Advertisement
  • Loading metrics

Molecular Control of Innate Immune Response to Pseudomonas aeruginosa Infection by Intestinal let-7 in Caenorhabditis elegans

  • Lingtong Zhi ,

    Contributed equally to this work with: Lingtong Zhi, Yonglin Yu

    Affiliation Key Laboratory of Developmental Genes and Human Diseases in Ministry of Education, Medical School, Southeast University, Nanjing, China

  • Yonglin Yu ,

    Contributed equally to this work with: Lingtong Zhi, Yonglin Yu

    Affiliation Key Laboratory of Developmental Genes and Human Diseases in Ministry of Education, Medical School, Southeast University, Nanjing, China

  • Xueying Li,

    Affiliation Key Laboratory of Developmental Genes and Human Diseases in Ministry of Education, Medical School, Southeast University, Nanjing, China

  • Daoyong Wang,

    Affiliation Key Laboratory of Developmental Genes and Human Diseases in Ministry of Education, Medical School, Southeast University, Nanjing, China

  • Dayong Wang

    dayongw@seu.edu.cn

    Affiliation Key Laboratory of Developmental Genes and Human Diseases in Ministry of Education, Medical School, Southeast University, Nanjing, China

Molecular Control of Innate Immune Response to Pseudomonas aeruginosa Infection by Intestinal let-7 in Caenorhabditis elegans

  • Lingtong Zhi, 
  • Yonglin Yu, 
  • Xueying Li, 
  • Daoyong Wang, 
  • Dayong Wang
PLOS
x

Abstract

The microRNA (miRNA) let-7 is an important miRNA identified in Caenorhabditis elegans and has been shown to be involved in the control of innate immunity. The underlying molecular mechanisms for let-7 regulation of innate immunity remain largely unclear. In this study, we investigated the molecular basis for intestinal let-7 in the regulation of innate immunity. Infection with Pseudomonas aeruginosa PA14 decreased let-7::GFP expression. Intestine- or neuron-specific activity of let-7 was required for its function in the regulation of innate immunity. During the control of innate immune response to P. aeruginosa PA14 infection, SDZ-24 was identified as a direct target for intestinal let-7. SDZ-24 was found to be predominantly expressed in the intestine, and P. aeruginosa PA14 infection increased SDZ-24::GFP expression. Intestinal let-7 regulated innate immune response to P. aeruginosa PA14 infection by suppressing both the expression and the function of SDZ-24. Knockout or RNA interference knockdown of sdz-24 dampened the resistance of let-7 mutant to P. aeruginosa PA14 infection. Intestinal overexpression of sdz-24 lacking 3’-UTR inhibited the susceptibility of nematodes overexpressing intestinal let-7 to P. aeruginosa PA14 infection. In contrast, we could observed the effects of intestinal let-7 on innate immunity in P. aeruginosa PA14 infected transgenic strain overexpressing sdz-24 containing 3’-UTR. In the intestine, certain SDZ-24-mediated signaling cascades were formed for nematodes against the P. aeruginosa PA14 infection. Our results highlight the crucial role of intestinal miRNAs in the regulation of the innate immune response to pathogenic infection.

Author Summary

Some microRNAs (miRNAs) have been identified recently to play important roles in the regulation of innate immunity in Caenorhabditis elegans. let-7 is one of important miRNAs identified to be involved in the control of innate immune response. However, the underlying molecular mechanism for let-7 in the regulation of innate immune response is still largely unknown. In C. elegans, let-7 could function in both the intestine and the neurons to regulate the innate immunity. We here focused on the examination of molecular basis for the intestinal let-7 in the regulation of innate immune response to Pseudomonas aeruginosa PA14 infection. We identified SDZ-24, an ortholog of human replication protein A1, as a direct target for intestinal let-7 in the regulation of innate immune response. For the molecular mechanisms of intestinal let-7 in the regulation of innate immunity, let-7 might negatively regulate the function of SKN-1 by suppressing the expression and function of its target of SDZ-24. Our results imply the important function of intestinal miRNAs, such as let-7, in the regulation of innate immune response to pathogenic infection.

Introduction

The free-living nematode Caenorhabditis elegans lives in soil, and potentially composts rich in the microorganisms, including those that are human microbial pathogens [12]. In the laboratory, once pathogenic bacteria can be deposited in the gut, they will invade the host cells, and even kill the nematodes through infectious processes. C. elegans usually responds to pathogen exposure by avoiding pathogens or activating an inducible innate immune system [3]. C. elegans has been considered as a useful model for the study of innate immunity at least based on the identification of virulence-related microbial genes and immune-based host genes [4]. Moreover, studies in C. elegans may potentially provide evolutionary and mechanistic insights into the signal transduction and the physiology of innate immunity [3]. Both genetic and functional genomic approaches in C. elegans have identified some conserved and important signaling pathways required for the control of innate immunity. Some of these identified conserved signal pathways involve p38 mitogen-activated protein kinase (MAPK), insulin, and TGF-β signaling pathways [58].

microRNAs (miRNAs) are a class of evolutionarily conserved non-coding RNAs with 19–22 nucleotides, and function to negatively regulate the gene expression [9]. miRNAs are encoded within the genome, and mature miRNAs post-transcriptionally regulate the gene expression by imperfectly binding to multiple target mRNAs [10]. miRNAs have been shown to be involved in the control of diverse fundamental biological processes, such as development, cell differentiation, apoptosis, and immune response [9, 1113]. C. elegans is a powerful in vivo model to study how miRNAs regulate the gene expression and regulate various biological processes during the development [11, 14]. Recently, some miRNAs such as mir-84, mir-241, mir-233, mir-251, mir-252, and mir-360 have been shown to be involved in the control of innate immunity in C. elegans [1517].

let-7 is one of the founding members of miRNA family firstly identified in C. elegans via forward genetic screen [18]. Some studies have suggested that let-7 can act as a developmental switch to control the transition from larval to adult [1819]. More recently, it has been shown that let-7 was also involved in the control of innate immunity [20]. However, the underlying molecular mechanism for let-7 in the regulation of innate immunity is still largely unclear. In the present study, we aimed to examine the molecular basis for intestinal let-7 in the regulation of innate immunity. We identified SDZ-24 as a potential target of intestinal let-7 in the regulation of innate immunity. In C. elegans, sdz-24 gene encodes an ortholog of human replication protein A1 (RPA1) [21]. SKN-1, a homolog to Nrf transcription factors, plays an important role in pathogen resistance [22]. Our results suggest that intestinal let-7 could directly target the SDZ-24, and regulated the innate immune response to Pseudomonas aeruginosa PA14 infection by suppressing the function of SDZ-24-SKN-1 signaling cascade. Our findings will not only aid our understanding the molecular basis for intestinal let-7 in the regulation of innate immunity, but will also be helpful for further understanding the complex biological functions of let-7 in animals.

Results

Effects of P. aeruginosa PA14 infection on let-7 expression

In C. elegans, let-7 is expressed in almost all tissues except the germline [23]. Using the transgenic strain of zaEx5[let-7::GFP], we observed that exposure to P. aeruginosa PA14 at least significantly decreased the expression of let-7::GFP in the pharynx, the neurons, and the intestine of infected transgenic strain compared with exposure to Escherichia coli OP50 (Fig 1A). Therefore, P. aeruginosa PA14 infection may suppress the let-7 expression in the body of nematodes.

thumbnail
Fig 1. Response of let-7 to P. aeruginosa PA14 infection.

(A) Effect of P. aeruginosa PA14 infection on let-7::GFP expression. Arrowheads indicate the neurons. Pharynx (*) and intestine (**) were also indicated. Nematodes were infected with P. aeruginosa PA14 for 24-h. Thirty animals were examined. Bars represent mean ± SD. **P < 0.01 vs OP50. (B) Comparison of P. aeruginosa PA14 CFU between wild-type N2 and let-7(mg279) mutants infected with P. aeruginosa PA14. Bars represent mean ± SD. **P < 0.01 vs wild-type. (C) Quantitative real-time PCR analysis of expression patterns of the anti-microbial peptide genes in let-7(mg279) mutant infected with P. aeruginosa PA14. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD.

https://doi.org/10.1371/journal.ppat.1006152.g001

Mutation of let-7 decreased the colony formation of P. aeruginosa PA14 and enhanced the innate immune response

A previous study has demonstrated that the loss-of-function mutant of let-7(mg279) was resistant to P. aeruginosa PA14 infection as indicated by the increased survival compared with that in infected wild-type nematodes [20]. Meanwhile, we found that the loss-of-function mutation of let-7 significantly decreased the colony-forming unit (CFU) of P. aeruginosa PA14 in the body of nematodes (Fig 1B). The normal accumulation of PA14::GFP in the lumen of pharynx of let-7(mg279) mutant implies that mutation of let-7 did not cause the deficit in the feeding of P. aeruginosa PA14 (S1 Fig). Moreover, we investigated the effect of loss-of-function mutation of let-7 on the expression of antimicrobial genes. The examined antimicrobial genes were lys-1, lys-8, clec-85, dod-22, K08D8.5, F55G11.7, and F55G11.4. P. aeruginosa PA14 could induce the significant increase in transcriptional expression of these antimicrobial genes in C. elegans [24]. We observed the noticeable increase in transcriptional expression of some antimicrobial genes (lys-1, dod-22, K08D8.5, F55G11.7, and F55G11.4) in P. aeruginosa PA14 infected let-7(mg279) mutant compared with P. aeruginosa PA14 infected wild-type nematodes (Fig 1C). On plates fed with E. coli OP50, the expression levels of these antimicrobial genes in let-7(mg279) mutant were similar to those in wild-type nematodes (Fig 1C). The let-7(mg279) mutant showed the similar brood size to wild-type (S2 Fig), suggesting that the observed resistance to PA14 infection in let-7(mg279) mutant is not the potential effect of let-7 mutation on fecundity. These results suggest that the loss-of-function mutation of let-7 may suppress the P. aeruginosa PA14 colonization in the body of nematodes, and induce an elevated immune competence.

