Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

ACE I/D genotype associates with strength in sarcopenic men but not with response to ACE inhibitor therapy in older adults with sarcopenia: Results from the LACE trial

  • Christos Rossios,

    Roles Investigation, Writing – review & editing

    Affiliation Cardiovascular and Respiratory Interface Section, National Heart and Lung Institute, Imperial College London, South Kensington Campus, London, United Kingdom

  • Tufail Bashir,

    Roles Investigation, Writing – review & editing

    Affiliation Cardiovascular and Respiratory Interface Section, National Heart and Lung Institute, Imperial College London, South Kensington Campus, London, United Kingdom

  • Marcus Achison,

    Roles Data curation, Funding acquisition, Investigation, Writing – review & editing

    Affiliation Tayside Clinical Trials Unit (TCTU), Tayside Medical Science Centre (TASC), University of Dundee, Ninewells Hospital & Medical School, Dundee, United Kingdom

  • Simon Adamson,

    Roles Data curation, Writing – review & editing

    Affiliation Tayside Clinical Trials Unit (TCTU), Tayside Medical Science Centre (TASC), University of Dundee, Ninewells Hospital & Medical School, Dundee, United Kingdom

  • Asangaedem Akpan,

    Roles Investigation, Writing – review & editing

    Affiliation University of Liverpool, Liverpool University Hospitals NHS FT Trust, Clinical Research Network Northwest Coast, Liverpool, United Kingdom

  • Terry Aspray,

    Roles Investigation, Writing – review & editing

    Affiliation AGE Research Group, NIHR Newcastle Biomedical Research Centre, Translational Clinical Research Institute, Newcastle University, Cumbria Northumberland Tyne and Wear NHS Foundation Trust and Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom

  • Alison Avenell,

    Roles Investigation, Writing – review & editing

    Affiliation Health Services Research Unit, University of Aberdeen, Aberdeen, United Kingdom

  • Margaret M. Band,

    Roles Project administration, Writing – review & editing

    Affiliation Tayside Clinical Trials Unit (TCTU), Tayside Medical Science Centre (TASC), University of Dundee, Ninewells Hospital & Medical School, Dundee, United Kingdom

  • Louise A. Burton,

    Roles Investigation, Writing – review & editing

    Affiliations Medicine for the Elderly, NHS Tayside, Dundee, United Kingdom, Ageing and Health, University of Dundee, Dundee, United Kingdom

  • Vera Cvoro,

    Roles Investigation, Writing – review & editing

    Affiliations Victoria Hospital, Kirkcaldy, United Kingdom, Centre for Clinical Brain Sciences, University of Edinburgh, Edinburgh, United Kingdom

  • Peter T. Donnan,

    Roles Data curation, Writing – review & editing

    Affiliation Division of Population Health and Genomics, School of Medicine, University of Dundee, Dundee, United Kingdom

  • Gordon W. Duncan,

    Roles Investigation, Writing – review & editing

    Affiliations Centre for Clinical Brain Sciences, University of Edinburgh, Edinburgh, United Kingdom, Medicine for the Elderly, NHS Lothian, Edinburgh, United Kingdom

  • Jacob George,

    Roles Data curation, Writing – review & editing

    Affiliation Dept Clinical Pharmacology, Division of Molecular & Clinical Medicine, University of Dundee Medical School, Ninewells Hospital, Dundee, United Kingdom

  • Adam L. Gordon,

    Roles Investigation, Writing – review & editing

    Affiliations Unit of Injury, Inflammation and Recovery, School of Medicine, University of Nottingham, Nottingham, United Kingdom, NIHR Nottingham Biomedical Research Centre, Department of Medicine for the Elderly, University Hospitals of Derby and Burton NHS Foundation Trust, Derby, United Kingdom

  • Celia L. Gregson,

    Roles Investigation, Writing – review & editing

    Affiliations Musculoskeletal Research Unit, Bristol Medical School, University of Bristol, Bristol, United Kingdom, Older Person’s Unit, Royal United Hospital NHS Foundation Trust Bath, Bath, United Kingdom

  • Adrian Hapca,

    Roles Data curation, Writing – review & editing

    Affiliation Tayside Clinical Trials Unit (TCTU), Tayside Medical Science Centre (TASC), University of Dundee, Ninewells Hospital & Medical School, Dundee, United Kingdom

  • Cheryl Hume,

    Roles Project administration, Writing – review & editing

    Affiliation Tayside Clinical Trials Unit (TCTU), Tayside Medical Science Centre (TASC), University of Dundee, Ninewells Hospital & Medical School, Dundee, United Kingdom

  • Thomas A. Jackson,

    Roles Investigation, Writing – review & editing

    Affiliation Institute of Inflammation and Ageing, University of Birmingham, Birmingham, United Kingdom

  • Simon Kerr,

    Roles Investigation, Writing – review & editing

    Affiliation Department of Older People’s Medicine, Newcastle upon Tyne Hospitals NHS Foundation Trust, Newcastle upon Tyne, United Kingdom

  • Alixe Kilgour,

    Roles Investigation, Writing – review & editing

    Affiliations Medicine for the Elderly, NHS Lothian, Edinburgh, United Kingdom, Ageing and Health Research Group, Usher Institute, University of Edinburgh, Edinburgh, United Kingdom

  • Tahir Masud,

    Roles Investigation, Writing – review & editing

    Affiliation Clinical Gerontology Research Unit, Nottingham University Hospitals NHS Trust, City Hospital Campus, Nottingham, United Kingdom

  • Andrew McKenzie,

    Roles Data curation, Writing – review & editing

    Affiliation Tayside Clinical Trials Unit (TCTU), Tayside Medical Science Centre (TASC), University of Dundee, Ninewells Hospital & Medical School, Dundee, United Kingdom

  • Emma McKenzie,

    Roles Data curation, Writing – review & editing

    Affiliation Tayside Clinical Trials Unit (TCTU), Tayside Medical Science Centre (TASC), University of Dundee, Ninewells Hospital & Medical School, Dundee, United Kingdom

  • Harnish Patel,

    Roles Investigation, Writing – review & editing

    Affiliation NIHR Biomedical Research Centre, University of Southampton and University Hospital Southampton NHSFT, Southampton, Hampshire, United Kingdom

  • Kristina Pilvinyte,

    Roles Project administration, Writing – review & editing

    Affiliation Tayside Clinical Trials Unit (TCTU), Tayside Medical Science Centre (TASC), University of Dundee, Ninewells Hospital & Medical School, Dundee, United Kingdom

  • Helen C. Roberts,

    Roles Investigation, Writing – review & editing

    Affiliation Academic Geriatric Medicine, University of Southampton, Mailpoint 807 Southampton General Hospital, Southampton, United Kingdom

