  • Loading metrics

Wolbachia Blocks Viral Genome Replication Early in Infection without a Transcriptional Response by the Endosymbiont or Host Small RNA Pathways


9 May 2016: The PLOS Pathogens Staff (2016) Correction: Wolbachia Blocks Viral Genome Replication Early in Infection without a Transcriptional Response by the Endosymbiont or Host Small RNA Pathways. PLOS Pathogens 12(5): e1005639. View correction


The intracellular endosymbiotic bacterium Wolbachia can protect insects against viral infection, and is being introduced into mosquito populations in the wild to block the transmission of arboviruses that infect humans and are a major public health concern. To investigate the mechanisms underlying this antiviral protection, we have developed a new model system combining Wolbachia-infected Drosophila melanogaster cell culture with the model mosquito-borne Semliki Forest virus (SFV; Togaviridae, Alphavirus). Wolbachia provides strong antiviral protection rapidly after infection, suggesting that an early stage post-infection is being blocked. Wolbachia does appear to have major effects on events distinct from entry, assembly or exit as it inhibits the replication of an SFV replicon transfected into the cells. Furthermore, it causes a far greater reduction in the expression of proteins from the 3´ open reading frame than the 5´ non-structural protein open reading frame, indicating that it is blocking the replication of viral RNA. Further to this separation of the replicase proteins and viral RNA in transreplication assays shows that uncoupling of viral RNA and replicase proteins does not overcome Wolbachia’s antiviral activity. This further suggests that replicative processes are disrupted, such as translation or replication, by Wolbachia infection. This may occur by Wolbachia mounting an active antiviral response, but the virus did not cause any transcriptional response by the bacterium, suggesting that this is not the case. Host microRNAs (miRNAs) have been implicated in protection, but again we found that host cell miRNA expression was unaffected by the bacterium and neither do our findings suggest any involvement of the antiviral siRNA pathway. We conclude that Wolbachia may directly interfere with early events in virus replication such as translation of incoming viral RNA or RNA transcription, and this likely involves an intrinsic (as opposed to an induced) mechanism.

Author Summary

The intracellular endosymbiotic bacterium Wolbachia can protect insects against viral infection. However, the mechanisms underlying this antiviral activity are poorly understood. We have developed a new model system combining Wolbachia-infected Drosophila melanogaster cell culture and the model mosquito-borne virus, Semliki Forest virus. Wolbachia confers strong antiviral activity against SFV. Our study indicates that viral replication appears to be inhibited at a very early stage, such as initial translation or replication. Results indicate that Wolbachia does not mount a transcriptional response to SFV infection and that host small RNA pathways are not involved in Wolbachia mediated antiviral activity in our system. We conclude that Wolbachia may directly interfere with early events in virus replication such as translation of incoming viral RNA or RNA transcription, and this likely involves an intrinsic (as opposed to an induced) mechanism.


Arthropod-borne viruses (arboviruses) pose a considerable threat to human and animal health, yet effective control measures have proven difficult to implement [1, 2]. In recent years novel means of reducing their replication in arthropod vectors have been suggested as an alternative way to reduce the prevalence of these viruses. One of the most exciting approaches is the use of the endosymbiotic intracellular bacterium Wolbachia to control arbovirus transmission from mosquito to vertebrate from within the arthropod vector [3, 4]. Wolbachia was first found to confer resistance to viruses in Drosophila melanogaster [5, 6]. When it was transferred to the mosquito Aedes aegypti it made the mosquitoes resistant to two important human pathogenic arboviruses, dengue virus (DENV) and chikungunya virus (CHIKV) [7, 8]. Importantly, Wolbachia can also invade and be stably maintained in natural populations thanks to a trait called cytoplasmic incompatibility, which causes embryos to die when uninfected females mate with infected males [9]. This allows Wolbachia to spread through mosquito populations by providing a reproductive advantage to the Wolbachia-infected females that transmit the bacterium [10]. Field trials have shown that releasing Wolbachia-infected mosquitoes allows the bacterium to invade Ae. aegypti populations [11, 12] and reduces the susceptibility of the mosquitoes to DENV [13].

The mechanism(s) by which Wolbachia confers broad resistance remains unclear. Antiviral protection is seen in insects that harbour high densities of Wolbachia [14, 15]. For example Martinez et al (2014) showed a clear correspondence between Wolbachia density and the level of protection against the insect viruses, Drosophila C virus (DCV) and Flock House virus (FHV) [16]. This phenomenon is also seen in the mosquito Ae. albopictus, where the endogenous Wolbachia strains wAlbA and wAlbB have a relatively low density especially in key tissues such as the midgut and offer little protection against DENV [17, 18]. It has also been hypothesised that Wolbachia protection is dependent on target cells and tissues harbouring Wolbachia [8, 14, 17]. Indeed, there is little evidence of Wolbachia and virus being present together in the same cell when either is present in a high density, suggesting that antiviral protection is cell autonomous [8, 19]. It may be a case of competition for space or cellular resources [8]. Viruses and Wolbachia depend on host lipids, and in D. melanogaster it has been shown that enriching dietary cholesterol reduced the extent to which Wolbachia protects against DCV [20]. It has also been suggested that there is competition for iron resources within cells, as Wolbachia upregulates transferrin in mosquitoes while DENV and CHIKV are thought to cause its downregulation [21, 22].

Viral replication is controlled by innate immune responses in both D. melanogaster and mosquitoes and several experiments suggested that the upregulation of immune pathways—immune-priming—may be important for Wolbachia-mediated antiviral activity [17, 23, 24]. However, this appears to only be the case in mosquito populations that have been transinfected with Wolbachia strains [21, 24]. Drosophila species that are naturally infected with Wolbachia do not show an immune-priming phenotype, yet still confer antiviral activity [6, 15, 21, 25]. RNAi is considered the most important antiviral response in insects, with double stranded viral RNA (dsRNA) being processed into short RNAs by the small interfering RNA (siRNA) pathway and directing the destruction of viral RNA [26, 27]. However, several studies have shown that Wolbachia provides protection in mutant Drosophila and cells that lack components of this pathway, ruling out a role for the siRNA pathway in Wolbachia-mediated protection [19, 28, 29]. There is however data that suggest the miRNA pathway may play a role in Wolbachia mediated protection [3032]. Wolbachia has been shown to alter the expression of multiple miRNAs in mosquitoes [31]. The miRNA pathway is involved in many cellular processes, and miRNAs are produced from genome-encoded nuclear precursor RNAs that are processed into 22 nucleotide (nt) molecules that can induce target RNA degradation or inhibition of translation [26, 33].

In summary, the mechanism(s) by which Wolbachia confers antiviral activity are still unclear, and very little is known about exactly how the viral replication cycle is affected. Furthermore, it is not clear if Wolbachia itself responds to viral infection. In order to address these questions and to understand how Wolbachia interacts with viruses we have combined two powerful and well-studied model systems–the mosquito-borne alphavirus Semliki Forest virus (SFV; Togaviridae, genus Alphavirus) and a Wolbachia-containing D. melanogaster cell line [34]–and show that the endosymbiont provides strong protection against infection in this system. To identify the stage of the viral replication cycle that is likely being affected we compared SFV, SFV replicon and a SFV-based transreplicase system. We then used high-throughput sequencing to unravel the role of host small RNA pathways and the Wolbachia transcriptional response in antiviral protection. We find that Wolbachia targets the virus rapidly after infection, and is likely blocking early events in the replication of viral RNA (for example translation of incoming RNA, the switch from translation to replication or RNA transcription) within cells, though we cannot rule out an effect on entry or exit. These effects are neither associated with a host small RNA response nor a transcriptional response by the endosymbiont, but mediated by intrinsic activities.


Wolbachia has no effect on cell growth but significantly decreases SFV replication in D. melanogaster Jw18 cells

We developed a model arbovirus infection system based on SFV, for which excellent molecular tools including replicons and recombinant viruses are available and which we have used extensively to study arbovirus-arthropod interactions [3537], and the D. melanogaster-derived Jw18 cell line infected with the Wolbachia strain wMel [34].

