Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Angiotensin-Converting Enzyme (ACE) gene polymorphism and arterial blood pressure among the Tawang Monpa of Eastern Himalayan Mountains: Is there a signature of natural selection?

  • Sudipta Ghosh

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    ghosh.sudiptaa@gmail.com

    Affiliation Department of Anthropology, North-Eastern Hill University, Shillong, Meghalaya, India

    ⨯

Abstract

Objectives

The present paper aims to characterize the Angiotensin-converting enzyme (ACE) genotype, with particular emphasis on its association with arterial oxygen saturation, arterial blood pressure, hemoglobin [Hb] concentration, and ventilatory measures among the Tawang Monpa, a high-altitude native population of the Eastern Himalaya, India.

Methods

A cross-sectional sample of 168Monpa participants from Tawang town, Arunachal Pradesh, India, was selected who live at an altitude of ∼3,200 meters (m) above sea level. For each participant, height, weight, and skinfold thickness were measured, based on which body mass index (BMI, kg/m2) and percentage of body fat (%BF) were calculated. Physiological measures, such as the transcutaneous arterial oxygen saturation (SaO2), hemoglobin [Hb] concentration, forced vital capacity (FVC), forced expiratory volume in 1-second (FEV1), and systemic arterial blood pressure were measured. First, the peripheral venous blood samples (four ml) were drawn, and then white blood cells were separated for the ACE genotyping of each participant.

Results

Unlike high-altitude natives from Peru and Ladakh, who exhibit high frequencies of II homozygotes, the Tawang Monpa shows a significantly high frequency of ID heterozygotes (p<0.0001). In addition, no significant association was identified between ACE gene polymorphism and arterial blood pressure, oxygen saturation at rest, vital capacity, or [Hb] concentration.

Discussion

The results suggest that the association of the ACE gene with resting SaO2 is inconsistent across native populations living under hypobaric hypoxia. Further, ACE I/D gene polymorphism may not be under natural selection in specific native populations, including Tawang Monpa, for their adaptation to high-altitude hypoxia.

Citation: Ghosh S (2023) Angiotensin-Converting Enzyme (ACE) gene polymorphism and arterial blood pressure among the Tawang Monpa of Eastern Himalayan Mountains: Is there a signature of natural selection? PLoS ONE 18(9): e0291810. https://doi.org/10.1371/journal.pone.0291810

Editor: Esteban Ortiz-Prado, Universidad de Las Americas, Quito-Ecuador, ECUADOR

Received: May 24, 2023; Accepted: September 5, 2023; Published: September 21, 2023

Copyright: © 2023 Sudipta Ghosh. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the paper and its Supporting Information files.

Funding: The author(s) received no specific funding for this work.

Competing interests: The authors have declared that no competing interests exist.

Introduction

The angiotensin-converting enzyme (ACE) gene encodes for an enzyme found in the endothelial cells of arterial blood vessels. ACE is a vital component of the Renin-Angiotensin System (RAS), which plays an essential role in cardiovascular homeostasis. ACE helps produce angiotensin II and the degradation of Bradykinin-like vasodilator. Angiotensin II is a vasoconstrictor, which constricts arterial blood vessels and stimulates the adrenal cortex to release aldosterone that activates the RAS. Variation in ACE accounts for approximately half of the variance in ACE plasma levels [1, 2]. In particular, an insertion/deletion (I/D) polymorphism in intron 16 plays a vital role in RAS physiological pathways [3]. Interestingly, homozygotes of the deletion (D) allele exhibit significantly higher serum angiotensin-converting enzyme levels than the insertion (I) allele homozygotes [1].

In high-altitude adaptation studies, the RAS has been considered one of the most essential physiological pathways to overcome hypobaric hypoxia [4–6]. Both systemic and tissue-specific RAS up-regulation in chronic hypoxia occurs through the activation of RAS genes, including ACE [7], whose up-regulation leads to the increased production of plasma angiotensin II. Angiotensin II then stimulates cardio-respiratory functions and plays a crucial role in fluid and electrolyte homeostasis through modulation of carotid body chemoreceptor activity and its central transduction [7]. The ACE I/D gene polymorphism has been suggested as a crucial factor in altitude adaptation and acclimatization, given the effect of the -I allele on serum ACE activity [3]. This adaptive function of low serum ACE is mediated through ACE’s effects on the vascular remodeling responses to hypoxia with subsequent improvements in arterial oxygen saturation (SaO2). For example, the hemodynamic consequences of ACE inhibition show beneficial effects on cardiac remodeling in heart failure [8]. More specifically, chronic changes in hemodynamic forces can result in structural alterations of the vessel wall through wall diameter and thickness changes. Studies suggest that hemodynamic forces do not solely determine changes in vascular structure and can also be aggravated by inflammatory responses. Such structural changes of the medial layer of the vascular wall during hypertension are generally termed ‘remodeling,’ which can subsequently lead to other vascular pathologies, including hypertension and atherosclerosis [9]. It has also been observed that patients with essential hypertension are treated with ACE inhibitors because of their effect on vascular remodeling responses [9].