  • Avan A. Sayer,

    Roles Investigation, Writing – review & editing

    Affiliation AGE Research Group, NIHR Newcastle Biomedical Research Centre, Translational Clinical Research Institute, Newcastle University, Cumbria Northumberland Tyne and Wear NHS Foundation Trust and Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom

  • Karen T. Smith,

    Roles Project administration, Writing – review & editing

    Affiliation Tayside Clinical Trials Unit (TCTU), Tayside Medical Science Centre (TASC), University of Dundee, Ninewells Hospital & Medical School, Dundee, United Kingdom

  • Roy L. Soiza,

    Roles Investigation, Writing – review & editing

    Affiliation Ageing & Clinical Experimental Research (ACER) Group, University of Aberdeen, Aberdeen, United Kingdom

  • Claire J. Steves,

    Roles Investigation, Writing – review & editing

    Affiliation Department of Twin Research and Genetic Epidemiology, King’s College London & Department of Clinical Gerontology, King’s College Hospital, London, United Kingdom

  • Allan D. Struthers,

    Roles Investigation, Writing – review & editing

    Affiliation Dept Clinical Pharmacology, Division of Molecular & Clinical Medicine, University of Dundee Medical School, Ninewells Hospital, Dundee, United Kingdom

  • Divya Tiwari,

    Roles Investigation, Writing – review & editing

    Affiliation Bournemouth University and Royal Bournemouth Hospital, Bournemouth, United Kingdom

  • Julie Whitney,

    Roles Investigation, Writing – review & editing

    Affiliation School of Population Health & Environmental Sciences, King’s College London and King’s College Hospital, London, United Kingdom

  • Miles D. Witham,

    Roles Conceptualization, Funding acquisition, Investigation, Project administration, Writing – review & editing

    Affiliation AGE Research Group, NIHR Newcastle Biomedical Research Centre, Translational Clinical Research Institute, Newcastle University, Cumbria Northumberland Tyne and Wear NHS Foundation Trust and Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom

  •  [ ... ],
  • Paul R. Kemp

    Roles Conceptualization, Funding acquisition, Investigation, Supervision, Writing – original draft, Writing – review & editing

    p.kemp@imperial.ac.uk

    Affiliation Cardiovascular and Respiratory Interface Section, National Heart and Lung Institute, Imperial College London, South Kensington Campus, London, United Kingdom

  • [ view all ]
  • [ view less ]

Abstract

Background

Angiotensin II (AII), has been suggested to promote muscle loss. Reducing AII synthesis, by inhibiting angiotensin converting enzyme (ACE) activity has been proposed as a method to inhibit muscle loss. The LACE clinical trial was designed to determine whether ACE inhibition would reduce further muscle loss in individuals with sarcopenia but suffered from low recruitment and returned a negative result. Polymorphic variation in the ACE promoter (I/D alleles) has been associated with differences in ACE activity and muscle physiology in a range of clinical conditions. This aim of this analysis was to determine whether I/D polymorphic variation is associated with muscle mass, strength, in sarcopenia or contributed to the lack of response to treatment in the LACE study.

Methods

Sarcopenic individuals were recruited into a 2x2 factorial multicentre double-blind study of the effects of perindopril and/or leucine versus placebo on physical performance and muscle mass. DNA extracted from blood samples (n = 130 72 women and 58 men) was genotyped by PCR for the ACE I/D polymorphism. Genotypes were then compared with body composition measured by DXA, hand grip and quadriceps strength before and after 12 months’ treatment with leucine and/or perindopril in a cross-sectional analysis of the influence of genotype on these variables.

Results

Allele frequencies for the normal UK population were extracted from 13 previous studies (I = 0.473, D = 0.527). In the LACE cohort the D allele was over-represented (I = 0.412, D = 0.588, p = 0.046). This over-representation was present in men (I = 0.353, D = 0.647, p = 0.010) but not women (I = 0.458, D = 0.532, p = 0.708). In men but not women, individuals with the I allele had greater leg strength (II/ID = 18.00 kg (14.50, 21.60) vs DD = 13.20 kg (10.50, 15.90), p = 0.028). Over the 12 months individuals with the DD genotype increased in quadriceps strength but those with the II or ID genotype did not. Perindopril did not increase muscle strength or mass in any polymorphism group relative to placebo.

Conclusion

Our results suggest that although ACE genotype was not associated with response to ACE inhibitor therapy in the LACE trial population, sarcopenic men with the ACE DD genotype may be weaker than those with the ACE I/D or II genotype.

Introduction

The normal human growth cycle includes periods of muscle growth, muscle maintenance and muscle loss [1]. As people live to a greater age through improved environmental conditions and medical therapies, the period of loss is prolonged. Loss of muscle mass and strength in older age is termed sarcopenia [2], which is associated with major adverse consequences including falls, dependency and the need for care, hospital admission, prolonged hospital stay and earlier death [3]. As muscle mass and strength are governed by environmental, genetic and epigenetic factors, the combination of these will determine whether an individual becomes sarcopenic, and how rapidly the condition will deteriorate. The genetic factors contributing to sarcopenia are likely to include those that contribute to muscle mass and strength in adulthood and identifying such factors and pathways will aid the identification of therapeutic approaches to prevent, mitigate or help reverse sarcopenia.

The renin-angiotensin system has gained significant attention as a potential target pathway to treat sarcopenia [48]. Angiotensin II (AII) promotes the skeletal muscle catabolic pathway (e.g., MuRF1) in vitro [9] and inhibits IGF-1 production [10]. Infusion of angiotensin into mice promotes skeletal atrophy [11]. In one small before and after clinical study of patients with heart failure, 6 months treatment with ACEi or AII antagonists increased exercise performance [12]. In cross sectional studies of individuals on antihypertensive therapies, ACEi usage associated with preservation of muscle mass and strength [13, 14]. Other studies have combined ACEi with exercise in both individuals with COPD and women with sarcopenia to attempt to identify combinatorial effects but the results of these trials do not provide a consistent picture of increased effectiveness of exercise interventions in those receiving ACEi [1517].

These data suggest that reducing ACE activity and thereby AII could preserve muscle mass and strength in older individuals and one interventional study has supported this suggestion [18]. However, other trials in patients with COPD [4] and in patients with hypertension [19] have not shown a beneficial effect of ACEi. We recently conducted and published a multicentre 2 x 2 factorial RCT of leucine and ACE inhibitors in older people with sarcopenia (the LACE trial) which also showed no overall benefit from perindopril (an ACEi) therapy [20]. Whilst recruitment to this trial was low (as discussed in [21]) resulting in early termination by the funder, a meta-analysis of similar trials also showed a lack of effect, supporting the findings [20].