As SFV does not naturally infect D. melanogaster, we first established if this virus is able to infect and replicate in Jw18 cells. We used SFV4(3H)-RLuc, which expresses Renilla luciferase, RLuc, from the non-structural open reading frame (Fig 1A) and has been used previously to study antiviral mechanisms in mosquito cells [36, 37].

Fig 1. Virus, replicon and transreplicase systems used in this study.

(A) Schematic representation of genome of SFV4(3H)-RLuc, carrying the RLuc reporter gene flanked by duplicated nsP2-protease cleavage sites at the nsP3/4 junction. Note that the genome is split into two major ORFs, 1 and 2, encoding non-structural and structural proteins respectively. (B) Schematic representation of the genome of viral replicon pSFV1(3F)RLuc-SG-FFLuc, where RLuc is fused to the region encoding for nsP3 and the structural genes have been replaced by the reporter gene firefly luciferase (FFLuc). Expression of FFLuc occurs only from subgenomic RNA produced from the subgenomic promoter; hence detection of this marker is dependent on the active replication of transfected RNA. (C-D) Schematic representation of the SFV-derived transreplicase constructs used in this study. Expression of the replicase proteins is under the control of the Drosophila Actin promoter (C). Expression of SFV template RNA is also under the control of the Actin promoter (D). When the replicase proteins are expressed this leads to active replication of the template RNA. FFLuc expression is therefore under both the control of the Actin promoter and the SFV genomic promoter. Whereas Gluc is exclusively under the control of the subgenomic promoter and therefore requires active replication of the template RNA in order for expression to occur. Two replicase constructs were used in this study: one functional, and one non-functional due to the insertion of a GDD-GAA mutation in nsP4 as indicated in (C).

The cells were first antibiotic treated to generate a Wolbachia-free control cell line, which we refer to as Jw18Free cells. These were infected at a multiplicity of infection (MOI) of 20 and cells were lysed 4, 8, 12 and 24 hours post infection (hpi) and RLuc activity measured. Over a 24 hour period RLuc activity gradually increased, indicating that SFV4(3H)-RLuc can infect and replicate in Jw18Free cells (Fig 2A). In order to rule out any effect of Wolbachia or SFV on cell growth we next compared the growth of cells Jw18Free and Jw18Wol cells either infected or not infected with SFV4(3H)-RLuc. There was no significant difference between any of the treatments observed, indicating that neither Wolbachia nor SFV4(3H)-RLuc infection affected cell growth (Fig 2B). It is important to note that SFV does not cause cytopathic effects in insect cells and therefore cells are able to continue to grow even under high infection rates.

Fig 2. Analysis of cell growth and infection dynamics of Jw18Wol and Jw18Free cells infected with SFV.

(A) Jw18Free cells were infected with SFV(3H)-RLuc at an MOI of 20. Cells were lysed 4, 8, 12 and 24 hpi and RLuc activity determined. The figure represents data from three independent experiments, where each treatment was carried out in triplicate. (B) The density of Jw18Wol and Jw18Free cells 7 and 24 hpi with SFV(3H)-RLuc at an MOI of 20; 0 (seed) is 24 h prior to infection. Data represents three independent experiments carried out in duplicate. (C) Jw18Wol and Jw18Free cells were infected at an MOI of 20 with SFV4(3H)-RLuc and RLuc activity was measured at 7 and 24 hpi. The graph indicates the mean ratio of RLuc activity in Jw18Wol and Jw18Free cells, where Jw18Wol at 7hpi and 24 hpi is equal to one. The data represents five independent experiments carried out in duplicate. Error bars represent the standard error of mean in all figures. Stars indicate significance P = <0.05 in T-Test analysis.

To determine if Wolbachia could protect against SFV infection in Jw18 cells, we infected Jw18Wol and Jw18Free cells with SFV4(3H)-RLuc (infectivity >90%) and measured RLuc activity at 7 and 24 hpi as a proxy for viral replication and spread [38]. Results indicated that even as early as 7 hpi inhibition of virus by Wolbachia is observed, with a 2–3 fold increase in RLuc activity in Jw18Free cells compared to Jw18Wol cells. By 24 hpi this difference is more marked with an 8–12 fold increase in RLuc activity in the Jw18Free cells (Fig 2C). Therefore, Wolbachia confers antiviral protection against an arbovirus in this system. Furthermore the mechanism by which Wolbachia inhibits viral infection must be rapid suggesting either entry of the virus is inhibited or replication/translation are inhibited.

Suppression of reporter gene expression mediated by activity of the viral subgenomic promoter suggests Wolbachia inhibits early replication events

As Wolbachia inhibits viral infection or subsequent processes as early as 7 hpi it could be hypothesised that entry of the virus into cells is inhibited, leading to a significant reduction in the number of subsequent replication complexes. In order to test this hypothesis we bypassed viral entry and analysed early translation and replication by transfection of in vitro transcribed capped SFV1(3F)RLuc-SG-FFLuc replicon RNA (Fig 1B). In this SFV-derived replicon RNA, an open reading frame (ORF1) encoding RLuc is fused to the non-structural nsP3 and the second, structural ORF(2) has been deleted and replaced with the FFLuc ORF (see Materials and Methods). Alphavirus gene expression occurs in separate phases which are linked to replicative processes. Initially ORF1 is translated from the RNA genome giving rise to the nsP proteins, which carry out replicative functions. Then a switch from translation to replication occurs leading to production of a full length antisense copy of the genome, the antigenome. Antisense RNA (which most likely exists in a duplex with the original positive-strand genome) is used as a template for synthesis of new genomes; in addition it carries an internal promoter sequence that directs transcription of a subgenomic mRNA encoding the structural proteins (Fig 1) [39]. Thus, expression of structural proteins (or FFLuc marker, Fig 1B) takes place only from these subgenomic RNAs i.e. is fully dependent on the replication process. In contrast, RLuc can be produced both by directly translating the replicon that was transfected into the cells as well as by translating new full-length positive strands, generated during RNA replication. Furthermore, in the absence of structural proteins no new virus particles can be formed preventing the spread of infection. It was found that Wolbachia results in a significant inhibition of early translation and/or replication independent of normal viral entry, with both RLuc and FFLuc readouts being significantly lower in Jw18Wol cells compared to Jw18Free cells (Fig 3A and 3B). We cannot rule out that Wolbachia may also have an effect on entry which we do not observe in these assays.

Fig 3. The effect of Wolbachia on SFV replicon and transreplicase activity.

(A, B) Jw18Wol and Jw18Free cells were transfected with in vitro transcribed SFV1(3F)RLuc-SG-FFLuc RNA, and both RLuc (A) and FFLuc (B) activity was measured 24 h post transfection (hpt). Graphs indicate mean fold change of measurements of luciferase activity where activity in Jw18Wol cells is taken as 1 and represent three independent experiments carried out in triplicate. RLuc activity represents translation of genome RNAs whereas FFLuc indicates translation of the subgenomic mRNA. Error bars represent standard error of mean. Stars indicate significance where P = <0.05 in T-Test analysis. (C, D) Jw18Wol and Jw18Free cells were transfected with two plasmids: one expressing SFV replicase proteins (wt or mutant, under the control of the D. melanogaster Actin promoter) and one expressing viral template and both FFluc (C) and Gluc (D) activity were measured 24 hpt. FFLuc activity represents translation of RNA produced from the Actin promoter (and to some extent the genomic promoter) and Gluc activity represents translation of RNA produced from the subgenomic promoter following replication. Graphs represent relative luciferase activity and represent three independent experiments carried out in duplicate. Stars indicate significance where P = <0.01 in T-Test analysis.

