefilled with 0.1 mm glass beads. Using a mechanical homogenizer (Savant Bio 101 FastPrep FP120 Cell disruption system), cells were lysed following 2 cycles at 6000 rpm for 30 seconds. Samples were then filtered by centrifugation at 1000 xg for 5 minutes at 4°C using a 0.22 um filter unit. Then, the follow-through was centrifuged at 12.000 xg for 12 minutes at 4°C. Finally, clear supernatants were collected and stored at -80°C until they were used.

C. acnes lysate assay with plasmid DNA

C. acnes lysates were incubated with 0.5 ug plasmid DNA together with different buffers (NEB) supplemented with or without ATP or SAM. Cutsmart (NEB) buffer was chosen for further experiments. 8 ul of C. acnes concentrated lysate was mixed with 2 ul of Cutsmart buffer (1x final) and 0,5 ug of plasmid DNA was added. Final volume was adjusted to 20 ul and samples were incubated for 4 h at 37°C. Afterwards, DNA was observed on a 1% agarose gel.

C. acnes PAD20 Phage infection

C. acnes SLST types A1, H1, H2 (KPA171202) and restriction-methylation deficient H2 (H2 KO) were infected with a high titer of C. acnes PAD20 phage extracted from either A1 or H1. Brucella top agar plates (0,6%) were prepared by mixing 4,5 mL Brucella agar with 0,5 mL Bacterial culture. After being solidified, phages were added in 10 ul drops and plates were incubated at 37°C anaerobically for 3–5 days. After the first infection cycle, phages were extracted by adding 10 mL SM buffer (100 mM NaCl, 8 mM MgSO₄, 50 mM Tris-HCl pH 7.5, 0.01% gelatin) to the plates and incubating 30 min at RT carefully rotating. SM buffer was collected and NaCl was added to a final concentration of 0.5 M to release phages bound to bacterial debris. Samples were incubated for 30 min at RT and centrifuged at 8000g for 20 min. Then, samples were filtered and 10% (w/v) PEG 6000 was added. After 10 minutes of incubation, the phages were collected by centrifugation (10,000 xg, 30 min). Finally, the pellet was resuspended in 300ul of SM buffer. Phage concentration was determined by serial dilutions followed by plaque counting. EOP assay was performed by using an initial phage concentration of 5x10^3 PFU/mL to re-infect C. acnes A1, A5, C1, C3, F4, H1, H2 (KPA171202), K1 (09–9) and K2 in serial dilutions. Plaquing efficiency of phages PAD20 A1, PAD20 H1, PAD20 H2 and PAD20 H2 KO was measured in PFU/mL and compared to each other.

In vitro phage selectivity testing

C. acnes SLST types A1 and H1 were mixed 1:1 and inoculated to an OD600 of 0,1. A volume of 50 ul of PAD20 phage (3x10^6 PFU/mL) was added and phage infection proceeded for 3 days anaerobic growth, 37°C, 110 rpm. After 3 days serial dilutions were plated on Brucella agar plates, grown for 3 days anaerobically at 37°C and a subset of 10 colonies characterized by SLST PCR and subsequent Sanger sequencing.

Whole microbiome phage infection assay and strain genotyping

Whole microbiome was extracted by swapping as previously described in Paetzold et. al 2019 [44]. Bacteria was grown on agar plates anaerobically for 5 days prior to inoculation into BHI media to enrich in C. acnes. Inoculation was done to a OD₆₀₀ of 0,1 and 50 ul of PAD20 extracted from A1 (3x10^6 PFU/mL) was added. The culture was grown until time point 120h while samples were taken after 24h, 48h and 120h. To extract DNA 10 ul of culture was added to 500 ul QuickExtract Solution (Epicentre) and treated 65°C for 6 min followed by 98°C for 2 min. 5 ul of this solution was used for amplification of the SLST region linked to illumina adaptors using KAPA HiFi HotStart Readymix (Roche) (Initial denaturation for 5 min at 95°C followed by 35 cycles of 98°C for 20 s, 62°C for 25 s, and 72°C 30 s; and a final elongation for 1 min at 72°C).

SLST_illumina_fwd: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTTGCTCGCAACTGCAAGCA-3’ and

SLST_illumina_rev: 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCGGCTGGCAAATGAGGCAT -3’.

Samples were PCR purified and afterwards barcoded with Nextera XT indices using KAPA HiFi HotStart Readymix (Initial denaturation 95°C for 3 minutes followed by 8 cycles of 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds and a final elongation of 72°C for 5 minutes) for sequencing in a single Illumina flow cell. Illumina MiSeq was conducted and an adequate depth reserved per sample. Hamming distance between MiSeq paired-end reads of the same length and all SLST alleles were calculated with DistanceMatrix from DECIPHER (https://rdrr.io/bioc/DECIPHER/man/DistanceMatrix.html). Each read was assigned to the most similar strain, taking into consideration all alleles with the same minimal distance. Since there were several sequences with the same distance to more than one strain, we grouped similar strains. After obtaining all distances, reads were filtered allowing a maximum of 3 mismatches between the paired reads and the SLST alleles, because this was the minimal distance to discriminate between the established groups without uncertainty. Finally, we have calculated the proportion between different clades (IA, IB, and II) at each time point (24, 48, and 120 hours) using the number of paired reads with a minimal distance with a certain strain or with several strains of the same clade.