Tissue-specific activity of let-7 in the regulation of innate immune response to P. aeruginosa PA14 infection

In this study, we next investigated the intestine-, neuron-, pharynx-, muscle-, or hypodermis-specific activity of let-7 in the regulation of innate immune response to P. aeruginosa PA14 infection. After P. aeruginosa PA14 infection, expression of let-7 in the pharynx, the muscle, or the hypodermis did not significantly affect the survival and the CFU of P. aeruginosa PA14 in let-7(mg279) mutant (Fig 2A and 2B). In contrast, after P. aeruginosa PA14 infection, expression of let-7 in the intestine or the neurons significantly reduced the survival, increased the CFU of P. aeruginosa PA14, and decreased the expressions of antimicrobial genes (lys-1, dod-22, K08D8.5, F55G11.7, and F55G11.4) in let-7(mg279) mutant (Fig 2). Additionally, the survival, the CFU of P. aeruginosa PA14, or the expression patterns of antimicrobial genes (lys-1, dod-22, K08D8.5, F55G11.7, and F55G11.4) in P. aeruginosa PA14 infected transgenic strain of let-7(mg279)Ex(Pges-1-let-7) or let-7(mg279)Ex(Punc-14-let-7) were similar to those in P. aeruginosa PA14 infected wild-type nematodes (Fig 2B). Therefore, let-7 may act in the intestine or the neurons to regulate the innate immune response to P. aeruginosa PA14 infection.

thumbnail
Fig 2. Tissue-specific activity of let-7 in the regulation of innate immunity.

(A) Tissue-specific activity of let-7 in the regulation of survival in P. aeruginosa PA14 infected nematodes. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of let-7(mg279)Ex(Pges-1-let-7) (P < 0.0001) or let-7(mg279)Ex(Punc-14-let-7) (P < 0.0001) was significantly different from that of let-7(mg279), and the survival of let-7(mg279)Ex(Pmyo-2-let-7) (P = 0.9643), let-7(mg279)Ex(Pmyo-3-let-7) (P = 0.9234), or let-7(mg279)Ex(Pdpy-7-let-7) (P = 0.9545) was not significantly different from that of let-7(mg279). (B) Tissue-specific activity of let-7 in the regulation of P. aeruginosa PA14 CFU in the body of nematodes. (C) Tissue-specific activity of let-7 in the regulation of expression patterns of anti-microbial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated).

https://doi.org/10.1371/journal.ppat.1006152.g002

Nematodes overexpressing let-7 in the intestine or the neurons were susceptible to P. aeruginosa PA14 infection

To confirm the function of let-7 in the regulation of innate immunity, we investigated the effects of let-7 overexpression in the intestine or the neurons on innate immune response to P. aeruginosa PA14 infection. After exposure to P. aeruginosa PA14, nematodes overexpressing let-7 in the intestine or the neurons exhibited the significant decrease in survival compared with wild-type nematodes (S3A Fig). After exposure to P. aeruginosa PA14, overexpression of let-7 in the intestine or the neurons also resulted in a significant increase in CFU of P. aeruginosa PA14 in the body compared with wild-type nematodes (S3B Fig). Moreover, after exposure to P. aeruginosa PA14, nematodes overexpressing let-7 in the intestine or the neurons showed the decreased expression in antimicrobial genes (lys-1, dod-22, K08D8.5, F55G11.7, and F55G11.4) compared with wild-type nematodes (S3C Fig). These results suggest that the overexpression of let-7 in the intestine or the neurons may induce a susceptible property of nematodes to P. aeruginosa PA14 infection.

Identification of candidate let-7 targets involved in the control of innate immune response to P. aeruginosa PA14 infection

To identify the potential targets for let-7 in the regulation of innate immune response to P. aeruginosa PA14 infection, we first used the TargetScan software to predict the potential targets for let-7 by searching for the presence of conserved sites that match the seed region of let-7, and found 351 potential targets for let-7 in C. elegans (Fig 3A). In C. elegans, a previous study has suggested that 697 genes could be dysregulated by P. aeruginosa PA14 infection [25]. Among the predicted 351 targeted genes, 7 genes (tag-38, nhr-43, mtl-1, nex-4, sdz-24, Y95B8A.6, and K01A2.10) were also dysregulated by P. aeruginosa PA14 infection (Fig 3A).

thumbnail
Fig 3. Identification of candidate targets for let-7 in the regulation of innate immune response to P. aeruginosa PA14 infection.

(A) Search for the candidate targets for let-7 in the regulation of innate immune response to P. aeruginosa PA14 infection. (B) Effects of mutation or RNAi knockdown of candidate targeted genes of let-7 on survival in P. aeruginosa PA14 infected nematodes. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of nhr-43(tm1381) mutant was significantly different from that of wild-type (P < 0.0001), and the survival of sdz-24(RNAi) was significantly different from that of L4440(RNAi) nematodes (P < 0.0001). (C) Effects of mutation or RNAi knockdown of candidate targeted genes of let-7 on CFU of P. aeruginosa PA14 in the body of nematodes. (D) Effects of mutation or RNAi knockdown of candidate targeted genes of let-7 on expression patterns of anti-microbial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression for L4440(RNAi) or nhr-43(tm1381). Normalized expression is presented relative to L4440(RNAi) expression for sdz-24(RNAi). L4440(RNAi), empty vector RNAi. Bars represent mean ± SD. **P < 0.01 vs wild-type or L4440(RNAi).

https://doi.org/10.1371/journal.ppat.1006152.g003

Using the corresponding mutants or RNA interference (RNAi) knockdown animals for these 7 genes, we found that only loss-of-mutation of nhr-43 gene or RNAi knockdown of sdz-24 gene significantly influenced the survival of infected nematodes after P. aeruginosa PA14 infection (Fig 3B). After P. aeruginosa PA14 infection, loss-of-mutation of nhr-43 gene or RNAi knockdown of sdz-24 gene significantly reduced the survival in nematodes (Fig 3B). In C. elegans, NHR-43 is a nuclear hormone receptor (NHR), and SDZ-24 is a SKN-1-dependent zygotic protein. Meanwhile, loss-of-mutation of nhr-43 gene or RNAi knockdown of sdz-24 gene significantly enhanced the colony formation of P. aeruginosa PA14 in the body of nematodes (Fig 3C). Moreover, loss-of-mutation of nhr-43 gene caused the decreased expression in antimicrobial genes (lys-1, lys-8, clec-85, and F55G11.7), and RNAi knockdown of sdz-24 gene resulted in the decreased expression in antimicrobial genes (lys-1, dod-22, K08D8.5, and F55G11.7) (Fig 3D).

Genetic interaction between let-7 and nhr-43 or sdz-24 in the regulation of innate immune response to P. aeruginosa PA14 infection

To confirm the role of nhr-43 or sdz-24 as the targeted gene of let-7, we constructed the double mutants of nhr-43(tm1381);let-7(mg279) and sdz-24(yd101);let-7(mg279). We assumed that the nhr-43 or sdz-24 mutation would suppress the phenotype in nematodes with let-7 mutation, if nhr-43 or sdz-24 is the targeted gene of let-7 in nematodes. To confirmed the function of SDZ-24 in the regulation of innate immunity to P. aeruginosa PA14 infection, we generated the knockout strain for sdz-24 (sdz-24(yd101)) using the clustered, regularly interspersed, short palindromic repeats (CRISPR) RNA-guided Cas9 technique [26]. The related deletion information was shown in S4 Fig. The survival, CFU of P. aeruginosa PA14, and expression patterns of antimicrobial genes in P. aeruginosa PA14 infected sdz-24(yd101) were similar to those in P. aeruginosa PA14 infected sdz-24(RNAi) nematodes (Fig 4). The sdz-24(yd101) mutant also had the normal accumulation of PA14::GFP in the lumen of pharynx, which was similar to that in wild-type nematodes (S1 Fig).

thumbnail
Fig 4. Genetic interaction between let-7 and sdz-24 in the regulation of innate immune response to P. aeruginosa PA14 infection.