As this SFV-derived replicon allows for the separate analysis of transcription and translation from both the genomic and subgenomic promoters and corresponding mRNAs, it allows us to further pinpoint the stage in the replication cycle that is affected by Wolbachia. In the Wolbachia infected cells we observed a 200–600 fold decrease in FFLuc readout, a marker expressed from the RNA produced from subgenomic promoter, which is significantly greater (T-Test P <0.0001) than the ~ 8 fold decrease in RLuc readout, a marker produced both from transfected RNAs and full-length positive-strand transcripts from the genomic promoter. This would suggest a clear and early inhibition of establishment of RNA replication. Alternatively, it could indicate a specific defect in the production of the subgenomic mRNA. This could occur either by Wolbachia directly interfering with replication, or by preventing the translation of proteins required for replication to occur and/or inhibiting the switch from replicase protein translation to RNA replication. Overall the results indicate that early viral RNA translation and/or replication were likely to be inhibited by Wolbachia.

To further investigate the effect of Wolbachia on viral translation and/or replication we uncoupled viral replicase proteins from viral RNA by the introduction of two plasmids into cells in a SFV transreplicase assay. In this system, one plasmid encodes the viral replicase proteins and the second encodes an RNA template containing the untranslated regions of SFV with either FFLuc downstream of the genomic/actin promoter or Gluc downstream of the subgenomic promoter. In both cases the expressed sequences are under the control of a Drosophila Actin promoter. Upon expression the replicase proteins will bind the RNA template and replication of the reporter construct will take place. Expression of FFLuc is under both the control of the Actin promoter and the genomic promoter, therefore due to the high expression from the Actin promoter it is difficult to determine active replication from the genomic reporter. However active replication can be measured from the production of the Gluc reporter which is solely under the control of the subgenomic promoter. This system therefore allowed us to determine if production of replicase proteins from mRNA transcribed in the nucleus could overcome Wolbachia-mediated protection and determine if the origin of viral RNA is also important. In order to rule out arbitrary effects we also generated a non-replicating replicase with the introduction of a GDD-GAA mutation in the nsP4 protein, thus producing an inactive replicase. Results are shown in Fig 3C and 3D. Activity from the Actin and SFV genomic promoters appeared to be unaffected by the presence of Wolbachia, however it should be noted that there is no significant difference between the wildtype and mutant (GAA) replicase or cells where no replicase-expressing plasmid had been transfected. This confirms that the activity we saw here was most likely due to transcription from the Actin promoter and we are unlikely to detect expression from the genomic promoter as the system is at an optimum (Fig 3C). This has also been observed in mammalian systems [40]. As shown in Fig 3D, we observed that Wolbachia significantly lowered activity from the subgenomic promoter as Gluc activity is lower in Jw18Wol cells compared to Jw18Free. This is in keeping with our previous observation that Wolbachia is able to inhibit viral translation and/or replication. Once viral RNA template is produced from the nucleus and transported to the cytoplasm, replication complexes are thought to form as normal. Thus Wolbachia was still able to confer protection even when viral replicase/RNA delivery routes were changed. Taken together this data strongly indicated that Wolbachia inhibits viral translation and/or replication.

Virus-derived siRNA profiles support an inhibitory effect of Wolbachia on viral replicative processes

A major immune pathway in insects to fight viral infections is the exogenous siRNA pathway which involves the production of virus-derived small interfering RNAs (viRNAs) by the enzyme Dicer-2 acting on virus-derived dsRNA (such as viral replication intermediates) as a substrate [26, 27, 41]. The hallmark of this pathway in insects is the production of 21 nucleotide (nt) viRNAs, a process that has been described in detail for alphavirus infection of mosquitoes and mosquito cells [36, 37, 42]. To test whether the levels of viRNAs were affected by Wolbachia we used high-throughput sequencing of 18-33nt small RNAs from Jw18 cells 24hpi with SFV4(3H)-RLuc. In Jw18Free cells, small RNAs that were 21 nt long and map to the SFV genome were strongly induced upon viral infection (Wilcoxon unpaired test: P = 0.008, Fig 4A, S1A Fig for uninfected controls). 21 nt RNAs mapped equally in both sense and antisense orientations to the viral genome (Fig 4A; P > 0.1 Chi-squared test against a uniform distribution). The length and lack of strand bias or first nucleotide bias (Fig 4A) suggest that these small RNAs are generated by the activity of Dicer-2 on virus-derived dsRNA, probably replication intermediates; moreover 21 nt viRNAs were distributed across the viral genome as previously reported for SFV (Fig 5A) [37, 43] and also other arboviruses [26, 27]. Indeed there was no nucleotide bias seen at any position either in the Jw18Free or Jw18Wol cells (S2A and S2B Fig).

Fig 4. The effect of Wolbachia on the production of virus-derived small interfering RNAs in Jw18 cells.

(A-B) The length and first nucleotide distribution of small RNAs mapping to genome (upper bars, 5′-3′ orientation) or antigenome (lower bars, 3’-5’ orientation) of the SFV genome in the (A) absence (Jw18Free) or (B) (Jw18Wol) presence of Wolbachia. A = red, C = green, G = blue and T = pink. Data are from 24 hpi with SFV4(3H)-RLuc, of Jw18 D. melanogaster cells. Concatenated data from 5 independent infections are shown in all panels.

Fig 5. The effect of Wolbachia on the distrubution of virus-derived 21nt interfering RNAs in Jw18 cells.

Distribution of 21 nt long viRNAs along sense (upper bars, black; 5’-3’ orientation) or antisense (lower bars, red; 3′-5′ orientation) strands of the SFV genome in the absence (A) (Jw18Free) or presence (B) (Jw18Wol) of Wolbachia. A zoomed in version of (B) is shown in (C) for ease of comparison. Data are from 24 hpi with SFV4(3H)-RLuc, of Jw18 D. melanogaster cells. Concatenated data from 5 independent infections are shown in all panels.

If Wolbachia infection were to reduce viral infection by upregulating antiviral RNAi we would expect increased viRNA production in the presence of Wolbachia. However, whilst 21 nt viRNAs were still present above the background seen in virus-free controls (P = 0.008, Wilcoxon unpaired test; Fig 4B and S1B Fig), the amount of viRNAs was strongly reduced on both sense and antisense orientations relative to Wolbachia-free cells (P = 0.008, Wilcoxon unpaired test; Fig 4A versus 4B). Due to a significant reduction in viral replication, the distribution of 21 nt viRNAs from Jw18Wol cells revealed very few areas of viRNA production (Fig 5B and 5C). RNAs smaller than 21 nt were similar between Jw18Wol and Jw18Free cells in infected cells (Fig 4A and 4B), however it is likely that these smaller species of RNAs are background against the D. melanogaster genome or degradation products.

This confirmed that Wolbachia does not protect against infection by enhancing the production of small RNAs against viruses. Instead, these results are consistent with a model whereby Wolbachia interferes with viral replication, leading to a decrease in the levels of viral replication intermediates and therefore a reduction in dsRNA, the substrate available for Dicer-2 and exogenous siRNA pathway induction. This is not surprising as previous studies have shown that Wolbachia can still confer antiviral activity in flies mutant for key components of the siRNA pathway [29].

Wolbachia does not alter the expression of miRNAs

Previous studies suggested that Wolbachia affects the sensitivity of mosquito cells to viral infection by altering host miRNAs levels [31, 32]. Therefore, we tested whether Wolbachia alters the expression of known miRNAs in Jw18 cells. In the absence of virus, no miRNAs had significantly different expression levels in Jw18Wol and Jw18Free cells (Fig 6 and S3A Fig). It is likely therefore that any differences are not important to Wolbachia mediated protection as in our system there are no significantly altered miRNAs between non-infected Jw18Free and Jw18Wol cells.

Fig 6. The effect of Wolbachia on D. melanogaster miRNA expression in the presence or absence of virus.