Creating a methylation deficient KPA171202

We followed a strategy previously described by Sörensen et al. 2010 [37] to create a methylation deficient KPA171202 strain. Shortly, we amplified 500 bp upstream (primers 468/469) and downstream (primers 470/471) of the locus to be replaced and cloned those into the pGEM-T-easy vector. In a second step the erythromycin cassette was cloned between the homology arms using Acc65I restriction sites and positive clones selected to be transformed into dam- GM2199 cells. C. acnes competent cells were prepared as previously described and transformants selected on Brucella plates containing 10 ug/mL erythromycin [37]. Knock-out was verified by WGS and junction PCR using primer pairs 499/338 and 308/500.

PCR amplification, cloning and recombinant type IIIB methylase expression

Methylase genes corresponding to type IIIB were amplified using KAPA HiFi HotStart Polymerase (Roche) and primer pair 283 and 284 (KPA-MIIIb_fwd and rev) to include the constitutive promoter BBa_J23100 (S2 Table). PCR products were TOPO cloned using the Zero Blunt TOPO cloning kit (Life TECHNOLOGIES) and transformed into dam-dcm- E. coli strain (New England BioLabs) and co-transformed with pMW535, a C. acnes suicide vector containing eight AGCAGY motifs. A single colony was grown overday in 5 mL LB broth and then inoculated in 200 mL o/n. Afterwards, plasmid DNA was extracted using HiPure Maxiprep kit (Life TECHNOLOGIES).

Preparation of Nanopore libraries

Genomic libraries corresponding to C. acnes A1, H1, H2, C1, K1, K2 strains, PAD20 phage DNA and E. coli plasmids were prepared using the Ligation Sequencing Kit SQK-LSK109 (Oxford Nanopore) according to the manufacturer’s instructions. Native and WGA samples were barcoded using the Native Barcoding Kit (EXP-NBD104) and PCR Barcoding kit (EXP-PBC001), respectively. All samples were sequenced on the MinION platform either using a FLO-MIN106D (R9) flow cell or a FLO-FLG001 Flongle (R9.4.1) flow cell. Basecalling and demultiplexing were performed using Guppy v4.0.11.

Data analysis and de novo motif detection

Nanopore sequencing data for the mentioned strain were analyzed using Tombo v1.5 software [45] for detection of modified bases. In brief, current signals were compared against the KPA171202 reference genome using the “resquiggle” command. Then, methylation peaks were detected comparing the native sample and the whole genome amplification (WGA) sample for each strain using the “detect_modifications model_sample_compare” command. For the detection of methylated motifs, first we extracted the 50 bp context of 1000 positions with the highest modified fraction (i.e. the fraction of reads identified as potentially methylated over all reads mapping to the given position in the genome) using the “text_output signif_sequence_context” command. This set of sequences was processed using MEME [46] with ‘zoops’ mode to identify common sequences. Statistically significant modified fraction values for each genomic position were exported from tombo using tombo’s “text_output browser_files” and were further analysed using a custom R script (see code availability). A similar procedure was used to analyse the Phage DNA and plasmid samples. For phage DNA, the genome reference was assembled de novo using Fyle [47] with the default parameters. Fine typing of the methylation motif was performed using the multi-label classification algorithm present in the Nanodisco [48] toolkit according to its documentation.

SMRT library preparation and sequencing

Library was prepared using Pacific Biosciences protocol for SMRTbell Libraries using PacBio Barcoded Adapters for MultiplexSMRT Sequencing. The library was sequenced on Pacific Biosciences Sequel instrument using Sequel Polymerase v2.1, SMRT cells v2 LR and Sequencing chemistry v2.1. This sequencing service was provided by the Norwegian Sequencing Centre (www.sequencing.uio.no).

RNA extraction, cDNA synthesis and qRT-PCR

Total RNA was extracted using RNeasy Mini kit with RNAprotect Bacteria reagent (Qiagen) and treated with RNase-free DNase I (Qiagen) on column. RNA was quantified using a NanoDrop One spectrophotometer (Thermofisher). 500 ng of RNA were used to perform the RT-PCR in random hexamer primed reactions using RevertAid First strand cDNA synthesis kit (Thermofisher). qRT-PCR was carried out in a QuantStudio 12K Flex Real-Time PCR System (Applied Biosystems). Each reaction contained 25 ng transcribed cDNA, 0.5 uM each fwd and rev primer (S2 Table) and 1x PowerUp SYBR Green Master Mix (Applied Biosystems) following manufacturer’s recommendation. Three independent replicates were made for each sample and gene.

RNAseq

Isolated RNA purity and integrity was assessed using Bioanalyzer (Agilent Technologies GmbH, Germany). Library preparation was done with Truseq Stranded Total RNA and samples were sequenced using Illumina (Macrogen, South Korea) at 60 million paired reads.

RNA-seq analysis was performed using the nf-core RNA-seq pipeline v3.0 [49,50] in Nexflow v20.12.0-edge [51]. Raw paired-end reads were trimmed using Trim Galore v0.6.6 and aligned to C. acnes strains H2, K1 or K2 genomes using STAR v2.6.1d and SAMtools v1.10 [52–54]. Quality control was performed using FastQC v0.11.9 [55]. Mapped reads were counted using mpileup from BCFtools in htslib v1.11 [56].