Studies of genetic variation show that the relationship between ACE activity and strength is not as simple as lower ACE activity associating with increased strength. One well-studied ACE promoter polymorphism, the insertion (I)/deletion (D) polymorphism, affects ACE synthesis with the D allele associated with greater ACE synthesis and higher circulating ACE activity [22]. However, contrary to the effects of AII on muscle mass and strength, several studies associate the ACE D allele with greater muscle mass and strength. For example, the D allele has been associated with increased performance in power sports [23], with increased strength following exercise training [24], and with increased strength in COPD patients [25]. Conversely, the I allele is associated with endurance [26, 27]. However, not all studies show the same enrichment of the D allele with strength in elite sports [28]. The effects of this polymorphism on muscle performance in the older population is unclear. In a study of 65-year-old Koreans the II genotype was associated with increased fatigue resistance [29]. In an Indonesian population of over 60 years the DD genotype was associated with reduced muscle mass [30] and in a Spanish cohort, individuals carrying the I allele had greater hand-grip strength than those with the DD genotype [31]. Conversely, in a large study of older Americans, (70–79 years) who continued to exercise, individuals with the II phenotype were more likely to show a loss of functional capacity [32]. One recent study of older individuals failed to identify any differences in lower limb strength normalised for body weight [33] and one further study failed to see any effect of the ACE I/D polymorphism on the exercise response in women over 60 [34].

These effects of the I/D polymorphism could be explained by variations in muscle fibre proportions. Skeletal muscle can be broadly categorised into two major fibre types (oxidative type I and more glycolytic type II). Type I fibres are used in endurance activities, whereas type II fibres are associated with power activities. In untrained volunteers, the D allele is associated with a greater proportion of type II fibres, with the I allele associated with a greater proportion of type I fibres [35], and treatment of patients with ACEi for 6 months increases MHC I (Myh7) expression [12]. Thus, over extended periods of time, higher ACE activity within the normal range, appears to promote a higher type II fibre proportion and so higher strength. However, more recent data have suggested that in Japanese individuals the opposite association between ACE genotype and muscle fibre type exists [36].

Type II fibres are more sensitive to both anabolic and catabolic stimuli than type I fibres [37, 38]. This higher sensitivity may contribute to the general loss of type II fibres that occurs in older individuals. However, this shift towards type I fibres is complicated by a shift in the opposite direction (increased proportion of type II fibres) that accompanies reduced physical activity and is seen in many patients with chronic disease [39].

It is therefore difficult to predict the effect of ACE genotype on the likelihood of sarcopenia as DD individuals may have started with a larger muscle mass and greater strength with a higher type II fibre composition that is more susceptible to loss. The effects of these polymorphisms may have contributed to the findings of the LACE study by affecting the muscle mass of individuals before the study or by modifying the response to therapy. In this study therefore, we analysed the genotypes of individuals with sarcopenia, enrolled into the LACE study to determine any association of ACE genotype with strength or muscle mass. We also determined the effect of genotype on the change in muscle mass, strength and physical performance 1 year later in those who completed the trial.

Materials and methods

Participants and physiological analysis

Individuals over the age of 70 with sarcopenia according to the EWGSOP definition (2010) [40] were recruited at 14 UK centres between April 2016 and December 2019 to a 2x2 factorial trial of leucine and/or ACE inhibition (trial registration ISRCTN90094835). Full recruitment criteria and methodology are described in [20]. The trial was performed in accordance with the ethical standards laid down in the 1964 Declaration of Helsinki and its later amendments and approved by the East of Scotland NHS research ethics committee (approval 14/ES/1099) and the UK Medicines and Healthcare Regulatory Authority (EudraCT number 2014-003455-61; Clinical Trial Authorisation number 36888/0001/001-0001). The study was a double-blind randomised controlled trial and sample preparation and analysis was carried out without any access to information that could identify the individuals involved. The trial protocol and primary outcomes have been published [20, 41]. The CONSORT diagram for the study with details of recruitment and dropout from the trial is published [20, 41]. Participants invited to attend for a screening visit had their age, weight and height measured and bioimpedance was used to measure overall muscle mass as part of the recruitment process. Bioimpedance was used at this stage to reduce the total number of DXA scans required. Individuals conforming to the EWGSOP guidelines as sarcopenic were recruited and attended a baseline visit. At this visit, their appendicular body composition (muscle mass, fat mass and bone mass) was determined by DXA and their physical performance measured. Physical performance measures were 6-minute walk distance (6MW) and short physical performance battery (SPPB), grip strength (measured using a hand-held Jamar dynamometer) and leg strength (Quadriceps Maximum Voluntary Contraction QMVC, measured as isometric voluntary knee extension with a Lafayette 01165 dynamometer Lafayette Instrument, Lafayette, IN, USA). Measurements were taken with the participant seated, the knee joint at 90 degrees, and with a non-elastic strap running between the chair and the ankle to restrain the dynamometer. The patients were randomised to placebo, leucine, perindopril or both leucine and perindopril at this baseline visit. Appendicular body composition and all physical performance measures were repeated 12 months later for those completing the trial. The LACE trial did not attempt to calibrate DXA readings between different sites or machines and this may have increased the noise inherent in the DXA results. However, each participant had their baseline and 12-month DXA scans performed on the same machine, removing this as a source of error from the longitudinal data. QMVC was divided by leg muscle mass to give a normalised quadriceps strength (kg/kg). Proportionate change was calculated as 12-month value/baseline value for each variable with longitudinal data.

The original study was powered to show difference in SPPB, but the study was terminated early due to poor recruitment. Of the 145 individuals recruited to the study 15 dropped out prior to a 3 month visit and their baseline samples were not retained for this study. All available samples were included in this analysis.

DNA analysis

Whole blood samples were taken at the first study visit and frozen. DNA was extracted using the QIAamp DNA blood mini kit according to the manufacturer’s instructions. DNA genotyping was performed by PCR using the primers ACE I/D-F CTGGAGACCACTCCCATCCTTTCT and ACE I/D-R GATGTGGCCATCACATTCGTCAGAT as described [42]. The reaction mix was made using HOTstarTaq DNA polymerase (Qiagen) included 2pmol of each primer. The samples were amplified for 40 cycles using a cycle of 95C for 1 min 58 C for 1 min and 72 C for 1 min in a VertiPro 96 well thermocycler. The PCR products were separated by agarose gel electrophoresis through a 1.5% agarose gel, stained with SYBRsafe and visualised on a GelDoc imager (Biorad). All available samples from the study were included.

Statistical analysis

The original study was a double-blind randomised controlled trial and sample preparation and analysis for this work was carried out without any access to information that could identify the individuals involved. Statistical analysis was performed in Aabel 3.0 and SPSS with the exception of the Chi squared test. Normality was determined by Shapiro-Wilk test, with differences between groups determined by Mann-Whitney U test for data that was not normal distributed and Student’s T-test for normally distributed data. Changes in strength at baseline and follow-up were determined by Wilcoxon matched-pairs signed rank test in Aabel 3.0. Values are given as median (interquartile range) for non-parametric data or as mean ± SD for normally distributed data. The threshold for statistical significance (alpha) was taken as 0.05. All available data was used for each comparison and no manipulations were performed to include missing values for individual tests. As the analysis here is exploratory, no corrections have been made for multiple testing. Reasons for loss to follow-up is detailed in [20, 41].