Heatmap showing the effects of Wolbachia and SFV4(3H)-RLuc virus on miRNA abundance. The mean of the No Virus-No Wolbachia treatment is set to zero. Only miRNAs that are significantly (Adjusted p value<0.1, Negative Binomial Test) differentially expressed in at least one treatment are shown. Jw18Wol replicate WV 3 was included in analysis; although it appeared to be an outlier as its inclusion did not alter the significance of the data. T = Jw18Free, W = Jw18Wol, V = SFV infection, O = no SFV infection and numbers represent replicate.

We next examined whether Wolbachia alters the miRNA response to viral infection. We identified a number of miRNAs that significantly changed in abundance when Jw18Free cells were infected with SFV (Figs 6 and S3D; S1 Table). Very similar changes in miRNA expression were seen when cells with Wolbachia were infected with virus (Fig 6 and S3B Fig, S1 Table). However, when cells were infected with SFV there were no miRNAs whose abundance was significantly changed by the presence of Wolbachia (Fig 6 and S3C Fig). Therefore in D. melanogaster cells there is no evidence that Wolbachia modulates the constitutive expression of miRNAs or the miRNA-mediated response to infection. The similar miRNA response to virus in cells with and without Wolbachia is intriguing as Wolbachia-infected cells have greatly reduced levels of virus, and suggests it may reflect a sensitive response to initial infection by the virus.

Absence of a transcriptional response of Wolbachia to viral infection

To investigate whether Wolbachia itself might mount an active antiviral response after infection, we tested if there is a transcriptional response of Wolbachia to viral infection. We sequenced total RNA from Jw18Wol cells 7 and 24 hpi with SFV4(3H)-RLuc virus together with uninfected controls. Over 229 million reads could be mapped to the D. melanogaster, Wolbachia or SFV transcriptomes (excluding D. melanogaster rRNA). Of these 85.6% mapped to D. melanogaster and 12.4% mapped to Wolbachia. In the virus-infected cells, 3.8% of reads mapped to the SFV genome, and this dropped to 0.03% for cells that were not challenged with the virus. No Wolbachia genes were differentially expressed in response to viral infection at either time point (Fig 7B and 7C). There are three reasons to believe that this is a true lack of a transcriptional response and not simply a lack of statistical power. First, across many transcripts we were able to detect a transcriptional response of the cells to SFV in the same experiment (Fig 7D and 7E), and the coverage of many of these differentially expressed transcripts was lower than for many Wolbachia transcripts (Fig 7B–7E). Second, we had a very large dataset. In each of the 4 treatments about two thirds of the Wolbachia transcripts had over 100 reads mapped to them (Fig 7A), which is expected to give good power to detect differential expression. Compared to most published RNAseq experiments ours was a highly replicated experiment involving 40 libraries (biological replicates) across 4 lanes of Illumina HiSeq. Third, if genes with very low-expression are ignored, our estimates of Wolbachia gene expression levels in cells with and without SFV were nearly identical (Fig 7B and 7C, log2FC≈0). Therefore, the lack of differential expression cannot be attributed to a lack of statistical power.

Fig 7. Analysis of changes in Wolbachia and D. melanogaster gene expression upon viral infection.

Jw18Wol cells infected with SFV4(3H)-RLuc were analyzed. (A) Sequence coverage of Wolbachia genes. Genes are arranged from lowest to highest coverage on the X axis. In the legend + refers to the presence of SFV. (B-C) The response to infection (log2 fold expression change) for each Wolbachia gene is shown against expression level (average log2 count per million [CPM]) at (B) 7 h and (C) 24 h after infection. (D-E) The response to infection of D. melanogaster genes. Genes that significantly change in expression at 10% false discovery rate (FDR) are shown in red (there were no significant induction/repression for Wolbachia genes).


The bacterial symbiont Wolbachia offers an exciting opportunity in the fight against arbovirus transmission by mosquitoes. Several studies have found that it has antiviral activity in key arbovirus mosquito vectors [8, 28, 44, 45]. However, the exact mechanisms behind this activity are poorly understood. In order for Wolbachia to be used as a long term and sustainable system to control arbovirus spread, it is critical that we understand these mechanisms. By combining two powerful model systems–the model arbovirus SFV, and a Wolbachia-infected D. melanogaster cell line–we were able to show that Wolbachia may protect against virus at a very early stage of infection and appeared to block replication and/or translation of viral RNA. This did not involve an active transcriptional response from either the host, the small RNA pathways or Wolbachia itself.

Little is known about how Wolbachia affects viral replication and dynamics, with studies measuring changes in either the survival of infected insects or viral copy number [5, 6, 1719]. To investigate the phenomenon in more depth we used the alphavirus SFV, for which virus-encoded reporter genes are known to correspond well to viral replication [38]. We found that Wolbachia is able to inhibit viral replication as early as 7 hpi. To our knowledge this is the first indication that Wolbachia inhibits viral replication at such an early stage (for example by inhibition of initial translation of incoming RNA or other early replicative processes), as previous studies have focused mainly on days post-infection [5, 17, 19, 46]. This suggests that the mechanism by which Wolbachia is conferring antiviral activity is either fast acting or is already present upon viral infection i.e. intrinsic. This is important as for Wolbachia to be used successfully as a control mechanism for arbovirus transmission, control of viral replicative processes at an early stage could be vital, as it would not allow the virus to replicate to high levels allowing for dissemination.

The SFV life cycle can be divided into entry, initial translation of incoming viral genomes, switch from translation to replication, RNA replication, translation of structural proteins from subgenomic RNA, assembly and exit from cells. Understanding where in this lifecycle Wolbachia acts is vital to understanding the mechanisms behind its antiviral activity. This can often prove difficult to investigate as little is understood about SFV (and arbovirus) replication in insect cells compared to vertebrate cells. By utilising SFV reporter viruses and replicon constructs we can begin to deconstruct the replication cycle. The very early stage at which SFV was inhibited and the fact that bypassing viral entry still resulted in viral inhibition by Wolbachia suggests that Wolbachia is likely blocking an early post-entry stage in the replication cycle. We can further dissect how Wolbachia affects the replication cycle due to the presence of a sub-genomic promoter in alphaviruses [39, 47]. Expression from the first ORF of SFV does not require viral replication (though due to an increase of genomic RNA copy number, it is dramatically increased when replication occurs), as positive-sense RNA virus genomes can act as mRNA immediately after infection. In contrast translation and protein expression from the second ORF of SFV requires a full round of replication in order for the sub-genomic promoter to become available. Therefore by utilising the replicon SFV expressing RLuc reporter directly from genomic RNA and FFLuc via activity of the subgenomic promoter we could test whether Wolbachia is affecting the replication of viral RNA. Our results showed that viral replication and/or translation of replicon were inhibited by Wolbachia. This could occur either by Wolbachia directly interfering with replication, or by inhibiting the translation of viral proteins required for this to occur and/or inhibiting the switch from translation to replication. Further to this we showed by using a SFV transreplicase system and uncoupling the replicase proteins from template RNA that there was significant inhibition of the subgenomic promoter and thus viral translation and/or replication. Thus providing replicase proteins either directly or separately did not overcome the inhibition phenotype. These results indicate that the origin of viral RNA (transcription in the nucleus in the transreplicase system) was also not important to Wolbachia-mediated antiviral activity.

This block in translation/replication in the presence of the endosymbiont was backed by analysis of the induction of small RNA responses, which reveal that Wolbachia-infected cells did not show higher production of viRNAs which are derived from the dsRNA generated during viral replication (see below).

One possible way in which Wolbachia could protect against viruses would be by the bacterium mounting an active antiviral response following infection. If this were the case, it would likely be reflected in a transcriptional response of the endosymbiont to the virus. However, in a very large dataset we did not find a single Wolbachia gene that was differentially regulated in response to viral infection. This is consistent with the very early inhibition of viral replication, which suggests that the antiviral mechanism is constitutively present before the virus infects the cell and is thus intrinsic.