The role of ACE inhibitors in human adaptation to hypobaric hypoxia still needs to be understood completely. In this regard, previous studies have reported an overrepresentation of -I allele in general and II homozygotes in particular among high-altitude native populations, including Peruvian Quechua and Indian Ladakhis [6, 3, 10, 11]. The probable adaptive advantage of the II homozygotes is that the -I/I genotype maintains higher SaO2 at high altitudes [10, 12]. However, studies in various ethnic groups have shown conflicting evidence of such associations between ACE I/D gene polymorphism and SaO2 [12]. Hence, such association studies from other high-altitude native populations can provide a better and more conclusive understanding of the role of ACE gene polymorphism in human adaptation to high-altitude hypoxia. Specifically, the association of ACE gene polymorphism with different physiological attributes is inconsistent across human populations (Fig 1).

thumbnail
Download:
Fig 1. ACE gene polymorphism and its association with physiological attributes in human.

https://doi.org/10.1371/journal.pone.0291810.g001

Furthermore, evidence suggests that the -I allele, particularly the I/I genotype, can have detrimental effects at high altitudes. Studies conducted among Kyrgyz and Tibetan highlanders have revealed adverse health effects of both the -I and -D alleles at high altitudes. Kyrgyz highlanders with high-altitude pulmonary hypertension (HAPH) display a threefold higher frequency of the I/I genotype than normotensive controls [13]. In addition, the I/I genotype showed significantly greater mean pulmonary artery pressure (MPAP) than the I/D or D/D genotypes [13]. Among Tibetans, the ACE-D allele is significantly associated with chronic mountain sickness (CMS) [14] and arterial hypertension only among Tibetan women [2]. Altogether, these results suggest that the adaptive role of the -I allele at high altitudes might not follow a universal adaptive mechanism pathway.

Against this backdrop, the present paper aimed to answer whether the overrepresentation of the-I allele at high altitude is reproducible in other high altitude native populations and hence a universal phenomenon or limited to few native populations and thus population specific. Moreover, the association between the -I allele and SaO2 at high altitudes remains to be determined. To answer these questions, the present paper examined the association of ACE I/D gene polymorphism with arterial oxygen saturation at rest, systemic arterial blood pressure, hemoglobin concentration [Hb], and ventilatory measures among the Tawang Monpa, a high-altitude Tibetan-derived population of the Eastern Himalayan Mountains of Arunachal Pradesh, India.

Materials and methods

Study participants

A cross-sectional sample of 168 Tawang Monpa (80 males and 88 females) inhabiting the easternmost part of the Himalayan Mountains was recruited in Tawang Town, India, at an altitude of ∼3,200 meters (m) above sea level. Study participants who self-identified as Monpa were recruited during June-July 2016. Tawang Monpa ancestry in the region is dated to ∼1,000 years before the present, following a migration from Southern Tibet [15]. Participants were healthy, non-smokers between 18 and 35 years old born and raised above 3,000 m above sea level. Study participants provided written, informed consent according to the guidelines established by the North-Eastern Hill University (NEHU) institutional review board, Meghalaya, India.

Phenotypic measurements

For each participant, height, weight, and skinfold measurements were taken, which was followed by the calculation of body mass index (BMI, kg/m2) and percentage of body fat (%BF) [16]. Transcutaneous arterial oxygen saturation (SaO2) was measured at rest using a fingertip pulse oximeter (CMS50EW, Neclife, India). Hemoglobin [Hb] concentration was measured from a fingertip blood drop using a Hemocue portable hemoglobin analyzer (Hemocue®Angelholm, Sweden). Forced vital capacity (FVC) and forced expiratory volume in 1-second (FEV1) were measured on each participant following standard protocols, details given elsewhere [17]. Spirometry was conducted using a portable spirometer (Care Fusion Micro I Diagnostic Spirometer, USA).

Two consecutive readings of systolic blood pressure (SBP) and diastolic blood pressure (DBP) were taken on each participant using a sphygmomanometer and a stethoscope following a 10-minute rest in the seated position. Average measurement was used in the analysis. Blood pressure measurement was classified as normal ≤120/80 mmHg; high normal 121-139/81-89 mmHg, and hypertension ≥140/90 mmHg, according to the American Heart Association (2005) guidelines [18]. Mean arterial pressure (MAP) was calculated using the following formula: MAP = DBP + [0.333 (SBP–DBP)].

DNA extraction and genotyping

Peripheral venous blood samples (four ml) were drawn, and white blood cells were separated. High-molecular-weight DNA was isolated from the peripheral blood leukocytes using the Phenol-Chloroform DNA extraction method [19]. The ACE in/del allele was amplified by polymerase chain reaction (PCR) [20] using two primers, F: 5ʹ 3ʹ CTGGAGACCACTCCCATCCTTTCT and R: 5ʹ 3ʹ GATGTGGCCATCACA TTCGTCAGAT. Genotyping was conducted by 2% agarose gel electrophoresis and visualized with ethidium bromide staining.