(A) Genetic interaction between let-7 and sdz-24 in the regulation of survival in P. aeruginosa PA14 infected nematodes. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of nhr-43(tm1381);let-7(mg279) was not significantly different from that of let-7(mg279) (P = 0.9213), and the survival of sdz-24(yd101);let-7(mg279) was significantly different from that of let-7(mg279) (P < 0.0001). (B) Genetic interaction between let-7 and sdz-24 in the regulation of CFU of P. aeruginosa PA14 in the body of nematodes. (C) Genetic interaction between let-7 and sdz-24 in the regulation of expression patterns of anti-microbial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated).

https://doi.org/10.1371/journal.ppat.1006152.g004

After P. aeruginosa PA14 infection, we found that mutation of sdz-24 gene significantly reduced the survival in let-7(mg279) mutant; however, mutation of nhr-43 gene did not obviously affect the survival in let-7(mg279) mutant (Fig 4A). These results suggest that the SDZ-24, not the NHR-43, is the direct target for let-7 in the regulation of innate immune response to P. aeruginosa PA14 infection.

The assays on CFU of P. aeruginosa PA14 and expression pattern of antimicrobial genes further confirmed the role of SDZ-24 as the direct target for let-7 in the regulation of innate immunity. Mutation of sdz-24 gene significantly increased the CFU of P. aeruginosa PA14 in the body of let-7(mg279) mutant (Fig 4B). Moreover, mutation of sdz-24 gene significantly decreased the expression of antimicrobial genes ((lys-1, dod-22, K08D8.5, and F55G11.7) in let-7(mg279) mutant (Fig 4C).

Effects of let-7 mutation on SDZ-24::GFP expression

In C. elegans, SDZ-24::GFP is primarily expressed in the posterior of intestine (S5 Fig). After P. aeruginosa PA14 infection, the expression of SDZ-24::GFP was significantly increased (S5 Fig), which is different from the effect of the P. aeruginosa PA14 infection on expression of let-7::GFP as indicated above.

Moreover, loss-of-function mutation of let-7 significantly increased the SDZ-24::GFP expression under both the E. coli OP50 exposure condition and the P. aeruginosa PA14 exposure condition (S5 Fig), suggesting that let-7 may potentially suppress the expression of SDZ-24.

Intestinal RNAi of sdz-24 gene caused a susceptible property of nematodes to P. aeruginosa PA14 infection

Considering the fact that the sdz-24 gene is pronounced expressed in the intestine, we investigated the effects of intestinal RNAi of sdz-24 gene on innate immune response to P. aeruginosa PA14 infection using the VP303 strain as the intestinal RNAi tool [27]. After P. aeruginosa PA14 infection, intestinal RNAi of sdz-24 gene significantly reduced the survival, enhanced the CFU of P. aeruginosa PA14 in the body of nematodes, and decreased the expression of antimicrobial genes (lys-1, dod-22, K08D8.5, and F55G11.7) (Fig 5A–5C). We also employed another intestinal RNAi tool of sid-1(qt9) to perform the RNAi assay [28]. We obtained the similar results (S6 Fig). Therefore, intestinal RNAi of sdz-24 gene may induce a susceptible property of nematodes to P. aeruginosa PA14 infection.

thumbnail
Fig 5. Function of SDZ-24 in the regulation of innate immune response to P. aeruginosa PA14 infection.

(A) Effects of intestinal RNAi of sdz-24 gene on survival in P. aeruginosa PA14 infected nematodes. Statistical comparison of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of nematodes with intestinal RNAi of sdz-24 gene was significantly different from that of VP303 strain (P < 0.0001). Bars represent mean ± SD. (B) Effects of intestinal RNAi of sdz-24 gene on CFU of P. aeruginosa PA14 in the body of nematodes. Bars represent mean ± SD. **P < 0.01 vs VP303. (C) Effects of intestinal RNAi of sdz-24 gene on expression patterns of anti-microbial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression for VP303. Normalized expression is presented relative to VP303 for sdz-24(intestinal RNAi). Bars represent mean ± SD. (D) Effects of sdz-24 overexpression in the intestine on survival in P. aeruginosa PA14 infected nematodes. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of nematodes with sdz-24 overexpression in the intestine was significantly different from that of wild-type nematodes (P < 0.0001). Bars represent mean ± SD. (E) Effects of sdz-24 overexpression in the intestine on CFU of P. aeruginosa PA14 in the body of nematodes. Bars represent mean ± SD. **P < 0.01 vs wild-type. (F) Effects of sdz-24 overexpression in the intestine on expression patterns of anti-microbial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD.

https://doi.org/10.1371/journal.ppat.1006152.g005

Effects of intestinal sdz-24 overexpression on innate immune response to P. aeruginosa PA14 infection

Different from the effects of intestinal RNAi of sdz-24 gene on innate immune response to P. aeruginosa PA14 infection, we observed that overexpression of sdz-24 gene in the intestine led to significant increase in the survival, decrease in the CFU of P. aeruginosa PA14 in the body of nematodes, and enhancement of the expression of antimicrobial genes (lys-1, dod-22, K08D8.5, and F55G11.7) after P. aeruginosa PA14 infection (Fig 5D–5F). These results suggest that overexpression of sdz-24 gene in the intestine may induce a resistance for nematodes against the toxic effects from P. aeruginosa PA14 infection, which further confirms the important function of SDZ-24 in the intestine in the regulation of innate immunity.

Interaction between let-7 and SDZ-24 in the intestine in the regulation of innate immunity to P. aeruginosa PA14 infection

To further determine the genetic interaction between let-7 and SDZ-24 in the intestine in the regulation of innate immunity, we introduced the sdz-24 lacking 3’-UTR driven by ges-1 promoter, an intestine-specific promoter, into the nematodes overexpressing intestinal let-7. After P. aeruginosa PA14 infection, the transgenic strain of Ex(Pges-1-sdz-24-3’-UTR);Is(Pges-1-let-7) exhibited the similar survival, CFU of P. aeruginosa PA14, and expression patterns of antimicrobial genes (lys-1, dod-22, K08D8.5, and F55G11.7) to those in the transgenic strain of Ex(Pges-1-sdz-24-3’-UTR) (Fig 6A–6C). Meanwhile, the survival, CFU of P. aeruginosa PA14, and expression patterns of antimicrobial genes (lys-1, dod-22, K08D8.5, and F55G11.7) in P. aeruginosa PA14 infected transgenic strain of Ex(Pges-1-sdz-24-3’-UTR);Is(Pges-1-let-7) were significantly different from those in P. aeruginosa PA14 infected transgenic strain of Is(Pges-1-let-7) (Fig 6A–6C). These results suggest that the overexpression of sdz-24 gene lacking 3’-UTR in the intestine may effectively suppress the susceptible property of nematodes overexpressing intestinal let-7. Very different from these, we found that intestinal overexpression of let-7 could significantly reduce the survival, enhance the CFU of P. aeruginosa PA14, and decrease the expressions of antimicrobial genes (lys-1, dod-22, K08D8.5, and F55G11.7) in P. aeruginosa PA14 infected transgenic strain of Ex(Pges-1-sdz-24+3’-UTR);Is(Pges-1-let-7) (Fig 6D–6F), suggesting the effects of intestinal expression of let-7 on innate immunity.

thumbnail
Fig 6. Effects of intestinal overexpression of sdz-24 lacking 3’-UTR or containing 3’-UTR on innate immune response to P. aeruginosa PA14 infection in nematodes overexpressing intestinal let-7.