Previous studies have indicated that a host miRNA response may be responsible for Wolbachia’s antiviral activity [30, 31, 48], but we found no support for this hypothesis in our system. In virus-free mosquitoes Wolbachia changes the expression of a number of miRNAs, but we found no such differences in our cell line (S3E Fig). Previous studies did not analyze concurrent infections of both Wolbachia and virus [30, 31, 48]. When we did this we found a marked miRNA response to the virus, but this was unaltered by the presence of Wolbachia. It is surprising that we still see host miRNA response to viral infection in the presence of Wolbachia, as the level of SFV infection is extremely low. This suggests that miRNA response may be due to early events in viral replication such as virion binding and/or entry or that this response requires very little viral protein synthesis/RNA replication to be initiated. Previous studies have indicated that the viRNA pathway is not required for Wolbachia’s antiviral activity [29]. Our data supports this, with a strong reduction in 21 nt viRNAs mapping to the SFV genome and antigenome when Wolbachia is present. This suggests that viral replication is inhibited so significantly that very few viRNAs are produced, rather than Wolbachia inducing an antiviral RNAi response. Further studies utilising this system would be beneficial to the field. For example little is known about the possibility of viruses mutating to overcome Wolbachia mediated protection as long term studies are lacking. A cell-based assay offers an ideal opportunity to look at virus evolution over the long term in such associations. In addition to this it would be interesting to look at the effect on other viruses in our system as other studies have indicated that even within the same family Wolbachia can have different effects on viruses [49]. In Drosophila studies Wolbachia is also known to protect against FHV without lowering viral titres. It would be interesting to look at this in the context of our findings, as it may suggest another mechanism by which Wolbachia can confer antiviral activity [6].

In conclusion we have developed a powerful new system to study the replication dynamics of SFV in Wolbachia-infected D. melanogaster cells. While the exact mechanism of the antiviral response remains unknown, current data is consistent with a ‘passive’ mechanism such as competition for resources or space, or by Wolbachia remodelling the intracellular environment. While effects of Wolbachia on entry or exit cannot be excluded, our data point to an effect on translation and/or replication at least for this model alphavirus. Considering the broad antiviral effects of Wolbachia across Drosophila and mosquito species, it is tempting to propose a model of inhibition that relies on similar intrinsic mechanisms rather than diverse processes such as miRNA regulation or immune responses. The data presented in this study point towards such an antiviral mode of action by Wolbachia endosymbionts.

Materials and Methods

Cell culture

The Wolbachia-infected D. melanogaster cell line Jw18Wol (obtained from W. Sullivan, L. Serbus, A. Debec) has been described elsewhere [34]. A corresponding tetracycline cured line (Jw18Free) was created by treating cells with 10 μg/ml of tetracycline for 4 passages, cells were then tested for Wolbachia by PCR and DAPI staining and if the infection was cleared cells were left for 5 more passages in order to eliminate tetracycline effects. Cells were maintained at 24°C in Shields and Sanger media (Sigma) supplemented with 10% fetal calf serum (FCS) and 10% Penicillin/Streptomycin (Pen/Strep). Cells were checked every four passages for the presence of Wolbachia by PCR using two separate primer pairs as described previously [6]; cells were stained with DAPI in order to visualise Wolbachia content (shown as dots in cytoplasm), density in Jw18Wol cells was consistent with previous observations with ~90% of cells infected (S4 Fig). qPCR was also carried out in order to determine Wolbachia density. Standard curve analysis was carried out and normalised to an Actin endogenous control. Primers used were as follows, Actin5CF_ GACGAAGAAGTTGCTGCTCTGGTTG Actin5CR TGAGGATACCACGCTTGCTCTGC and WolF GTTTGCAATACAACGGTGAA WolR CAACCCTGATGTCGTCCATT. qPCR was carried out using the ABI Fast SYBR Green Master Mix, as per manufactures guidelines, on an ABI 750 Fast machine. Results indicated that when compared to Actin endogenous control there is ~22 times more Wolbachia (S5 Fig), suggesting a density of at least 100% with more than one copy number per cell as is seen in the DAPi staining.

Virus production and in vitro transcription of replicon RNA

SFV4(3H)-RLuc virus was grown and cultivated as described previously [37]. For replicon production, pSFV1(3F)RLuc-SG-FFLuc plasmid (details available on request) was linearized with SpeI and purified using the PCR product purification kit (Roche). 1 μg of linearized DNA was in vitro transcribed using MEGAscript SP6 polymerase kit (Ambion) in the presence of cap analog (Ambion).

SFV transreplicase system: construction of replicase and template expression constructs

pAc51-V5-His backbone was used to construct the plasmid expressing the replicase of SFV. First, the multiple coning site of the plasmid was replaced by a polylinker sequence TTCGAATATGGATCCTATTTAATTAATATCCTAGG (recognition sites of Bsp119I and PacI are underlined). Second, Bsp119I and PacI adapters were added to the 5’ and 3’ ends of the sequence encoding SFV replicase, respectively, by using PCR and subcloning procedures. Finally, the sequence encoding SFV replicase was inserted into modified pAc51 vector using Bsp119I and PacI restriction sites. The resulting plasmid was designated as pAct51-SFVRepl. In order to obtain plasmid encoding for a polymerase defective form of SFV replicase, the conserved GDD motif in nsP4 was altered to GAA using PCR-based mutagenesis and subcloning procedures; the resulting plasmid was designated pAc51-SFVRepl-GAA.

In order to obtain a plasmid for expression of template RNA for the SFV replicase the polylinker and terminator regions of pAc51-V5-His were replaced with a synthetic DNA fragment consisting from the first 280 nucleotides of SFV genome (including EcoRV restriction site, nucleotides 275–280) followed by the sequence TATGGATCCTATGGCGCGCCGTCGAC (recognition sites BamHI, BssH2 and SalI underlined). The replacement was performed in such a way that the 5’ end of the SFV genome was positioned exactly downstream of last start site of actin promoter. The following sequences were added using synthetic DNA fragments (GenScript, USA) and subcloning procedures: a) sequence encoding for firefly luciferase (FFLuc), placed in frame with N-terminal fragment of SFV nsP1 (amino acid residues 1–65, encoded by the 5’ region of SFV genome); b) SFV subgenomic promoter spanning from position -145 to +51 with respect of the start site of SFV subgenomic RNA; c) sequence encoding for Gaussia luciferase (Gluc); d) 3’ UTR of SFV followed by 69 adenine residues; e) negative strand ribozyme of hepatitis delta virus; e) late termination region of simian virus 40. Elements a, b, c and d were separated from each other by recognition sequences of EcoRV, ApaI and Bsp119I nucleases, respectively. The plasmid was designated as pAc51-Temp-Fluc2-SG-Gluc.

Infection of cells with SFV

Cells were plated out at a density of 3.5x105 cells/well 24 h prior to infection in a 24 well plate. For infection, virus was diluted in Shields and Sanger media (Sigma) with no FCS. Virus was titred as described [37] and an MOI of 20 was shown to give an infectivity of over 90% in Jw18Free cells (S4C Fig). Cells were incubated for 3 h before media was replaced with fresh media supplemented with 10% FCS and Pen/Strep. Samples were collected at time points as indicated. Virus free cells were mock infected by treating the same as infected cells but without the addition of virus to the media.

Immunofluorescence detection of Wolbachia and SFV

Wolbachia was detected using the nuclear stain DAPI. Briefly cells were fixed in 4% paraformaldehyde, permeabilized and covered in Vectashield containing DAPI. Wolbachia was indicated by the presence staining outside of the nucleus which was absent in tetracycline treated cells. SFV was detected as described previously using an antibody against the replicative protein nsP2 [50].

Transfection of cells with SFV1(3F)RLuc-SG-FFLuc replicon RNA or SFV transreplicase plasmids

Cells were plated out at a density of 3.5x105 cells/well 24 h prior to transfection in a 24 well plate. Cells were transfected with 1 μl of in vitro transcribed RNA using Fugene in Shields and Sanger media minus FCS. Cells were incubated for 2 h before media was replaced with fresh media supplemented with 10% FCS and Pen/Strep. For transreplicase experiments 300 ng of each plasmid was transfected into cells as described above.