Results

All individuals enrolled into the LACE study were sarcopenic as defined by EWGSOP and the demographics of the cohort are given in Table 1. Therefore, to establish an allele frequency for the ACE genotype in the UK population, the genotypes of controls from 13 published studies with a UK only population were averaged [4355]. The ages of individuals and the study from which they are taken, and the details of the cohort used are given in S1 Table. This identified a total of 9909 genotypes (Table 2) and showed that the relative frequency of the alleles was I = 0.473 and D = 0.527. In the entire LACE cohort there was a significant over representation of the D allele (LACE population I = 0.411, D = 0.588, Chi2 = 3.97, p = 0.046). This difference was due to an excess of the D allele in the men but not the women (LACE men; I = 0.353, D = 0.647, Chi2 = 6.70, p = 0.010, LACE women; I = 0.458, D = 0.542, Chi2 = 0.14, p = 0.708, Table 2). Restricting the UK population to just men using the studies where sex and genotype were identifiable, gave a genotype frequency of I = 0.477, D = 0.523. However, this was from a smaller number of individuals (n = 710, II = 157, ID = 364, DD = 189) and the LACE male distribution was even further from the allele frequencies in this group than from the whole UK cohort (Chi2 = 7.10, p = 0.008). Restricting the UK cohort to those studies of individuals with an average age over 75 (II = 144, ID = 308, DD = 204) gave allele frequencies of I = 0.454, D = 0546. The men in the LACE cohort were still significantly different to this cohort (Chi2 = 4.85, p = 0.028).

Given the difference in body composition and strength between men and women, the sexes were analysed separately. Furthermore, due to the small number of II homozygous individuals, the cohort was analysed as those possessing the minor (I) allele and DD individuals. In women only, the I allele was associated with higher fat mass in the lower limbs but not with upper or lower limb muscle mass or strength (Table 3, Fig 1). This difference in fat mass was not seen at 12 months in the individuals who completed the trial.

thumbnail
Fig 1. Effect of ACE genotype on lower limb fat and muscle strength.

Limb composition was determined by DXA in 72 women and 58 men. The individuals were genotyped for the ACE I/D polymorphism and the effect of polymorphic variation on body composition and strength was determined. The II/ID genotypes were associated with a higher lower limb fat mass than the DD genotype in women but not in men (A). In men but not women, the II/ID genotypes were associated with greater quadriceps muscle strength than the DD genotype. (p Values calculated by Mann-Whitney U test).

https://doi.org/10.1371/journal.pone.0292402.g001

thumbnail
Table 3. Baseline body mass composition and muscle physiology in the different genotypes split by sex.

https://doi.org/10.1371/journal.pone.0292402.t003

In men, presence of the minor allele was associated with higher QMVC both as a raw value (II/ID median 18.0 kg IQR (14.5, 21.6) vs DD 13.2 kg (10.5, 15.9) p = 0.028 Fig 1, Table 3) and when normalised to leg muscle mass determined by DXA (II/ID 1.18 kg/kg (0.86,1.33) vs DD 0.78 kg/kg (0.63, 1.15) Table 3, p = 0.035). However, there was no difference in lower limb muscle mass between the genotypes. Using proportionate change in muscle strength over 12 months to allow the combination of both men and women showed that the DD genotype was associated with a greater average increase in muscle strength over the 12-month period (% change in QMVC: II/ID median = 3.8% (-21.1%- 30.6%), DD median = 20.8% (8.8%-66%), p = 0.032, Fig 2A). To confirm this analysis comparing QMVC at baseline and follow-up using a Wilcoxon matched-pairs signed rank test within the genotypes showed that the DD individuals increased in strength (baseline 10.8 kg (7.6, 15.8), vs 12 months 12.8 kg (10.5, 17.4), p = 0.003) over the period of the trial whereas the II/ID individuals did not (baseline 13.0 kg (8.1, 18.1), vs 12 months 12.2 kg (8.6, 17.8), p = 0.504, Fig 2B and 2C). However, there was no accompanying change in leg muscle mass (DD individuals; baseline 14.6 kg (11.5, 15.9) vs 12 months 14.3 kg (11.3, 15.4) p = 0.322, II/ID individuals; baseline 12.1 kg (10.4, 15.5) vs 12 months 12.5 kg (10.5, 15.9) p = 0.808).

thumbnail
Fig 2. Effect of genotype on change in strength over 12 months of the LACE trial.

Proportionate strength was determined by dividing MVC at month 12 by MVC at baseline allowing us to combine data from men and women in the study. (A) Individuals with the DD genotype had a higher proportionate strength at month 12 than individuals with the II/ID genotype (Mann-Whitney U test). (B and C) Comparison of the baseline and 12-month MVC showed that the DD individuals (B) increased in strength over the course of the trial (p = 0.003 Wilcoxon-signed rank test) whereas there was no change in strength in the II/ID individuals (C). There was no effect of perindopril on proportionate strength in either the DD or II/ID genotypes (D).

https://doi.org/10.1371/journal.pone.0292402.g002

To determine if the increase in muscle strength was a consequence of the treatment with perindopril, we compared QMVC at 0 and 12 months in II/ID and DD individuals who completed the study. This analysis showed that, consistent with the overall trial data, perindopril did not cause the increase in strength in the DD genotype individuals or the II/ID individuals as specified groups. Wilcoxon matched-pairs analysis showed that the DD individuals on perindopril did not increase their strength over 12 months (change in QMVC = 2.55 kg (-0.35, 4.15) p = 0.196) but those not on perindopril did (change in QMVC = 1.8 kg (1.2, 6.6), p = 0.008). However, strength did not increase in II/ID individuals whether on perindopril (change in QMVC = 1.45 kg (-2.3, 3.9), p = 0.247), or not (change in QMVC = -0.4 kg (-2.6, 3.3), p = 0.860). In the absence of perindopril, the increase in proportionate strength was larger in individuals with the DD than the II/ID genotype but there was no difference in the presence of perindopril (Fig 2, Table 4). No differences were seen in the change in QMVC between baseline and follow-up in either DD or II/ID genotypes in response to leucine.

thumbnail
Table 4. Effect of perindopril on muscle performance based on genotype.

https://doi.org/10.1371/journal.pone.0292402.t004

Finally, we compared the effect of perindopril on physical performance measured by the short physical performance battery (SPPB). In those with the II/ID genotype there was a median increase in SPPB of 1 point over the 12 months in the absence of perindopril but in the presence of perindopril median change in SPPB was 0 points (Table 4). In the DD genotype group, there was no change in SPPB at 12 months. Leucine had no effect on SPPB in either DD or II/ID genotypes.