(A) Effects of intestinal overexpression of sdz-24 lacking 3’-UTR on survival in P. aeruginosa PA14 infected nematodes overexpressing intestinal let-7. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of transgenic strain of Ex(Pges-1-sdz-24-3’-UTR);Is(Pges-1-let-7) was significantly different from that of transgenic strain of Is(Pges-1-let-7) (P < 0.0001). (B) Effects of intestinal overexpression of sdz-24 lacking 3’-UTR on CFU of P. aeruginosa PA14 in P. aeruginosa PA14 infected nematodes overexpressing intestinal let-7. (C) Effects of intestinal overexpression of sdz-24 lacking 3’-UTR on expression patterns of anti-microbial genes in P. aeruginosa PA14 infected nematodes overexpressing intestinal let-7. Normalized expression is presented relative to wild-type expression. (D) Effects of intestinal overexpression of sdz-24 containing 3’-UTR on survival in P. aeruginosa PA14 infected nematodes overexpressing intestinal let-7. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of transgenic strain of Ex(Pges-1-sdz-24+3’-UTR);Is(Pges-1-let-7) was significantly different from that of transgenic strain of Ex(Pges-1-sdz-24+3’-UTR) (P < 0.0001). (E) Effects of intestinal overexpression of sdz-24 containing 3’-UTR on CFU of P. aeruginosa PA14 in P. aeruginosa PA14 infected nematodes overexpressing intestinal let-7. (F) Effects of intestinal overexpression of sdz-24 containing 3’-UTR on expression patterns of anti-microbial genes in P. aeruginosa PA14 infected nematodes overexpressing intestinal let-7. Normalized expression is presented relative to wild-type expression. -, lacking 3’-UTR; +, containing 3’-UTR. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated).

https://doi.org/10.1371/journal.ppat.1006152.g006

In vivo 3’-UTR binding assay of sdz-24

To further confirm whether SDZ-24 is a direct target of let-7, we constructed a GFP vector driven by ges-1 promoter, which contained the 3’-UTR of the sdz-24 (Pges-1::GFP-3’-UTR (sdz-24 wt) or Pges-1::GFP-3’-UTR (sdz-24 mut)). Because let-7 can not bind to the tag-192 3’-UTR, a Pges-1::mCherry-3’-UTR (tag-192) construct was used as an internal control. After P. aeruginosa PA14 infection, the GFP expression was noticeably reduced in wild-type nematodes; however, mutagenesis of the putative binding site for let-7 in sdz-24 3’-UTR abolished this inhibition of GFP expression in wild-type nematodes (Fig 7). Moreover, after P. aeruginosa PA14 infection, the GFP expression was much higher in let-7(mg279) mutant than that in wild-type nematodes (Fig 7). These results further confirmed that let-7 may suppress the function of SDZ-24 through binding to its 3’-UTR and inhibiting its translation in P. aeruginosa PA14 infected nematodes.

thumbnail
Fig 7. Fluorescence images of the sdz-24-3’-UTR GFP reporter in nematodes grown on E. coli OP50 or P. aeruginosa PA14.

Bars represent mean ± SD. **P < 0.01 vs wt on OP50 (if not specially indicated).

https://doi.org/10.1371/journal.ppat.1006152.g007

Interaction between sdz-24 and genes encoding some known signaling pathways in the regulation of innate immune response to P. aeruginosa PA14 infection

To determine the intestinal SDZ-24-mediated signaling pathway in the control of innate immunity, we investigated the genetic interaction between SDZ-24 and some known signaling pathways involved in the control of innate immune response to P. aeruginosa PA14 infection. In C. elegans, daf-16 gene encodes a FOXO transcription factor in insulin signaling pathway, and dbl-1 gene encodes a TGF-β ligand in TGF-β signaling pathway. In the p38 MAPK signaling pathway, pmk-1 gene encoded a MAPK, sek-1 gene encoded a MAPK kinase (MAPKK), and nsy-1 gene encoded a MAPK kinase kinase (MAPKKK). After P. aeruginosa PA14 infection, RNAi knockdown of daf-16 or dbl-1 gene did not significantly affect the survival in transgenic nematodes overexpressing intestinal sdz-24; however, RNAi knockdown of pmk-1, sek-1, or nsy-1 gene significantly suppressed the survival in transgenic nematodes overexpressing intestinal sdz-24 (Fig 8A and 8B), suggesting that RNAi knockdown of genes encoding the p38 MAPK signaling pathway may potentially inhibit the resistant property of transgenic nematodes overexpressing intestinal sdz-24 to P. aeruginosa PA14 infection. RNAi knockdown of pmk-1, sek-1, or nsy-1 gene also significantly increased the CFU of P. aeruginosa PA14 in the body of P. aeruginosa PA14 infected transgenic nematodes overexpressing intestinal sdz-24 (Fig 8C). Moreover, RNAi knockdown of pmk-1, sek-1, or nsy-1 gene significantly decreased the expression of antimicrobial genes (lys-1, dod-22, K08D8.5, and F55G11.7) in P. aeruginosa PA14 infected transgenic nematodes overexpressing intestinal sdz-24 (Fig 8D).

thumbnail
Fig 8. Genetic interactions between SDZ-24 and some known signaling pathways in the regulation of innate immune response to P. aeruginosa PA14 infection.

(A) Genetic interaction between SDZ-24 and PMK-1, DAF-16, or DBL-1 in the regulation of survival in P. aeruginosa PA14 infected nematodes. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of Ex(Pges-1-sdz-24);pmk-1(RNAi) (P < 0.0001) was significantly different from that of Ex(Pges-1-sdz-24), and the survival of daf-16(RNAi);Ex(Pges-1-sdz-24) (P = 0.9463) or Ex(Pges-1-sdz-24);dbl-1(RNAi) (P = 0.9619) was not significantly different from that of Ex(Pges-1-sdz-24). (B) Genetic interaction between SDZ-24 and PMK-1, SEK-1, or NSY-1 in the regulation of survival in P. aeruginosa PA14 infected nematodes. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of Ex(Pges-1-sdz-24);pmk-1(RNAi), Ex(Pges-1-sdz-24);sek-1(RNAi), or Ex(Pges-1-sdz-24);nsy-1(RNAi) was significantly different from that of Ex(Pges-1-sdz-24) (P < 0.0001). (C) Genetic interaction between SDZ-24 and PMK-1, SEK-1, or NSY-1 in the regulation of CFU of P. aeruginosa PA14 in P. aeruginosa PA14 infected nematodes. (D) Genetic interaction between SDZ-24 and PMK-1, SEK-1, or NSY-1 in the regulation of expression patterns of anti-microbial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated).

https://doi.org/10.1371/journal.ppat.1006152.g008

To confirm the interaction between SDZ-24 and p38 MAPK signaling pathway in the regulation of innate immunity to P. aeruginosa PA14 infection, we further examined the effect of sdz-24 mutation on expression of some immune effectors (T24B8.5, F08G5.6, and F35E12.5) for the p38 MAPK signaling pathway [2930]. However, we found that mutation of sdz-24 did not significantly affect the expression of these immune effectors for the p38 MAPK signaling pathway (S7A Fig). Moreover, mutation of sdz-24 also did not significantly affect the expression of phosphorylated PMK-1 compared with wild-type (S7B Fig). Therefore, SDZ-24 may actually do not act upstream of the p38 MAPK signaling pathway to regulate innate immunity in P. aeruginosa PA14 infected nematodes.

Genetic interaction of sdz-24 with skn-1 in the regulation of innate immune response to P. aeruginosa PA14 infection

Considering the fact that SDZ-24 is a SKN-1-dependent protein, we next investigated the genetic interaction between SDZ-24 and SKN-1 in the regulation of innate immune response to P. aeruginosa PA14 infection. After P. aeruginosa PA14 infection, RNAi knockdown of skn-1 gene significantly reduced the survival in transgenic nematodes overexpressing intestinal sdz-24 (Fig 9A), suggesting that RNAi knockdown of skn-1 gene may suppress the resistant property of nematodes overexpressing intestinal sdz-24 to P. aeruginosa PA14 infection. RNAi knockdown of skn-1 gene further significantly increased the CFU of P. aeruginosa PA14 in the body of infected nematodes overexpressing intestinal sdz-24 (Fig 9B). Moreover, RNAi knockdown of skn-1 gene significantly inhibited the expression of antimicrobial genes (lys-1, dod-22, K08D8.5, and F55G11.7) in P. aeruginosa PA14 infected nematodes overexpressing intestinal sdz-24 (Fig 9C). Therefore, the function of SDZ-24 in the regulation of innate immunity may be dependent on the SKN-1.

thumbnail
Fig 9. Genetic interaction between SDZ-24 and SKN-1 in the regulation of innate immune response to P. aeruginosa PA14 infection.

(A) Genetic interaction between SDZ-24 and SKN-1 in the regulation of survival in P. aeruginosa PA14 infected nematodes. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of Ex(Pges-1-sdz-24);skn-1(RNAi) was significantly different from that of Ex(Pges-1-sdz-24) (P < 0.0001). (B) Genetic interaction between SDZ-24 and SKN-1 in the regulation of CFU of P. aeruginosa PA14 in P. aeruginosa PA14 infected nematodes. (C) Genetic interaction between SDZ-24 and SKN-1 in the regulation of expression patterns of anti-microbial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression. (D) Effects of intestinal RNAi of skn-1 gene on survival in P. aeruginosa PA14 infected nematodes. Statistical comparison of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of nematodes with intestinal RNAi of skn-1 gene was significantly different from that of VP303 strain (P < 0.0001). (E) Effects of intestinal RNAi of skn-1 gene on CFU of P. aeruginosa PA14 in the body of nematodes. (F) Effects of intestinal RNAi of skn-1 gene on expression patterns of anti-microbial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated).

https://doi.org/10.1371/journal.ppat.1006152.g009

Previous study has demonstrated that SKN-1 is involved in the control of innate immunity [22]. We further found that, after P. aeruginosa PA14 infection, intestinal RNAi of skn-1 gene significantly decreased the survival, enhanced the CFU of P. aeruginosa PA14 in the body, and suppressed the expression of antimicrobial genes (lys-1, dod-22, K08D8.5, F55G11.7, and F55G11.4) compared with VP303 (Fig 9D–9F), suggesting that skn-1 gene can act in the intestine to regulate the innate immune response to P. aeruginosa PA14 infection.