Luciferase assays

Cells were lysed in passive lysis buffer and luciferase readings carried out using the Dual Luciferase Kit (Promega). Luciferase activities were determined on a Glomax Multi+ Microplate Multimode reader (Promega).

Sequencing and analysis of small RNAs

Cells were infected with SFV as described above. At 7 and 24 hpi cells were lysed in 1 ml of Trizol solution. Small RNA libraries were prepared according to the Illumina method using the Truseq small RNA Preparation kit. We made a small adjustment to the manufacturer’s protocol to include a ribosomal RNA blocking step prior to ligation of 5´ adapter and reverse transcription in order to eliminate the abundant 30 nt D. melanogaster 2S rRNA, as specified in [51]. Small RNA libraries were then sequenced on one lane of a HiSeq 2000. High throughput sequencing data was processed and aligned to the viral genome as described previously [52]. miRNAs were mapped to D. melanogaster miRNAs downloaded from miRBase [53] using a custom Perl script and analysed to identify statistically significant changes in expression according to the negative binomial distribution using the R package DESeq as described [54]. All data processing was carried out in the R statistical environment. Sequence data has been submitted to the Sequence Read Archive (SRA) under accession number PRJEB9710.

Sequencing and analysis of total RNA

Wolbachia-positive Jw18Wol cells were infected with SFV at an MOI of 20 as described above. 7 and 24 hpi cells were lysed in 1 ml of Trizol; total RNA was extracted using the Direct-Zol MiniPrep kit (Zymo). The extracted RNA was then treated with TURBO DNase (Ambion) and purified using the RNA Clean and Concentrator kit (Zymo). D. melanogaster ribosomal RNA was then depleted using the Ribo-Zero Gold Magnetic kit (Human/Mouse/Rat, Epicentre). Libraries of the rRNA-depleted total RNA were prepared at The Genome Analysis Center (Norwich) with the Truseq RNA Sample Preparation kit (Illumina) and sequenced in 2 lanes on a HiSeq 2000. Sequence data has been submitted to the Sequence Read Archive (SRA) under accession number PRJEB10681. Sequences were quality trimmed from the 5´ and 3´ ends using Trimmomatic version 0.30 [55] when average quality scores in sliding windows of 4 base pairs dropped below 20 or when the quality score at the beginning or end of the read dropped below 20. Sequences less than 25 bp in length were discarded. Reads were aligned to the transcriptomes of Wolbachia strain wMel (Genbank accession number: GCA_000008025.1) and D. melanogaster (BDGP v. 5.25), and to the genome of SFV (Genbank: KP699763.1). Alignments were performed using Bowtie2 version 2.1.0 [56] with default parameters, and splicing was allowed in D. melanogaster using TopHat2 version 2.0.9 [57] with default parameters and no novel junctions allowed. The numbers of reads per transcript were counted using HTSeq [58] for Wolbachia and D. melanogaster. Differential expression analysis was performed using edgeR [59]. Lowly expressed genes were filtered out by requiring that each gene have at least 1 count per million in at least 8 samples. Differential expression in response to viral infection was measured separately at 7 and 24 hpi. Significance was assessed using exact tests [59] with a FDR of 10%.

Supporting Information

S1 Fig. Analysis of small RNAs profiles in virus-free cells in the different treatments.

This data is the virus-free controls for Fig 4A and 4B in the main text. The length and first nucleotide distribution of small RNAs mapping to SFV genome (upper bars, 5′-3′ orientation) or antigenome (lower bars, 3’-5’ orientation) at 24 h post mock infection of D. melanogaster cells in the absence (A) (Jw18Free) or presence (B) (Jw18Wol) of Wolbachia are shown. Concatenated data from 5 independent infections are shown. A = red, C = green, G = blue and T = pink.


S2 Fig. The effect of Wolbachia on the distribution of nucleotides in virus-derived small interfering RNAs (viRNAs).

Mapping of nucleotide distribution of small RNAs mapping to the SFV genome in the (A) (Jw18Free) absence or (B) (Jw18Wol) presence of Wolbachia. A = red, C = green, G = blue and T = pink.


S3 Fig. The expression of miRNAs in D. melanogaster Jw18 cells with (Jw18Wol) and without (Jw18Free) Wolbachia, and with and without virus (SFV) infection.

Panels (A-D) are volcano plots summarizing the differential expression of miRNAs between pairs of treatments. The Y axis is the log10 of the FDR corrected P value. The X axis is the change in expression on a log2 scale. (E) Heatmap showing the relative expression of miRNAs homologous to those reported to be affected by Wolbachia infection of mosquito cells [48]. T = Jw18Free, W = Jw18Wol, V = SFV infection, O = no SFV infection and numbers represent replicate.


S4 Fig. Detection of Wolbachia infection by DAPI staining.

Cells were tetracycline treated or not and stained with DAPI in order to visualize Wolbachia infection; tetracycline-treated cells are referred to as Jw18Free. (A) Cells were checked for the presence of Wolbachia by PCR using two separate primer pairs as described previously [6]. (B) Cells were then stained with DAPI in order to visualise Wolbachia content, density was consistent with previous observations with ~90% of cells infected. (C) Jw18Free cells were infected with an MOI of 20 calculated in BHK cells and stained with SFV NSP2 antibody [50] in order to determine infection rate. Cells positive for SFV were shown to have an infection rate >90%.


S5 Fig. Calculation of Wolbachia density by qPCR.

Wolbachia density was calculated as a ratio to the endogenous control Actin 5C (Wol/Act), where it is assumed there is one copy of actin per cell. Experiments were carried out in triplicate with two biological replicates. Error bar indicates standard deviation.


S1 Table. List of miRNAs significantly differentially expressed in response to SFV in cells both with and without Wolbachia.

Table indicates miRNAs found to be significantly differentially expressed (Adjusted p value<0.1, Negative Binomial Test) upon SFV infection in either cells positive (Jw18Wol) or negative (Jw18Free) for Wolbachia. Black means significantly upregulated and red significantly down regulated.



We thank Sylviane Moss for support with high-throughput sequencing. We thank Isabelle Dietrich for helpful discussion. We also thank William Sullivan, Laura Serbus and Alain Debec for sharing the Jw18 cells.

Author Contributions

Conceived and designed the experiments: SMR AK FMJ JM PS EAM ES. Performed the experiments: SMR JM MM PJ PS MV. Analyzed the data: SMR JM FMJ PJ PS AK. Contributed reagents/materials/analysis tools: AL AM EAM. Wrote the paper: SMR AK FMJ PS JM.