Discussion

Our data show that, in the LACE cohort of sarcopenic individuals, the number of men carrying the I allele (II and ID combined) was lower than predicted from the general UK population. The I allele frequency in men in our study is 0.353 compared to the expected 0.474. Furthermore, we found that II/ID men had greater muscle strength than those with the DD genotype. This observation is opposite to the effects of the I/D polymorphism seen in the non-sarcopenic population where the D allele is found enriched in power athletes and is associated with greater muscle mass and strength in a number of diverse cohorts including those representing elite athletes, normal healthy individuals and patients with chronic obstructive pulmonary disease [2325]. The reduction in the number of men carrying the I allele could be explained by one of three main mechanisms, survivor bias, recruitment bias or a resistance to sarcopenia for individuals with at least one I allele. A survivor or recruitment bias due to II males having died or been too frail to participate is unlikely given the body of literature indicating the association of the D allele with both morbidity and mortality [5662]. However, although comparison with published UK studies where the individuals had average age over 75 did not affect our results, a recent meta-analysis of studies including centenarians, and older individuals as well as younger controls suggests a survivor advantage for DD individuals but not for ID individuals [63]. For this bias to account for our findings on the disproportionate number of DD men, the survivor effect would need to be greater and/or observed earlier in men as our observation of increased DD individuals was restricted to men. Given the size of our study this finding needs to be replicated in a larger study. It is also possible that recruitment bias occurred as a consequence of differences in the effects of EWGSOP algorithm in men and women. Rather, our finding would be consistent with II males being relatively resistant to sarcopenia, and therefore under-recruited. This possibility is consistent with the original hypothesis that lowering ACE activity would associate with increased muscle strength but if this was the major mechanism, it might be expected that further lowering ACE activity would have increased muscle strength and this did not happen. An alternative mechanism that could contribute to this resistance would be the higher type I fibre proportion associated with the I allele compared to D allele and the relative insensitivity of type I fibres to atrophy compared to type II fibres [35]. Therefore, individuals with the II genotype could start with a lower muscle mass and strength than their DD counterparts but be more likely to maintain muscle mass and strength and so less likely to become sarcopenic. The ability to maintain physical performance/endurance because of the greater proportion of type I fibres may also contribute to greater relative physical activity over time helping to maintain muscle mass. A reduced rate of muscle loss would also account for the reduced strength seen in the sarcopenic DD men compared to those carrying the I allele. Again, this reduced strength in DD men is counter to the situation in non-sarcopenic populations that have been studied which show higher strength in those with the DD genotype.

We did not observe either of these effects in women. Previous studies have shown that women have a higher proportion of type I fibres in the quadriceps compared to men [64, 65] suggesting that the effects of the II genotype may make a smaller difference to the overall proportion of fibres in women than in men. It is also possible that the effects of AII are enhanced by testosterone. For example, testosterone has been shown to contribute to the AII dependent increase in blood pressure in male rats [66], but any such cross talk in skeletal muscle remains to be established.

The LACE trial, from which these samples were taken, did not report any effect of perindopril on muscle mass or strength and a meta-analysis performed following the trial also concluded that ACE inhibition did not increase muscle mass or strength. In this analysis we show that there is no positive effect of ACE inhibition either in individuals with the II/ID genotypes or the DD genotypes although we did see an increase in muscle strength in DD individuals enrolled in the trial, whether or not they were on perindopril or leucine. The presence of this increase in strength may have been a consequence of a combination of the two agents that would have been identifiable had the trial been allowed to recruit its full cohort, a consequence of altered activity as a response to being recruited to a trial or potentially a type II error given the size of the trial. The reason that it is only observed in the DD group could suggest either that this group is most likely to respond to both activity and potentially to drug therapies due to a higher proportion of type II fibres or that as these individuals started with a lower QMVC there was a greater response to any increase in activity. Physical activity was not measured in this study. Whether trial recruitment acted as a trigger to increase activity would not have been detectable as it would not be possible to quantify pre-recruitment activity.

Consistent with a change in behaviour, individuals carrying the I allele showed an increase in SPPB by 1 point over the 12 months. Both changes (increased strength in DD individuals and increased SPPB in II/ID individuals) only occurred in the absence of perindopril. It is not clear why this change was restricted to those not on perindopril but given the drop-out rate was higher for those on perindopril than those not taking perindopril, it is possible that adverse responses to perindopril treatment reduced the effect of being recruited to a trial.

The LACE trial and a meta-analysis of available randomised controlled trials did not identify any effect of ACEi on muscle mass or strength (33), one possible reason for this is that the trial did not combine pharmacological treatment with exercise. In support of this possibility some studies have suggested that exercise responses are larger in patients taking ACEi than in those not taking ACEi [67] and some but not all animal studies have shown a that ACEi increases the gains from exercise [68, 69]. However, several randomised control trials of exercise have not found support for this proposal. Indeed, in patients with COPD combining ACEi with exercise reduced the efficacy of the exercise program (measured as peak work rate [16]) and in healthy volunteers, ACEi impaired lean muscle mass gain, reduced left atrial volume and reduced haemoglobin content [70]. Furthermore, in older individuals with functional impairment there was also no increased positive effect of ACEi with exercise [5]. The effects of genotype were not addressed in these studies, but the findings from our study would be most consistent with ACEi reducing any effect as the only improvements we saw (increase in SPPB in II/ID individuals and increase in strength in DD individuals) were in the group not taking perindopril.

Limitations of this study

This study is limited due to its very small sample size and therefore requires repeating in a larger study. The trial also only recruited individuals with sarcopenia making us reliant on allele frequencies from previous studies rather than a control cohort recruited at the same time and from the same communities. To overcome this latter problem, we identified studies with control cohorts of UK individuals to calculate an allele frequency that was representative of the general UK population. Furthermore, as the group sizes are small and the study was a 2x2 factorial trial it is possible that there was an effect of perindopril on strength in the II/ID group, but this is too small to detect in this study and is complicated either by the treatment with leucine or that inclusion in the trial leads to altered physical activity.

In conclusion our analysis suggests that sarcopenic men with the DD ACE genotype may be weaker than men with at least one I allele. We speculate that this is due to differences in the fibre types that have been shown to occur with the differences in genotype and the higher sensitivity of type II fibres to atrophy than type I fibres. The data imply that genotype does not account for the lack of effect of perindopril that we observed in the LACE trial. However, if the basis of the effects of ACE genotype is due to long-term effects of lower ACE levels on fibre type, it is possible that one year of treatment is not sufficient to alter the fibre proportions sufficiently to reduce the loss of strength. It is also possible that the number of type II fibres has been reduced to such an extent that fibre shift is no longer a viable route to increase muscle function.

Supporting information

S1 Checklist. STROBE statement—Checklist of items that should be included in reports of observational studies.

https://doi.org/10.1371/journal.pone.0292402.s001

(DOCX)

Acknowledgments

The authors would also thank the efforts of all the research nurses and other site research staff who recruited participants to the trial, all the participants, and all the staff of the Tayside Clinical Trials Unit for their support of the trial.