Genetic interaction of sdz-24 with daf-2 in the regulation of innate immune response to P. aeruginosa PA14 infection

The transcriptional factor of SKN-1/Nrf usually acts downstream of DAF-2, the insulin receptor in the insulin signaling pathway, to regulate the biological processes such as longevity [31]. We further asked whether SDZ-24 can function through the insulin signaling to regulate the innate immunity. We found that mutation of sdz-24 gene significantly inhibited the resistant property of daf-2(e1370) mutant to P. aeruginosa PA14 infection (Fig 10A). Mutation of sdz-24 gene also significantly increased the CFU of P. aeruginosa PA14 in the body of P. aeruginosa PA14 infected daf-2(e1370) mutant nematodes (Fig 10B). Moreover, mutation of sdz-24 gene significantly suppressed the expression of antimicrobial genes (lys-1, dod-22, K08D8.5, and F55G11.7) in P. aeruginosa PA14 infected daf-2(e1370) mutant nematodes (Fig 10C). Therefore, SDZ-24 may act downstream of DAF-2 to regulate the innate immunity.

thumbnail
Fig 10. Genetic interaction between sdz-24 and daf-2 in the regulation of innate immune response to P. aeruginosa PA14 infection.

(A) Genetic interaction between sdz-24 and daf-2 in the regulation of survival in P. aeruginosa PA14 infected nematodes. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of sdz-24(yd101);daf-2(e1370) was not significantly different from that of sdz-24(RNAi) (P = 0.9218), and the survival of sdz-24(yd101);daf-2(e1370) was significantly different from that of daf-2(e1370) (P < 0.0001). (B) Genetic interaction between sdz-24 and daf-2 in the regulation of CFU of P. aeruginosa PA14 in the body of nematodes. (C) Genetic interaction between sdz-24 and daf-2 in the regulation of expression patterns of anti-microbial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated).

https://doi.org/10.1371/journal.ppat.1006152.g010

Discussion

In C. elegans, the miRNA of let-7 may have multiple biological functions by suppressing the functions of different targets. It has been shown that let-7 is involved in the control of developmental timing [1819]. In this study, we observed that P. aeruginosa PA14 infection could significantly decrease the expression of let-7::GFP (Fig 1). Meanwhile, the loss-of-function mutation of let-7 could induce a resistant property to P. aeruginosa PA14 infection, suppress the P. aeruginosa PA14 colonization, and lead to an elevated innate immune response (Fig 1B and 1C) [20]. Therefore, let-7 may encode a protection mechanism for nematodes against the toxic effects of P. aeruginosa PA14 infection. An emerging body of data has demonstrated the immune response induction as a source of cellular stress for nematodes [3233]. Our data suggest the important physiological role of let-7 in suppressing the immune response genes.

Previous study has implied that LIN-41 and HBL-1, two proteins required for the control of developmental timing, may act as the potential targets for let-7 in the regulation of innate immunity [20]. In this study, we further identified the other potential targets for let-7 in the regulation of innate immune response to P. aeruginosa PA14 infection. Based on the information from TargetScan prediction and dysregulated mRNA profiling induced by P. aeruginosa PA14 infection, we identified 7 candidate molecular targets for let-7 in the regulation of innate immune response to P. aeruginosa PA14 infection (Fig 3A). Among these 7 candidate targets, SDZ-24 was identified as a direct target for let-7 in the regulation of innate immune response to P. aeruginosa PA14 infection based on the assays of survival, CFU of P. aeruginosa PA14, expression pattern of antimicrobial genes, genetic interaction, and in vivo sdz-24 3’-UTR analysis (Figs 3B–3D, 4 and 7). These results imply that let-7 could directly target both the developmental timing proteins and the non-developmental timing proteins, such as the SDZ-24, to regulate the innate immune response. In C. elegans, mutation of sdz-24 did not affect the longevity (S8 Fig).

Nevertheless, we did not found that P. aeruginosa PA14 infection could significantly alter the expression levels of lin-41 and hbl-1 [25]. This implies that the altered expression of let-7 may be not enough to affect the expression of its targets of LIN-41 and HBL-1 in nematodes infected with P. aeruginosa PA14. Or, besides the let-7, the function of LIN-41 and HBL-1 in the regulation of innate immunity may be also under the control of other miRNAs or signaling pathways. In this study, we also found NHR-43 did not act as a direct target for let-7 in the regulation of innate immune response to P. aeruginosa PA14 infection (Fig 4A), although the nhr-43 gene was involved in the control of innate immunity (Fig 3B–3D), implying that other still unidentified miRNAs may target the NHR-43 to regulate the innate immune response to P. aeruginosa PA14 infection.

The tissue-specific activity assay indicated that let-7 could function in intestine to regulate the innate immune response to P. aeruginosa PA14 infection. The expression of let-7 in the intestine could reduce the survival, increase the CFU of P. aeruginosa PA14, and decrease the expression of antimicrobial genes (lys-1, dod-22, K08D8.5, F55G11.7, and F55G11.4) in let-7(mg279) after P. aeruginosa PA14 infection (Fig 2). Overexpression of let-7 in the intestine could reduce the survival, increase the CFU of P. aeruginosa PA14, and decrease the expression of antimicrobial genes (lys-1, dod-22, K08D8.5, F55G11.7, and F55G11.4) in P. aeruginosa PA14 infected wild-type nematodes (S3 Fig). In this study, we provide several lines of evidence to prove that SDZ-24 may act as a direct intestinal target for let-7 in the regulation of innate immune response to P. aeruginosa PA14 infection. Firstly, after P. aeruginosa PA14 infection, loss-of-function of let-7 significantly increased the expression of intestinal SDZ-24::GFP (S5 Fig). Secondly, intestinal RNAi of sdz-24 gene could reduce the survival, increased the CFU of P. aeruginosa PA14, and suppressed the expression of antimicrobial genes (lys-1, dod-22, K08D8.5, and F55G11.7) after P. aeruginosa PA14 infection (Fig 5A–5C). Thirdly, after P. aeruginosa PA14 infection, overexpression of sdz-24 gene in the intestine caused significant increase in the survival, decrease in the CFU of P. aeruginosa PA14, and enhancement of the expression of antimicrobial genes (lys-1, dod-22, K08D8.5, and F55G11.7) (Fig 5D–5F). More importantly, we found that the intestinal overexpression of sdz-24 lacking 3’-UTR could effectively suppress the susceptible property of nematodes overexpressing intestinal let-7 to P. aeruginosa PA14 infection (Fig 6A–6C). Different from this, we could observe the effects of intestinal expression of let-7 on innate immunity in P. aeruginosa PA14 infected transgenic strain overexpressing sdz-24 containing its 3’-UTR (Fig 6D–6F).

Moreover, our tissue-specific activity assay also indicated that let-7 may further act in the neurons to regulate the innate immune response to P. aeruginosa PA14 infection. The expression of let-7 in the neurons reduced the survival, increased the CFU of P. aeruginosa PA14, and decreased the expression of antimicrobial genes (lys-1, dod-22, K08D8.5, F55G11.7, and F55G11.4) in let-7(mg279) after P. aeruginosa PA14 infection (Fig 2). Additionally, overexpression of the let-7 in the neurons also reduced the survival, increased the CFU of P. aeruginosa PA14, and decreased the expression of antimicrobial genes (lys-1, dod-22, K08D8.5, F55G11.7, and F55G11.4) in P. aeruginosa PA14 infect wild-type nematodes (S3 Fig). These results imply that let-7 may further mediate certain neuronal signaling pathway(s) to regulate the innate immunity. However, so far, we still do not know the possible direct neuronal target for let-7 in the regulation of innate immune response to P. aeruginosa PA14 infection.