  1. 1. Kean J, Rainey S, McFarlane M, Donald C, Schnettler E, Kohl A, et al. Fighting Arbovirus Transmission: Natural and Engineered Control of Vector Competence in Aedes Mosquitoes. Insects. 2015;6(1):236. pmid:26463078
  2. 2. Weaver SC, Reisen WK. Present and future arboviral threats. Antiviral Res. 2010;85(2):328–45. Epub 2009/10/28. doi: S0166-3542(09)00495-1 [pii] pmid:19857523; PubMed Central PMCID: PMC2815176.
  3. 3. Rainey SM, Shah PN, Kohl A, Dietrich I. Understanding the Wolbachia-mediated inhibition of arboviruses in mosquitoes: progress and challenges. J Gen Virol. 2013;16(10):057422–0.
  4. 4. Iturbe-Ormaetxe I, Walker T, SL ON. Wolbachia and the biological control of mosquito-borne disease. EMBO Rep. 2011;12(6):508–18. pmid:21546911; PubMed Central PMCID: PMC3128286.
  5. 5. Hedges LM, Brownlie JC, O'Neill SL, Johnson KN. Wolbachia and virus protection in insects. Science. 2008;322(5902):702. Epub 2008/11/01. pmid:18974344.
  6. 6. Teixeira L, Ferreira A, Ashburner M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. PLoS Biol. 2008;6(12):e2. pmid:19222304.
  7. 7. Walker T, Johnson PH, Moreira LA, Iturbe-Ormaetxe I, Frentiu FD, McMeniman CJ, et al. The wMel Wolbachia strain blocks dengue and invades caged Aedes aegypti populations. Nature. 2011;476(7361):450–3. Epub 2011/08/26. pmid:21866159.
  8. 8. Moreira LA, Iturbe-Ormaetxe I, Jeffery JA, Lu G, Pyke AT, Hedges LM, et al. A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium. Cell. 2009;139(7):1268–78. Epub 2010/01/13. pmid:20064373.
  9. 9. McMeniman CJ, Lane RV, Cass BN, Fong AW, Sidhu M, Wang YF, et al. Stable introduction of a life-shortening Wolbachia infection into the mosquito Aedes aegypti. Science. 2009;323(5910):141–4. Epub 2009/01/03. doi: 323/5910/141 [pii] pmid:19119237.
  10. 10. Sinkins SP. Wolbachia and cytoplasmic incompatibility in mosquitoes. Insect Biochem Mol Biol. 2004;34(7):723–9. Epub 2004/07/10. pmid:15242714.
  11. 11. Hoffmann AA, Montgomery BL, Popovici J, Iturbe-Ormaetxe I, Johnson PH, Muzzi F, et al. Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission. Nature. 2011;476(7361):454–7. Epub 2011/08/26. pmid:21866160.
  12. 12. Hoffmann AA, Iturbe-Ormaetxe I, Callahan AG, Phillips BL, Billington K, Axford JK, et al. Stability of the wMel Wolbachia Infection following invasion into Aedes aegypti populations. PLoS Negl Trop Dis. 2014;8(9):e3115. pmid:25211492; PubMed Central PMCID: PMC4161343.
  13. 13. Frentiu FD, Zakir T, Walker T, Popovici J, Pyke AT, van den Hurk A, et al. Limited dengue virus replication in field-collected Aedes aegypti mosquitoes infected with Wolbachia. PLoS Negl Trop Dis. 2014;8(2):e2688. pmid:24587459; PubMed Central PMCID: PMC3930499.
  14. 14. Osborne SE, Iturbe-Ormaetxe I, Brownlie JC, O'Neill SL, Johnson KN. Antiviral protection and the importance of Wolbachia density and tissue tropism in Drosophila simulans. Applied and environmental microbiology. 2012;78(19):6922–9. Epub 2012/07/31. pmid:22843518; PubMed Central PMCID: PMC3457512.
  15. 15. Osborne SE, Leong YS, O'Neill SL, Johnson KN. Variation in antiviral protection mediated by different Wolbachia strains in Drosophila simulans. PLoS Pathog. 2009;5(11):e1000656. Epub 2009/11/17. pmid:19911047; PubMed Central PMCID: PMC2768908.
  16. 16. Martinez J, Longdon B, Bauer S, Chan YS, Miller WJ, Bourtzis K, et al. Symbionts commonly provide broad spectrum resistance to viruses in insects: a comparative analysis of Wolbachia strains. PLoS Pathog. 2014;10(9):e1004369. pmid:25233341; PubMed Central PMCID: PMC4169468.
  17. 17. Bian G, Xu Y, Lu P, Xie Y, Xi Z. The endosymbiotic bacterium Wolbachia induces resistance to dengue virus in Aedes aegypti. PLoS Pathog. 2010;6(4):e1000833. Epub 2010/04/07. pmid:20368968; PubMed Central PMCID: PMC2848556.
  18. 18. Lu P, Bian G, Pan X, Xi Z. Wolbachia induces density-dependent inhibition to dengue virus in mosquito cells. PLoS Negl Trop Dis. 2012;6(7):e1754. Epub 2012/08/01. PNTD-D-12-00216 [pii]. pmid:22848774; PubMed Central PMCID: PMC3404113.
  19. 19. Frentiu FD, Robinson J, Young PR, McGraw EA, O'Neill SL. Wolbachia-Mediated Resistance to Dengue Virus Infection and Death at the Cellular Level. PloS one. 2010;5(10). doi: ARTN e13398 pmid:ISI:000283043700006.
  20. 20. Caragata EP, Rances E, Hedges LM, Gofton AW, Johnson KN, O'Neill SL, et al. Dietary cholesterol modulates pathogen blocking by wolbachia. PLoS Pathog. 2013;9(6):e1003459. Epub 2013/07/05. PPATHOGENS-D-12-02513 [pii]. pmid:23825950; PubMed Central PMCID: PMC3694857.
  21. 21. Rances E, Ye YH, Woolfit M, McGraw EA, O'Neill SL. The relative importance of innate immune priming in Wolbachia-mediated dengue interference. Plos Pathogens. 2012;8(2):e1002548. Epub 2012/03/03. pmid:22383881; PubMed Central PMCID: PMC3285598.
  22. 22. Tchankouo-Nguetcheu S, Khun H, Pincet L, Roux P, Bahut M, Huerre M, et al. Differential protein modulation in midguts of Aedes aegypti infected with chikungunya and dengue 2 viruses. PloS one. 2010;5(10). Epub 2010/10/20. pmid:20957153; PubMed Central PMCID: PMC2950154.
  23. 23. Kambris Z, Blagborough AM, Pinto SB, Blagrove MS, Godfray HC, Sinden RE, et al. Wolbachia stimulates immune gene expression and inhibits plasmodium development in Anopheles gambiae. Plos Pathogens. 2010;6(10):e1001143. Epub 2010/10/16. pmid:20949079; PubMed Central PMCID: PMC2951381.
  24. 24. Rances E, Johnson TK, Popovici J, Iturbe-Ormaetxe I, Zakir T, Warr CG, et al. The Toll and Imd Pathways Are Not Required for Wolbachia-Mediated Dengue Virus Interference. Journal of virology. 2013;87(21):11945–9. Epub 2013/08/30. pmid:23986574.
  25. 25. Bourtzis K, Pettigrew MM, O'Neill SL. Wolbachia neither induces nor suppresses transcripts encoding antimicrobial peptides. Insect molecular biology. 2000;9(6):635–9. Epub 2000/12/21. pmid:11122472.
  26. 26. Donald CL, Kohl A, Schnettler E. New insights into control of arbovirus replication and spread by insect RNA interference pathways. Insects. 2012;3(2):511–31. pmid:26466541
  27. 27. Blair CD, Olson KE. The role of RNA interference (RNAi) in arbovirus-vector interactions. Viruses. 2015;7(2):820–43. pmid:25690800; PubMed Central PMCID: PMC4353918.
  28. 28. Glaser RL, Meola MA. The native Wolbachia endosymbionts of Drosophila melanogaster and Culex quinquefasciatus increase host resistance to West Nile virus infection. PloS one. 2010;5(8):e11977. Epub 2010/08/12. pmid:20700535; PubMed Central PMCID: PMC2916829.
  29. 29. Hedges LM, Yamada R, O'Neill SL, Johnson KN. The siRNA pathway is not essential for Wolbachia-mediated antiviral protection in Drosophila. Applied and environmental microbiology. 2012;78(18):6773–6. Epub 2012/07/13. pmid:22798369