References

  1. 1. Melton LJ 3rd, Khosla , Crowson CS, O’Connor MK, O’Fallon WM, Riggs BL. Epidemiology of sarcopenia. J Am Geriatr Soc. 2000;48(6):625–30. pmid:10855597
  2. 2. Cruz-Jentoft AJ, Sayer AA. Sarcopenia. Lancet. 2019;393(10191):2636–46. pmid:31171417
  3. 3. Han A, Bokshan SL, Marcaccio SE, DePasse JM, Daniels AH. Diagnostic Criteria and Clinical Outcomes in Sarcopenia Research: A Literature Review. J Clin Med. 2018;7(4):70. pmid:29642478
  4. 4. Shrikrishna D, Tanner RJ, Lee JY, Natanek A, Lewis A, Murphy PB, et al. A randomized controlled trial of angiotensin-converting enzyme inhibition for skeletal muscle dysfunction in COPD. Chest. 2014;146(4):932–40. pmid:24556825
  5. 5. Sumukadas D, Band M, Miller S, Cvoro V, Witham M, Struthers A, et al. Do ACE inhibitors improve the response to exercise training in functionally impaired older adults? A randomized controlled trial. J Gerontol A Biol Sci Med Sci. 2014;69(6):736–43. pmid:24201696
  6. 6. Sumukadas D, Witham MD, Struthers AD, McMurdo ME. Ace inhibitors as a therapy for sarcopenia—evidence and possible mechanisms. J Nutr Health Aging. 2008;12(7):480–5. pmid:18615230
  7. 7. Harper SA, Baptista LC, Roberts LM, Wherry SJ, Boxer RS, Hildreth KL, et al. Angiotensin Converting Enzyme Inhibitors Combined with Exercise for Hypertensive Seniors (The ACES Trial): Study Protocol of a Randomized Controlled Trial. Front Med (Lausanne). 2019;6:327. pmid:32039215
  8. 8. Kostka J, Sikora J, Guligowska A, Kostka T. Quadriceps muscle power and optimal shortening velocity are inversely related to angiotensin converting enzyme activity in older men. F1000Res. 2021;10:184. pmid:34354813
  9. 9. Du Bois P, Pablo Tortola C, Lodka D, Kny M, Schmidt F, Song K, et al. Angiotensin II Induces Skeletal Muscle Atrophy by Activating TFEB-Mediated MuRF1 Expression. Circ Res. 2015;117(5):424–36. pmid:26137861
  10. 10. Brink M, Price SR, Chrast J, Bailey JL, Anwar A, Mitch WE, et al. Angiotensin II induces skeletal muscle wasting through enhanced protein degradation and down-regulates autocrine insulin-like growth factor I. Endocrinology. 2001;142(4):1489–96. pmid:11250929
  11. 11. Silva KAS, Ghiarone T, Schreiber K, Grant D, White T, Frisard MI, et al. Angiotensin II suppresses autophagy and disrupts ultrastructural morphology and function of mitochondria in mouse skeletal muscle. J Appl Physiol (1985). 2019;126(6):1550–62. pmid:30946636
  12. 12. Vescovo G, Dalla Libera L, Serafini F, Leprotti C, Facchin L, Volterrani M, et al. Improved exercise tolerance after losartan and enalapril in heart failure: correlation with changes in skeletal muscle myosin heavy chain composition. Circulation. 1998;98(17):1742–9. pmid:9788828
  13. 13. Bea JW, Wassertheil-Smoller S, Wertheim BC, Klimentidis Y, Chen Z, Zaslavsky O, et al. Associations between ACE-Inhibitors, Angiotensin Receptor Blockers, and Lean Body Mass in Community Dwelling Older Women. J Aging Res. 2018;2018:8491092. pmid:29670769
  14. 14. Ng TP, Nguyen TN, Gao Q, Nyunt MSZ, Wee S-L. Angiotensin receptor blockers use and changes in frailty, muscle mass, and function indexes: Singapore Longitudinal Ageing Study. JCSM rapid communications. 2021;4:111–21.
  15. 15. Kon SS, Jolley CJ, Shrikrishna D, Montgomery HE, Skipworth JR, Puthucheary Z, et al. ACE and response to pulmonary rehabilitation in COPD: two observational studies. BMJ Open Respir Res. 2017;4(1):e000165. pmid:28321311
  16. 16. Curtis KJ, Meyrick VM, Mehta B, Haji GS, Li K, Montgomery H, et al. Angiotensin-Converting Enzyme Inhibition as an Adjunct to Pulmonary Rehabilitation in Chronic Obstructive Pulmonary Disease. Am J Respir Crit Care Med. 2016;194(11):1349–57. pmid:27248440
  17. 17. Mile M, Balogh L, Papp G, Pucsok JM, Szabo K, Barna L, et al. Effects of Functional Training on Sarcopenia in Elderly Women in the Presence or Absence of ACE Inhibitors. Int J Environ Res Public Health. 2021;18(12):6594. pmid:34205250
  18. 18. Sumukadas D, Witham MD, Struthers AD, McMurdo ME. Effect of perindopril on physical function in elderly people with functional impairment: a randomized controlled trial. CMAJ. 2007;177(8):867–74. pmid:17923654
  19. 19. Bunout D, Barrera G, de la Maza MP, Leiva L, Backhouse C, Hirsch S. Effects of enalapril or nifedipine on muscle strength or functional capacity in elderly subjects. A double blind trial. J Renin Angiotensin Aldosterone Syst. 2009;10(2):77–84. pmid:19502254
  20. 20. Achison M, Adamson S, Akpan A, Aspray T, Avenell A, Band MM, et al. Effect of perindopril or leucine on physical performance in older people with sarcopenia: the LACE randomized controlled trial. J Cachexia Sarcopenia Muscle. 2022;13:858–71. pmid:35174663
  21. 21. Witham MD, Achison M, Aspray TJ, Avenell A, Band MM, Donnan PT, et al. Recruitment strategies for sarcopenia trials: lessons from the LACE randomized controlled trial. JCSM rapid communications. 2021;4(2):93–102.
  22. 22. Banhegyi V, Enyedi A, Fulop GA, Olah A, Siket IM, Varadi C, et al. Human Tissue Angiotensin Converting Enzyme (ACE) Activity Is Regulated by Genetic Polymorphisms, Posttranslational Modifications, Endogenous Inhibitors and Secretion in the Serum, Lungs and Heart. Cells. 2021;10(7):1708. pmid:34359878
  23. 23. Melian Ortiz A, Laguarta-Val S, Varillas-Delgado D. Muscle Work and Its Relationship with ACE and ACTN3 Polymorphisms Are Associated with the Improvement of Explosive Strength. Genes (Basel). 2021;12(8):1177. pmid:34440352
  24. 24. Folland J, Leach B, Little T, Hawker K, Myerson S, Montgomery H, et al. Angiotensin-converting enzyme genotype affects the response of human skeletal muscle to functional overload. Exp Physiol. 2000;85(5):575–9. pmid:11038409