For the intestinal SDZ-24-mediated signaling pathways, we found that the intestinal SDZ-24 may act upstream of SKN-1/Nrf to regulate the innate immunity, because RNAi knockdown the skn-1 gene could significantly decrease the survival, increase the CFU of P. aeruginosa PA14, and inhibit the expression of antimicrobial genes (lys-1, dod-22, K08D8.5, and F55G11.7) in nematodes overexpressing intestinal sdz-24 (Fig 9A–9C). It was reported that P. aeruginosa PA14 infection led to the intestinal SKN-1 accumulation [22]. In C. elegans, mir-84 and mir-241, the other members in let-7 family, could even regulate the innate immune response to P. aeruginosa PA14 infection by directly targeting SKN-1 [15]. It was reported that PMK-1 in the p38 MAPK signaling pathway acted upstream of SDZ-24 in the regulation of innate immunity [20]. In addition, SKN-1 could act downstream of p38 MAPK signaling pathway in the regulation of innate immunity [15]. These results imply the existence of signaling cascade of PMK-1-SDZ-24-SKN-1 in the intestine in the regulation of innate immunity. Meanwhile, after P. aeruginosa PA14 infection, intestinal RNAi knockdown of skn-1 did not significantly affect the sdz-24 expression (S9 Fig). In C. elegans, sdz-24 encodes an ortholog of human RPA1, and may have nucleic acid binding activity based on the protein domain information [21, 34]. However, it is still unclear whether sdz-24 can potentially have the nucleic acid binding activity with its targeted genes for the reason of lack of direct evidence.

In this study, we further found that intestinal SDZ-24 could act downstream of DAF-2 in the insulin signaling pathway to regulate the innate immunity, since RNAi knockdown the sdz-24 gene reduced the survival, increased the CFU of P. aeruginosa PA14, and suppressed the expression of antimicrobial genes (lys-1, dod-22, K08D8.5, and F55G11.7) in daf-2(e1370) mutant nematodes (Fig 10). In C. elegans, both the daf-2 gene and the sdz-24 gene can act in the intestine to regulate the innate immunity (Fig 5) [8]. Therefore, in the intestine, the DAF-2-SDZ-24-SKN-1 signaling cascade may be also formed to be involved in the control of innate immune response to P. aeruginosa PA14 infection.

In conclusion, in this study, we examined the tissue-specific activity of let-7 in the regulation of innate immune response to P. aeruginosa PA14 infection. We found that let-7 could function in both the intestine and the neurons to regulate the innate immunity. During the control of innate immune response to P. aeruginosa PA14 infection, we identified the SDZ-24 protein as a direct target for let-7 in the intestine. let-7 could regulate the innate immune response to P. aeruginosa PA14 infection by suppressing both the expression and the function of intestinal SDZ-24. Moreover, we raised the SDZ-24-mediated signaling cascades potentially formed in the intestine for nematodes against the P. aeruginosa PA14 infection. Our results provide an important molecular basis for the intestinal let-7 in the regulation of innate immunity. Our results will further highlight the crucial role of intestinal miRNAs for animals against the pathogen infection.

Materials and Methods

C. elegans strains

Nematodes strains used in the present study were wild-type N2, mutants of let-7(mg279), eat-2(ad465), sdz-24(yd101), sid-1(qt9), tag-38(tm470), nhr-43(tm1381), mtl-1(tm1770), nex-4(gk102), daf-2(e1370), Y95B8A.6(tm5312), nhr-43(tm1381);let-7(mg279), sdz-24(dy101);let-7(mg279), and sdz-24(dy101);daf-2(e1370), and transgenic strains of zaEx5[let-7::GFP], let-7(mg279)Ex(Pges-1-let-7), let-7(mg279)Ex(Punc-14-let-7), let-7(mg279)Ex(Pmyo-2-let-7), let-7(mg279)Ex(Pmyo-3-let-7), let-7(mg279)Ex(Pdpy-7-let-7), Is(Pges-1-let-7), Is(Punc-14-let-7), Ex(Psdz-24-sdz-24::GFP), Ex(Psdz-24-sdz-24::GFP);let-7(mg279), VP303/kbIs7[nhx-2p::rde-1], Ex(Pges-1-sdz-24), Ex(Pges-1-sdz-24);Is(Pges-1-let-7), Ex(Pges-1-sdz-24-3’-UTR), Ex(Pges-1-sdz-24-3’-UTR);Is(Pges-1-let-7), daf-16(RNAi);Ex(Pges-1-sdz-24), Ex(Pges-1-sdz-24);dbl-1(RNAi), Ex(Pges-1-sdz-24);pmk-1(RNAi), Ex(Pges-1-sdz-24);sek-1(RNAi), Ex(Pges-1-sdz-24)nsy-1(RNAi), and Ex(Pges-1sdz-24);skn-1(RNAi). Nematodes were basically maintained on nematode growth medium (NGM) plates seeded with E. coli OP50 at 20°C as described [35].

P. aeruginosa PA14 pathogenesis assay

Age synchronous populations of L4-larvae were prepared as described [36]. The L4-larvae were infected with P. aeruginosa PA14 as described [37]. P. aeruginosa PA14 was cultured in Luria broth, and seeded on killing plates containing a modified NGM (0.35% instead of 0.25% peptone). P. aeruginosa PA14 was incubated first at 37°C for 24-h and then at 25°C for 24-h. The P. aeruginosa PA14 infection was started by adding 60 animals to each plate at 25°C. Full-lawn PA14 killing plates were prepared for P. aeruginosa PA14 infection.

Survival assay

Survival assay was performed basically as described [38]. During the P. aeruginosa PA14 infection, nematodes were scored for dead or live every 12-h. Nematodes would be scored as dead if no response was detected after prodding with a platinum wire. The hermaphrodite nematodes were transferred daily at 25°C for the first 5 days of adulthood. For survival assay, three replicates were performed. For the survival assay, the killing plates contained the modified NGM, as well as of fluoro-29-deoxyuridine (FUdR, 75 μ g/mL) to prevent the growth of progeny. Survival curve data were statistically analyzed using the log-rank test. The survival curves were considered to be significantly different from the control when the p-values were less than 0.01.

P. aeruginosa CFU analysis

CFU of P. aeruginosa PA14 was analyzed as described [39]. After P. aeruginosa PA14 infection for 24-h, nematodes were transferred into 25 mM levamisole to paralyze nematodes and to stop the pharyngeal pumping. Nematodes were then placed on a NGM plate containing ampicillin (1 mg/mL) and gentamicin (1 mg/mL) for 15-min in order to eliminate the P. aeruginosa PA14 stuck to the body of animals. Nematodes were transferred onto a new NGM plate containing ampicillin (1 mg/mL) and gentamicin (1 mg/mL) for 30-min to further eliminate the external P. aeruginosa PA14. After that, the nematodes were lysed with a motorized pestle. The lysates were serially diluted with M9 buffer, and plated on Luria-Bertani plates containing rifampicin (100 μg/mL) for the selection of P. aeruginosa PA14. After incubation at 37°C overnight, colonies of P. aeruginosa PA14 were counted to determine the CFU per nematode. Ten nematodes were examined per treatment, and six replicates were performed.

Quantitative real-time polymerase chain reaction (qRT-PCR)

The nematodes were infected with P. aeruginosa PA14 for 24-h. Total nematode RNA (~ 1 μg) was extracted using RNeasy Mini kit (Qiagen), and reverse-transcribed using a cDNA synthesis kit (Bio-Rad Laboratories). qRT-PCR was performed at the optimized annealing temperature of 58°C. The examined targeted genes were lys-1, lys-8, clec-85, dod-22, K08D8.5, F55G11.7, F55G11.4, T24B8.5, F08G5.6, and F35E12.5. Relative quantification of targeted genes in comparison to reference tba-1 gene, encoding a tubulin, was determined. The final results were expressed as the relative expression ratio between the targeted gene and the reference tba-1 gene. The designed primers for targeted genes and reference tba-1 gene were shown in S1 Table. Six replicates were performed.

Brood size assay

The brood size was analyzed as described [40]. To assay brood size, the number of offspring at all stages beyond the egg was counted. Ten nematodes were used for each reproduction assay, and three replicates were performed.

Bioinformatics analysis for targeted gene prediction of let-7

The corresponding targeted genes for let-7 were firstly predicted using the TargetScan software by searching for the presence of conserved sites that match the seed region of let-7 (version 6.2, http://www.targetscan.org/worm_52/). This prediction results were confirmed by mirBase, PicTar, and miRanda assays. After that, we further screened whether the predicted targeted genes of let-7 could also be dysregulated by P. aeruginosa PA14 infection [25].

DNA constructs and germline transformation

To generate entry vector carrying promoter sequence, ges-1 promoter used for the intestine-specific expression, unc-14 promoter used for the neuron-specific expression, myo-2 promoter used for the pharynx-specific expression, myo-3 promoter used for the muscle-specific expression, or dpy-7 promoter used for the hypodermis-specific expression was amplified by PCR from C. elegans genomic DNA. The ges-1, unc-14, myo-2, myo-3, or dpy-7 promoter was inserted into pPD95_77 vector in the sense orientation. The let-7, or sdz-24/K07E8.3.1 cDNA lacking 3’-UTR or containing 3’-UTR was amplified by PCR, verified by sequencing, and inserted into the corresponding entry vector behind the ges-1, unc-14, myo-2, myo-3, or dpy-7 promoter. Transgenic nematodes were generated as described by coinjecting the testing DNA at a concentration of 10–40 μg/mL and a marker DNA (Pdop-1::rfp) at a concentration of 60 μg/mL into the gonad of nematodes [41]. The designed primers for DNA construct generation were shown in S2 Table.