  30. 30. Osei-Amo S, Hussain M, O'Neill SL, Asgari S. Wolbachia-induced aae-miR-12 miRNA negatively regulates the expression of MCT1 and MCM6 genes in Wolbachia-infected mosquito cell line. PloS one. 2012;7(11):e50049. Epub 2012/11/21. pmid:23166816; PubMed Central PMCID: PMC3500346.
  31. 31. Hussain M, Frentiu FD, Moreira LA, O'Neill SL, Asgari S. Wolbachia uses host microRNAs to manipulate host gene expression and facilitate colonization of the dengue vector Aedes aegypti. Proc Natl Acad Sci U S A. 2011;108(22):9250–5. Epub 2011/05/18. [pii]. pmid:21576469; PubMed Central PMCID: PMC3107320.
  32. 32. Zhang G, Hussain M, O'Neill SL, Asgari S. Wolbachia uses a host microRNA to regulate transcripts of a methyltransferase, contributing to dengue virus inhibition in Aedes aegypti. Proc Natl Acad Sci U S A. 2013;110(25):10276–81. Epub 2013/06/05. pmid:23733960; PubMed Central PMCID: PMC3690878.
  33. 33. Lucas K, Raikhel AS. Insect microRNAs: biogenesis, expression profiling and biological functions. Insect Biochem Mol Biol. 2013;43(1):24–38. pmid:23165178; PubMed Central PMCID: PMC3534889.
  34. 34. Serbus LR, Landmann F, Bray WM, White PM, Ruybal J, Lokey RS, et al. A Cell-Based Screen Reveals that the Albendazole Metabolite, Albendazole Sulfone, Targets Wolbachia. Plos Pathogens. 2012;8(9). doi: ARTN e1002922 pmid:ISI:000309816500028.
  35. 35. Rodriguez-Andres J, Rani S, Varjak M, Chase-Topping ME, Beck MH, Ferguson MC, et al. Phenoloxidase activity acts as a mosquito innate immune response against infection with Semliki Forest virus. PLoS Pathog. 2012;8(11):e1002977. Epub 2012/11/13. PPATHOGENS-D-12-01166 [pii]. pmid:23144608; PubMed Central PMCID: PMC3493465.
  36. 36. Schnettler E, Donald CL, Human S, Watson M, Siu RW, McFarlane M, et al. Knockdown of piRNA pathway proteins results in enhanced Semliki Forest virus production in mosquito cells. J Gen Virol. 2013;94(Pt 7):1680–9. pmid:23559478; PubMed Central PMCID: PMC3709635.
  37. 37. Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, et al. Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs. J Virol. 2011;85(6):2907–17. pmid:21191029; PubMed Central PMCID: PMC3067965.
  38. 38. Fragkoudis R, Chi Y, Siu RWC, Barry G, Attarzadeh-Yazdi G, Merits A, et al. Semliki Forest virus strongly reduces mosquito host defence signaling. Insect molecular biology. 2008;17(6):647–56. pmid:ISI:000260729100006.
  39. 39. Rupp JC, Sokoloski KJ, Gebhart NN, Hardy RW. Alphavirus RNA synthesis and nonstructural protein functions. J Gen Virol. 2015;96(9):2483–500. Epub 2015/07/27. pmid:26219641.
  40. 40. Utt A, Quirin T, Saul S, Hellstrom K, Ahola T, Merits A. Versatile Trans-Replication Systems for Chikungunya Virus Allow Functional Analysis and Tagging of Every Replicase Protein. PLoS One. 2016;11(3):e0151616. pmid:26963103.
  41. 41. Merkling SH, van Rij RP. Beyond RNAi: antiviral defense strategies in Drosophila and mosquito. Journal of insect physiology. 2013;59(2):159–70. Epub 2012/07/25. pmid:22824741.
  42. 42. Morazzani EM, Wiley MR, Murreddu MG, Adelman ZN, Myles KM. Production of virus-derived ping-pong-dependent piRNA-like small RNAs in the mosquito soma. PLoS Pathog. 2012;8(1):e1002470. pmid:22241995; PubMed Central PMCID: PMC3252369.
  43. 43. Cenik ES, Fukunaga R, Lu G, Dutcher R, Wang Y, Tanaka Hall TM, et al. Phosphate and R2D2 restrict the substrate specificity of Dicer-2, an ATP-driven ribonuclease. Mol Cell. 2011;42(2):172–84. pmid:21419681; PubMed Central PMCID: PMC3115569.
  44. 44. Blagrove MS, Arias-Goeta C, Di Genua C, Failloux AB, Sinkins SP. A Wolbachia wMel transinfection in Aedes albopictus is not detrimental to host fitness and inhibits Chikungunya virus. PLoS Negl Trop Dis. 2013;7(3):e2152. Epub 2013/04/05. PNTD-D-12-01495 [pii]. pmid:23556030; PubMed Central PMCID: PMC3610642.
  45. 45. Mousson L, Martin E, Zouache K, Madec Y, Mavingui P, Failloux AB. Wolbachia modulates Chikungunya replication in Aedes albopictus. Mol Ecol. 2010;19(9):1953–64. Epub 2010/03/30. [pii]. pmid:20345686.
  46. 46. Lu P, Bian G, Pan X, Xi Z. Wolbachia induces density-dependent inhibition to dengue virus in mosquito cells. PLoS neglected tropical diseases. 2012;6(7):e1754. Epub 2012/08/01. pmid:22848774; PubMed Central PMCID: PMC3404113.
  47. 47. Strauss JH, Strauss EG. The alphaviruses: gene expression, replication, and evolution. Microbiol Rev. 1994;58(3):491–562. pmid:7968923; PubMed Central PMCID: PMC372977.
  48. 48. Mayoral JG, Etebari K, Hussain M, Khromykh AA, Asgari S. Wolbachia infection modifies the profile, shuttling and structure of microRNAs in a mosquito cell line. PLoS One. 2014;9(4):e96107. pmid:24759922; PubMed Central PMCID: PMC3997519.
  49. 49. Hussain M, Lu G, Torres S, Edmonds JH, Kay BH, Khromykh AA, et al. Effect of Wolbachia on replication of West Nile virus in a mosquito cell line and adult mosquitoes. J Virol. 2013;87(2):851–8. Epub 2012/11/02. [pii]. pmid:23115298; PubMed Central PMCID: PMC3554047.
  50. 50. Spuul P, Balistreri G, Kaariainen L, Ahola T. Phosphatidylinositol 3-kinase-, actin-, and microtubule-dependent transport of Semliki Forest Virus replication complexes from the plasma membrane to modified lysosomes. J Virol. 2010;84(15):7543–57. pmid:20484502; PubMed Central PMCID: PMC2897599.
  51. 51. Wickersheim ML, Blumenstiel JP. Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries. Biotechniques. 2013;55(5):269–72. pmid:24215643; PubMed Central PMCID: PMC4077022.
  52. 52. Ashe A, Belicard T, Le Pen J, Sarkies P, Frezal L, Lehrbach NJ, et al. A deletion polymorphism in the Caenorhabditis elegans RIG-I homolog disables viral RNA dicing and antiviral immunity. Elife. 2013;2:e00994. pmid:24137537; PubMed Central PMCID: PMC3793227.
  53. 53. Kozomara A, Griffiths-Jones S. miRBase: integrating microRNA annotation and deep-sequencing data. Nucleic Acids Res. 2011;39(Database issue):D152–7. pmid:21037258; PubMed Central PMCID: PMC3013655.
  54. 54. Anders S, Huber W. Differential expression analysis for sequence count data. Genome Biol. 2010;11(10):R106. pmid:20979621; PubMed Central PMCID: PMC3218662.
  55. 55. Lohse M, Bolger AM, Nagel A, Fernie AR, Lunn JE, Stitt M, et al. RobiNA: a user-friendly, integrated software solution for RNA-Seq-based transcriptomics. Nucleic acids research. 2012;40(Web Server issue):W622–7. pmid:22684630; PubMed Central PMCID: PMC3394330.
  56. 56. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nature methods. 2012;9(4):357–9. pmid:22388286; PubMed Central PMCID: PMC3322381.
  57. 57. Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013;14(4):R36. pmid:23618408; PubMed Central PMCID: PMC4053844.
  58. 58. Anders S, McCarthy DJ, Chen Y, Okoniewski M, Smyth GK, Huber W, et al. Count-based differential expression analysis of RNA sequencing data using R and Bioconductor. Nat Protoc. 2013;8(9):1765–86. pmid:23975260.
  59. 59. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26(1):139–40. pmid:19910308; PubMed Central PMCID: PMC2796818.