  25. 25. Hopkinson NS, Nickol AH, Payne J, Hawe E, Man WD, Moxham J, et al. Angiotensin converting enzyme genotype and strength in chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 2004;170(4):395–9. pmid:15117739
  26. 26. Ipekoglu G, Bulbul A, Cakir HI. A meta-analysis on the association of ACE and PPARA gene variants and endurance athletic status. J Sports Med Phys Fitness. 2022;62(6):795–802. pmid:34028240
  27. 27. McAuley ABT, Hughes DC, Tsaprouni LG, Varley I, Suraci B, Roos TR, et al. The association of the ACTN3 R577X and ACE I/D polymorphisms with athlete status in football: a systematic review and meta-analysis. J Sports Sci. 2021;39(2):200–11. pmid:32856541
  28. 28. Kim CH, Cho JY, Jeon JY, Koh YG, Kim YM, Kim HJ, et al. ACE DD genotype is unfavorable to Korean short-term muscle power athletes. Int J Sports Med. 2010;31(1):65–71. pmid:20029740
  29. 29. Kang HJ, Kim CH, Park DS, Choi SY, Lee DH, Nam HS, et al. The Impacts of ACE Activity according to ACE I/D Polymorphisms on Muscular Functions of People Aged 65. Ann Rehabil Med. 2012;36(4):433–46. pmid:22977768
  30. 30. Handayani MDN, Sadewa AH, Farmawati A, Rochmah W. Deletion Polymorphism of Angiotensin-Converting Enzyme Gene Is Associated with Low Muscle Mass in Elderly People in Jakarta, Indonesia. Kobe J Med Sci. 2018;64(3):E119–E25. pmid:30666042
  31. 31. Garatachea N, Fiuza-Luces C, Torres-Luque G, Yvert T, Santiago C, Gomez-Gallego F, et al. Single and combined influence of ACE and ACTN3 genotypes on muscle phenotypes in octogenarians. Eur J Appl Physiol. 2012;112(7):2409–20. pmid:22045415
  32. 32. Kritchevsky SB, Nicklas BJ, Visser M, Simonsick EM, Newman AB, Harris TB, et al. Angiotensin-converting enzyme insertion/deletion genotype, exercise, and physical decline. JAMA. 2005;294(6):691–8. pmid:16091571
  33. 33. Shuler K, Sucic JF, Talley SA, Goldberg A. Angiotensin-Converting Enzyme Insertion/Deletion Polymorphism, Lower Extremity Strength, and Physical Performance in Older Adults. Phys Ther. 2019;99(8):998–1009. pmid:31087072
  34. 34. Romero-Blanco C, Artiga-Gonzalez MJ, Gomez-Cabello A, Vila-Maldonado S, Casajus JA, Ara I, et al. Strength and Endurance Training in Older Women in Relation to ACTN3 R577X and ACE I/D Polymorphisms. Int J Environ Res Public Health. 2020;17(4):1236. pmid:32075076
  35. 35. Zhang B, Tanaka H, Shono N, Miura S, Kiyonaga A, Shindo M, et al. The I allele of the angiotensin-converting enzyme gene is associated with an increased percentage of slow-twitch type I fibers in human skeletal muscle. Clin Genet. 2003;63(2):139–44. pmid:12630962
  36. 36. Kumagai H, Tobina T, Ichinoseki-Sekine N, Kakigi R, Tsuzuki T, Zempo H, et al. Role of selected polymorphisms in determining muscle fiber composition in Japanese men and women. J Appl Physiol (1985). 2018;124(5):1377–84. pmid:29345962
  37. 37. Adams GR, Bamman MM. Characterization and regulation of mechanical loading-induced compensatory muscle hypertrophy. Compr Physiol. 2012;2(4):2829–70. pmid:23720267
  38. 38. Vikne H, Strom V, Pripp AH, Gjovaag T. Human skeletal muscle fiber type percentage and area after reduced muscle use: A systematic review and meta-analysis. Scand J Med Sci Sports. 2020;30(8):1298–317. pmid:32281690
  39. 39. Natanek SA, Gosker HR, Slot IG, Marsh GS, Hopkinson NS, Man WD, et al. Heterogeneity of quadriceps muscle phenotype in chronic obstructive pulmonary disease (Copd); implications for stratified medicine? Muscle Nerve. 2013;48(4):488–97. pmid:23553751
  40. 40. Cruz-Jentoft AJ, Baeyens JP, Bauer JM, Boirie Y, Cederholm T, Landi F, et al. Sarcopenia: European consensus on definition and diagnosis: Report of the European Working Group on Sarcopenia in Older People. Age Ageing. 2010;39(4):412–23. pmid:20392703
  41. 41. Band MM, Sumukadas D, Struthers AD, Avenell A, Donnan PT, Kemp PR, et al. Leucine and ACE inhibitors as therapies for sarcopenia (LACE trial): study protocol for a randomised controlled trial. Trials. 2018;19(1):6. pmid:29301558
  42. 42. Rigat B, Hubert C, Corvol P, Soubrier F. PCR detection of the insertion/deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1). Nucleic Acids Res. 1992;20(6):1433. pmid:1313972
  43. 43. Kehoe PG, Russ C, McIlory S, Williams H, Holmans P, Holmes C, et al. Variation in DCP1, encoding ACE, is associated with susceptibility to Alzheimer disease. Nat Genet. 1999;21(1):71–2. pmid:9916793
  44. 44. Sagnella GA, Rothwell MJ, Onipinla AK, Wicks PD, Cook DG, Cappuccio FP. A population study of ethnic variations in the angiotensin-converting enzyme I/D polymorphism: relationships with gender, hypertension and impaired glucose metabolism. J Hypertens. 1999;17(5):657–64. pmid:10403609
  45. 45. Steeds RP, Wardle A, Smith PD, Martin D, Channer KS, Samani NJ. Analysis of the postulated interaction between the angiotensin II sub-type 1 receptor gene A1166C polymorphism and the insertion/deletion polymorphism of the angiotensin converting enzyme gene on risk of myocardial infarction. Atherosclerosis. 2001;154(1):123–8. pmid:11137090
  46. 46. Narain Y, Yip A, Murphy T, Brayne C, Easton D, Evans JG, et al. The ACE gene and Alzheimer’s disease susceptibility. J Med Genet. 2000;37(9):695–7. pmid:10978362
  47. 47. Montgomery HE, Clarkson P, Dollery CM, Prasad K, Losi MA, Hemingway H, et al. Association of angiotensin-converting enzyme gene I/D polymorphism with change in left ventricular mass in response to physical training. Circulation. 1997;96(3):741–7. pmid:9264477