Generation of sdz-24 knockout strain using Cas9-triggered homologous recombination

The method was performed as described [26]. To generate deletion allele of sdz-24, we targeted the fragment corresponding to the first exon. To clone the sequence with the target sites into the sgRNA expression vector, we designed the primers of Guide F (5’-CCCTATTCCATCACTCACTC-3’), and Guide R (5’-TCCTGCTCACCGACTCGTT-3’). To target Cas9 to the genomic sequence of sdz-24, we inserted the desired targeting sequence into the Cas9-sgRNA construct (pDD162) using the Q5 site-directed mutagenesis kit (New England BioLabs) using the forward primer (5′-N19GTTTTAGAGCTAGAAATAGCAAGT-3′) and the reverse primer (5′-CAAGACATCTCGCAATAGG-3′). For this deletion construction, we injected 20 animals with a mixture containing 5 ng/ml Pmyo-3::mCherry (pCFJ104), and 50 ng/ml of each of the two sgRNAs using standard microinjection procedures as described [41]. From transgenic F1 animals expressing mCherry, a region surrounding the target site of sdz-24 was PCR amplified using primers of sdz-24 PL (5’- CACTTTCACAAATGCTCCGCCTA-3’), and sdz-24 PR (5’- GGCCTGTGCGATTTGGATATCTT-3’) in order to confirm the knockout animals. The homozygous mutant lines were established by isolating single F2 nematodes and determining their genotype by PCR and sequence analysis.

3’-UTR reporters and microscopy

The 3’-UTR (wt) of sdz-24 was PCR amplified from genomic DNA. A sdz-24 3’-UTR (mut) reporter was constructed by replacing putative let-7 binding site with an oligonucleotide containing the exact complementary sequence of let-7. The synthesized sdz-24 3’-UTR (mut) sequence is ATAGAATTCTTTGCCGTGTGTAACCGAATGGCTCAATAAAGAGGGAAAGTGTCCAACATGCCGCAAGTTGCTTCTCAACCCCGGGATGATGGAGTATTGAATTAAATTTATAATATTTTTAGTGTCTCAAGTTTGTATTTTGAATGTATGAGAATATTTCGAAAAAATTATATCATGAATTACTTTCTTCTTATAACCTGGAACACAACAAAGGGGCCCTAT. The 3’ UTR reporter construct (Pges-1::GFP-3’ UTR (sdz-24 wt) or Pges-1::GFP-3’ UTR (sdz-24 mut)) and mCherry internal control (Pges-1::mCherry-3’ UTR (tag-192)) plasmid were coinjected into the gonad of nematodes as described [41]. The expression of GFP and mCherry was observed and analyzed under a fluorescence microscope (Olympus BX41, Olympus Corporation, Japan). The designed primers for related DNA construct generation were shown in S2 Table.

RNAi assay

RNAi was performed by feeding nematodes with E. coli strain HT115 (DE3) expressing double-stranded RNA that is homologous to a target of sdz-24, K01A2.10, daf-16, dbl-1, pmk-1, sek-1, nsy-1, or skn-1 gene as described [42]. E. coli HT115 (DE3) was first grown in LB broth containing ampicillin (100 μg/mL) at 37°C overnight, and then plated onto NGM plants containing ampicillin (100 μg/mL) and isopropyl 1-thio-β-D-galactopyranoside (IPTG, 5 mM). L2 larvae of certain strain were transferred onto RNAi plates for 2 days at 20°C until they developed into the gravid. The gravid adults were further transferred onto the fresh RNAi-expressing bacterial lawns to let them lay eggs for 2 h to obtain the second generation of RNAi population. The eggs were allowed to develop at 20°C to young adults for the subsequent survival, CFU of P. aeruginosa PA14, and gene expression pattern assays.

Western blotting assay

The method was performed as described previously [43]. Nematode protein was extracted and electrophoresed on a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel. The gel was transferred to a nitrocellulose membrane using a Bio-Rad semi-dry transfer apparatus. After pre-incubation with 5% nonfat milk in TBST buffer (10 mM Tris, pH 8.0, 150 mM NaCl and 0.5% Tween 20) for 30 min, the membrane was incubated with a primary antibody in TBST buffer with 5% nonfat milk for 12 h at 4°C. After washing with the TBST buffer, the membrane was further incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody for 1.5 h. The membrane was then developed with ECL system (Thermo Scientific). Anti-phospho-p38 MAPK monoclonal antibody 28B10 (1:500) was from Cell Signaling, and anti-Actin monoclonal antibody MAB1501 (1:5000) was from EMD Millipore. The goat anti-mouse IgG antibody (H&L) [HRP] (1:10 000) was from GenScript. Three replicates were performed.

Statistical analysis

All data in this article were expressed as means ± standard deviation (SD). Graphs were generated using Microsoft Excel (Microsoft Corp., Redmond, WA). Statistical analysis was performed using SPSS 12.0 (SPSS Inc., Chicago, USA). Differences between groups were determined using analysis of variance (ANOVA). Probability levels of 0.05 and 0.01 were considered statistically significant.

Supporting Information

S1 Fig. Accumulation of PA14::GFP in the lumen of pharynx in wild-type and mutant nematodes.

https://doi.org/10.1371/journal.ppat.1006152.s001

(DOC)

S2 Fig. Brood size in wild-type and let-7 mutant nematodes.

https://doi.org/10.1371/journal.ppat.1006152.s002

(DOC)

S3 Fig. Effects of let-7 overexpression in the intestine or the neurons on innate immunity.

https://doi.org/10.1371/journal.ppat.1006152.s003

(DOC)

S4 Fig. Generation of sdz-24 deletion by CRISPR/Cas9.

(A) Gene predictions with sgRNA target sites.

https://doi.org/10.1371/journal.ppat.1006152.s004

(DOC)

S5 Fig. let-7 mutation altered the expression of SDZ-24::GFP.

https://doi.org/10.1371/journal.ppat.1006152.s005

(DOC)

S6 Fig. Effects of intestinal RNAi of sdz-24 gene on innate immune response to P. aeruginosa PA14 infection.

https://doi.org/10.1371/journal.ppat.1006152.s006

(DOC)

S7 Fig. Effect of sdz-24 mutation on expression of immune effectors of p38 MAPK signaling pathway and phosphorylated PMK-1 in P. aeruginosa PA14 infected nematodes.

https://doi.org/10.1371/journal.ppat.1006152.s007

(DOC)

S8 Fig. Mutation of sdz-24 did not affect the longevity.

https://doi.org/10.1371/journal.ppat.1006152.s008

(DOC)

S9 Fig. Effect of intestinal RNAi knockdown of skn-1 on transcriptional expression of sdz-24 after P. aeruginosa PA14 infection.

https://doi.org/10.1371/journal.ppat.1006152.s009

(DOC)

S1 Table. Primers used for quantitative real-time polymerase chain reaction (PCR).

https://doi.org/10.1371/journal.ppat.1006152.s010

(DOC)

S2 Table. Primers for DNA construct generation.

https://doi.org/10.1371/journal.ppat.1006152.s011

(DOC)

Author Contributions

  1. Conceived and designed the experiments: DaW.
  2. Performed the experiments: LZ YY XL.
  3. Analyzed the data: LZ YY.
  4. Contributed reagents/materials/analysis tools: DaoW.
  5. Wrote the paper: DaW.

References

  1. 1. Sifri CD, Begun J, Ausubel FM. The worm has turned-microbial virulence modeled in Caenorhabditis elegans. Trends Microbiol. 2005; 13: 119–127. pmid:15737730
  2. 2. Yu Y-L, Zhi L-T, Guan X-M, Wang D-Y, Wang D-Y. FLP-4 neuropeptide and its receptor in a neuronal circuit regulate preference choice through functions of ASH-2 trithorax complex in Caenorhabditis elegans. Sci Rep. 2016; 6: 21485. pmid:26887501
  3. 3. Irazoqui JE, Urbach JM, Ausubel FM. Evolution of host innate defense: insights from C. elegans and primitive invertebrates. Nat Rev Immunol. 2010; 10: 47–58. pmid:20029447
  4. 4. Kurz CL, Ewbank JJ. Caenorabditis elegans: an emerging genetic model for the study of innate immunity. Nat Rev Genet. 2003; 4: 380–390. pmid:12728280
  5. 5. Kim DH, Feinbaum R, Alloing G, Emerson EF, Garsin DA, et al. A conserved p38 MAP kinase pathway in Caenorhabditis elegans innate immunity. Science. 2002; 297: 623–626. pmid:12142542
  6. 6. Evans EA, Kawli T, Tan M. Pseudomonas aeruginosa suppresses host immunity by activating the DAF-2 insulin-like signaling pathway in Caenorhabditis elegans. PLoS Pathog. 2008; 4: e1000175. pmid:18927620
  7. 7. Roberts AF, Gumienny TL, Gleason RJ, Wang H, Padgett RW. Regulation of genes affecting body size and innate immunity by the DBL-1/MBP-like pathway in Caenorhabditis elegans. BMC Dev Biol. 2010; 10: 61. pmid:20529267
  8. 8. Partridge FA, Gravato-Nobre MJ, Hodgkin J. Signal transduction pathways that function in both development and innate immunity. Dev Dyn. 2010; 239: 1330–1336. pmid:20131356
  9. 9. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004; 116: 281–297. pmid:14744438
  10. 10. Guo H, Ingolia NT, Weissman JS, Bartel DP. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature. 2011; 466: 835–840.
  11. 11. Lee RC, Ambros V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 2001; 294: 862–864. pmid:11679672
  12. 12. Umbach JL, Cullen BR. The role of RNAi and microRNAs in animal virus replication and antiviral immunity. Genes Dev. 2009; 23:1151–1164. pmid:19451215
  13. 13. Yarbrough ML, Zhang K, Sakthivel R, Forst CV, Posner BA, et al. Primate-specific miR-576-3p sets host defense signaling threshold. Nat Commun. 2015; 5: 4963.
  14. 14. Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, et al. The microRNAs of Caenorhabditis elegans. Genes Dev. 2003; 17: 991–1008. pmid:12672692
  15. 15. Liu F, He C, Luo L, Zou Y, Zhao Y, et al. Nuclear hormone receptor regulation of microRNAs controls innate immune responses in C. elegans. PLoS Pathog. 2013; 9: e1003545. pmid:23990780
  16. 16. Dai L, Gao J, Zou C, Ma Y, Zhang K. mir-233 modulates the unfolded protein response in C. elegans during Pseudomonas aeruginosa infection. PLoS Pathog. 2015; 11: e1004606. pmid:25569229
  17. 17. Sun L-M, Zhi L-T, Shakoor S, Liao K, Wang D-Y. microRNAs involved in the control of innate immunity in Candida infected Caenorhabditis elegans. Sci Rep. 2016; 6: 36036. pmid:27796366
  18. 18. Sokol NS. Small temporal RNAs in animal development. Curr Opin Genet Dev. 2012; 22: 368–373. pmid:22578317
  19. 19. Reinhart B, Slack F, Basson M, Pasquinelli AE, Bettinger JC, et al. The 21 nucleotide let-7 RNA regulates C. elegans developmental timing. Nature. 2000; 403: 901–906.
  20. 20. Ren Z, Ambros VR. Caenorhabditis elegans microRNAs of the let-7 family act in innate immune response circuits and confer robust developmental timing against pathogen stress. Proc Natl Acad Sci USA. 2015; 112: E2366–E2375. pmid:25897023
  21. 21. Robertson SM, Shetty P, Lin R. Identification of lineage-specific zygotic transcripts in early Caenorhabditis elegans embryos. Dev Biol. 2004; 276: 493–507. pmid:15581881
  22. 22. Papp D, Csermely P, Soti C. A role for SKN-1/Nrf in pathogen resistance and immunosenescence in Caenorhabditis elegans. PLoS Pathog. 2012; 8: e1002673. pmid:22577361
  23. 23. Martinez NJ, Ow MC, Reece-Hoyes JS, Barrasa MI, Ambros VR, et al. Genome-scale spatiotemporal analysis of Caenorhabditis elegans microRNA promoter activity. Genome Res. 2008; 18: 2005–2015. pmid:18981266
  24. 24. Alper S, McBride SJ, Lackford B, Freedman JH, Schwartz DA. Specificity and complexity of the Caenorhabditis elegans innate immune response. Mol Cell Biol. 2007; 27: 5544–5553. pmid:17526726
  25. 25. Troemel ER, Chu SW, Reinke V, Lee SS, Ausubel FM, et al. p38 MAPK regulates expression of immune response genes and contributes to longevity in C. elegans. PLoS Genet. 2006; 2: e183. pmid:17096597
  26. 26. Dickinson DJ, Ward JD, Reiner DJ, Goldstein B. Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nat. Methods. 2013; 10: 1028–1034. pmid:23995389
  27. 27. Bolz DD, Tenor JL, Aballay A. A conserved PMK-1/p38 MAPK is required in Caenorhabditis elegans tissue-specific immune response to Yersinia pestis infection. J Biol Chem. 2010; 285: 10832–10840. pmid:20133945
  28. 28. Mello JA, Ruvkun G. Inactivation of conserved genes induces microbial aversion, drug detoxification, and innate immunity in C. elegans. Cell. 2012; 149: 452–466.
  29. 29. Bolz DD, Tenor JL, Aballay A. A conserved PMK-1/p38 MAPK is required in Caenorhabditis elegans tissue-specific immune response to Yersinia pestis infection. J Biol Chem. 2010; 285: 10832–10840. pmid:20133945
  30. 30. Block DHS, Twumasi-Boateng K, Kang HS, Carlisle JA, Hanganu A, et al. The developmental intestinal regulator ELT-2 controls p38-dependent immune responses in adult C. elegans. PLoS Genet. 2015; 11: e1005265. pmid:26016853
  31. 31. Tullet JM, Hertweck M, An JH, Baker J, Hwang JY, et al. Direct inhibition of the longevity-promoting factor SKN-1 by insulin-like signaling in C. elegans. Cell. 2008; 132: 1025–1038. pmid:18358814
  32. 32. Couillault C, Fourquet P, Pophillat M, Ewbank JJ. A UPR-independent infection-specific role for a BiP/GRP78 protein in the control of antimicrobial peptide expression in C. elegans epidermis. Virulence. 2012; 3: 299–308. pmid:22546897
  33. 33. Cheesman HK, Feinbaum RL, Thekkiniath J, Dowen RH, Conery AL, Pukkila-Worley R. Aberrant activation of p38 MAP kinase-dependent innate immune response is toxic to Caenorhabditis elegans. G3. 2016; 6: 541–549. pmid:26818074
  34. 34. Ceron J, Rual J, Chandra A, Dupuy D, Vidal M, et al. Large-scale RNAi screens identify novel genes that interact with the C. elegans retinoblastoma pathway as well as splicing-related components with synMuv B activity. BMC Dev Biol. 2007; 7: 30. pmid:17417969
  35. 35. Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974; 77: 71–94. pmid:4366476
  36. 36. Donkin S, Williams PL. Influence of developmental stage, salts and food presence on various end points using Caenorhabditis elegans for aquatic toxicity testing. Environ Toxicol Chem. 1995; 14: 2139–2147.
  37. 37. Wu Q-L, Gao X-O, Yan D, Wang D-Y, Aballay A. Genetic screen reveals link between maternal-effect sterile gene mes-1 and P. aeruginosa-induced neurodegeneration in C. elegans. J Biol Chem. 2015; 290: 29231–29239. pmid:26475858
  38. 38. Wang D-Y, Cao M, Dinh J, Dong Y-Q. Methods for creating mutations in C. elegans that extend lifespan. Methods Mol Biol. 2013; 1048: 65–75. pmid:23929098
  39. 39. Yu Y-L, Zhi L-T, Wu Q-L, Jing L-N, Wang D-Y. NPR-9 regulates innate immune response in Caenorhabditis elegans by antagonizing activity of AIB interneurons. Cell Mol Immunol. 2016;
  40. 40. Zhao Y-L, Wu Q-L, Wang D-Y. An epigenetic signal encoded protection mechanism is activated by graphene oxide to inhibit its induced reproductive toxicity in Caenorhabditis elegans. Biomaterials. 2016; 79: 15–24. pmid:26686978
  41. 41. Mello C, Fire A. DNA transformation. Methods Cell Biol. 1995; 48: 451–482. pmid:8531738
  42. 42. Kamath RK, Martinez-Campos M, Zipperlen P, Fraser AG, Ahringer J. Effectiveness of specific RNA-mediated interference through ingested double stranded RNA in C. elegans. Genome Biol. 2001; 2: 1–10.
  43. 43. Zhao Y-L, Zhi L-T, Wu Q-L, Yu Y-L, Sun Q-Q, et al. p38 MAPK-SKN-1/Nrf signaling cascade is required for intestinal barrier against graphene oxide toxicity in Caenorhabditis elegans. Nanotoxicology. 2016; 10: 1469–1479. pmid:27615004