  48. 48. Kee F, Morrison C, Poirier O, McCrum E, Mallet C, Nicaud V, et al. Angiotensin II type-I receptor and ACE polymorphisms and risk of myocardial infarction in men and women. Eur J Clin Invest. 2000;30(12):1076–82. pmid:11122322
  49. 49. Missouris CG, Barley J, Jeffery S, Carter ND, Singer DR, MacGregor GA. Genetic risk for renal artery stenosis: association with deletion polymorphism in angiotensin 1-converting enzyme gene. Kidney Int. 1996;49(2):534–7. pmid:8821841
  50. 50. Markus HS, Barley J, Lunt R, Bland JM, Jeffery S, Carter ND, et al. Angiotensin-converting enzyme gene deletion polymorphism. A new risk factor for lacunar stroke but not carotid atheroma. Stroke. 1995;26(8):1329–33. pmid:7631331
  51. 51. Samani NJ, O’Toole L, Martin D, Rai H, Fletcher S, Lodwick D, et al. Insertion/deletion polymorphism in the angiotensin-converting enzyme gene and risk of and prognosis after myocardial infarction. J Am Coll Cardiol. 1996;28(2):338–44. pmid:8800107
  52. 52. Keavney B, McKenzie C, Parish S, Palmer A, Clark S, Youngman L, et al. Large-scale test of hypothesised associations between the angiotensin-converting-enzyme insertion/deletion polymorphism and myocardial infarction in about 5000 cases and 6000 controls. International Studies of Infarct Survival (ISIS) Collaborators. Lancet. 2000;355(9202):434–42. pmid:10841123
  53. 53. Barley J, Blackwood A, Sagnella G, Markandu N, MacGregor G, Carter N. Angiotensinogen Met235—>Thr polymorphism in a London normotensive and hypertensive black and white population. J Hum Hypertens. 1994;8(8):639–40.
  54. 54. Ueda S, Weir CJ, Inglis GC, Murray GD, Muir KW, Lees KR. Lack of association between angiotensin converting enzyme gene insertion/deletion polymorphism and stroke. J Hypertens. 1995;13(12 Pt 2):1597–601. pmid:8903617
  55. 55. Catto A, Carter AM, Barrett JH, Stickland M, Bamford J, Davies JA, et al. Angiotensin-converting enzyme insertion/deletion polymorphism and cerebrovascular disease. Stroke. 1996;27(3):435–40. pmid:8610309
  56. 56. Adamzik M, Frey U, Sixt S, Knemeyer L, Beiderlinden M, Peters J, et al. ACE I/D but not AGT (-6)A/G polymorphism is a risk factor for mortality in ARDS. Eur Respir J. 2007;29(3):482–8. pmid:17107992
  57. 57. Sayed-Tabatabaei FA, Schut AF, Arias Vasquez A, Bertoli-Avella AM, Hofman A, Witteman JC, et al. Angiotensin converting enzyme gene polymorphism and cardiovascular morbidity and mortality: the Rotterdam Study. J Med Genet. 2005;42(1):26–30. pmid:15635071
  58. 58. Bleumink GS, Schut AF, Sturkenboom MC, van Duijn CM, Deckers JW, Hofman A, et al. Mortality in patients with hypertension on angiotensin-I converting enzyme (ACE)-inhibitor treatment is influenced by the ACE insertion/deletion polymorphism. Pharmacogenet Genomics. 2005;15(2):75–81. pmid:15861031
  59. 59. Forero DA, Pinzon J, Arboleda GH, Yunis JJ, Alvarez C, Catano N, et al. Analysis of common polymorphisms in angiotensin-converting enzyme and apolipoprotein e genes and human longevity in Colombia. Arch Med Res. 2006;37(7):890–4. pmid:16971231
  60. 60. Fiuza-Luces C, Ruiz JR, Rodriguez-Romo G, Santiago C, Gomez-Gallego F, Cano-Nieto A, et al. Is the ACE I/D polymorphism associated with extreme longevity? A study on a Spanish cohort. J Renin Angiotensin Aldosterone Syst. 2011;12(3):202–7. pmid:21330423
  61. 61. Pati A, Mahto H, Padhi S, Panda AK. ACE deletion allele is associated with susceptibility to SARS-CoV-2 infection and mortality rate: An epidemiological study in the Asian population. Clin Chim Acta. 2020;510:455–8. pmid:32791137
  62. 62. Vladeanu MC, Bojan IB, Bojan A, Iliescu D, Badescu MC, Badulescu OV, et al. Angiotensin-converting enzyme gene D-allele and the severity of coronary artery disease. Exp Ther Med. 2020;20(4):3407–11. pmid:32905120
  63. 63. Li L, Murakami S. Artificial intelligence-assisted meta-analysis of the frequency of ACE I/D polymorphisms in centenarians and other long-lived individuals. medRxiv. 2022;doi: 10.1101/2022.12.10.22283306.
  64. 64. Sharanya A, Ciano M, Withana S, Kemp PR, Polkey MI, Sathyapala SA. Sex differences in COPD-related quadriceps muscle dysfunction and fibre abnormalities. Chron Respir Dis. 2019;16:1479973119843650. pmid:31131626
  65. 65. Haizlip KM, Harrison BC, Leinwand LA. Sex-based differences in skeletal muscle kinetics and fiber-type composition. Physiology (Bethesda). 2015;30(1):30–9. pmid:25559153
  66. 66. Mishra JS, More AS, Gopalakrishnan K, Kumar S. Testosterone plays a permissive role in angiotensin II-induced hypertension and cardiac hypertrophy in male rats. Biol Reprod. 2019;100(1):139–48. pmid:30102356
  67. 67. Baptista LC, Machado-Rodrigues AM, Verissimo MT, Martins RA. Exercise training improves functional status in hypertensive older adults under angiotensin converting enzymes inhibitors medication. Exp Gerontol. 2018;109:82–9. pmid:28645696
  68. 68. Habouzit E, Richard H, Sanchez H, Koulmann N, Serrurier B, Monnet R, et al. Decreased muscle ACE activity enhances functional response to endurance training in rats, without change in muscle oxidative capacity or contractile phenotype. J Appl Physiol (1985). 2009;107(1):346–53. pmid:19407247
  69. 69. Yang Y, Banerjee A, Sun Y, Carter CS, Buford TW. Interactive Effects of Enalapril Administration and Novel HIIT Wheel-Bed Training in Aged Rats. Front Rehabil Sci. 2021;2. pmid:34901931
  70. 70. Sjuretharson T, Bejder J, Breenfeldt Andersen A, Bonne T, Kyhl K, Roin T, et al. Effect of angiotensin-converting enzyme inhibition on cardiovascular adaptation to exercise training. Physiol Rep. 2022;10(13):e15382. pmid:35822425