Statistical analysis

All statistical analyses were performed using SPSS version 24.0 (SPSS Inc., Chicago, IL, USA) and STATA 11.1 (Stata Corp LP, Texas, USA). Anthropometric and physiological variations within the population were assessed by analysis of variance (ANOVA). Intra-population variation in ACE genotype and I/D allele frequencies were calculated through chi-square distribution. More specifically, the frequency distributions of Monpa males and females falling under the I/I, I/D, and D/D genotypes were calculated and compared statistically using the Pearson Chi-square test. The frequency distributions of–I and–D alleles were calculated and then compared with the help of the Pearson Chi-square test. The genotype-phenotype association was assessed by calculating genotype differences for all the measured variables using multivariate analysis of covariance (ANCOVA) after controlling for age and sex.

Results

Anthropometric, physiological, and genotypic characteristics

Statistically significant sex differences in all anthropometric and physiological variables except BMI and SaO2were observed (Table 1). Although BMI was similar between males and females, %BF was significantly (p<0.001) greater in females. This result suggests that Monpa females have greater fat mass (FM) in subcutaneous and abdominal/visceral fat than males, who have higher fat-free mass (FFM). SBP, DBP, and MAP were significantly (p<0.001) higher in males than their female counterparts. Genotype data was obtained from 168 participants, which was comprised of 80 males and 88 females. Allele and genotype frequencies are shown in Table 2. The genotype frequency of I/D heterozygote (0.48) was significantly higher (Chi-square = 16.75; p<0.001) than the genotype frequencies of both I/I (0.26; p<0.001) and D/D (0.26; p<0.001) homozygotes (Table 2). The allele frequencies of the -I and -D alleles were identical (0.50; p>0.05).

thumbnail
Download:
Table 1. Descriptive statistics and comparative differences in body composition and physiological variables between the Monpa males and females.

https://doi.org/10.1371/journal.pone.0291810.t001

thumbnail
Download:
Table 2. Genotype and allele frequencies of ACE I/D gene polymorphism among Monpa, by sex.

https://doi.org/10.1371/journal.pone.0291810.t002

Associations between ACE gene polymorphism and physiological characteristics

No significant difference (p>0.05) among I/I, I/D, and D/D genotypes was observed for SBP, DBP, MAP, or SaO2 (Table 3). D/D homozygotes have shown marginally higher (p>0.05) [Hb] concentration and FVC than both the I/I and I/D genotypes. The distributions of I/I, I/D, and D/D individuals, according to their blood pressure status (normal vs. high normal vs. hypertension), are presented in Fig 2. No statistically significant difference (p>0.05) between I/I, I/D, and D/D participants in respect of their blood pressure status was found (Table 4). Even though the proportion of I and D alleles according to their blood pressure status indicates higher frequencies of the D allele in the ‘hypertension’ category (Table 4), the differences are not statistically significant (p>0.05; Fig 2).

thumbnail
Download:
Fig 2. ACE I/D genotypes distribution according to the blood pressure categories among the Tawang Monpa.

https://doi.org/10.1371/journal.pone.0291810.g002

thumbnail
Download:
Table 3. Estimated marginal means (Mean±SE) of physiological characteristics of adult Monpa by their ACE Gene Polymorphisms, while controlling for age and sex.

https://doi.org/10.1371/journal.pone.0291810.t003

thumbnail
Download:
Table 4. Distribution of blood pressure levels in adult Monpa, by ACE genotypes and alleles.

https://doi.org/10.1371/journal.pone.0291810.t004

Discussion

The evolutionary significance of sex differences in anthropometric and physiological measures is still unclear, as the trend is not comparable across human populations. However, in line with the present study, sex differences in physiological attributes were also reported in previous studies [17, 21–23].

The gene for human ACE is an autosomal gene located on chromosome 17. Thus, as expected, no sex difference was observed in ACE gene polymorphism in Tawang Monpa, as reported in other high-altitude populations [10]. Such results are significant from an evolutionary viewpoint to understand the role of gender equality in human genetic adaptation to hypobaric hypoxia. Several studies have highlighted the crucial role of ACEI/D gene polymorphism in high-altitude adaptation. The association of the -I allele with oxygen saturation in high-altitude adaptation and its overrepresentation among the high-altitude native populations have been well documented. The present study has revealed that both -I and -D alleles have equivalent frequencies among the Tawang Monpa, in line with previous findings among Tibetan [2] and Kyrgyz highlanders [24] but contrary to the reporting on other high-altitude populations like Sherpa [25], Ladakhi [6], and Peruvian Quechua[10, 11].

Initially, this equivalent representation of both -I and -D alleles in Monpa might suggest an evolutionary significance of heterozygous advantage, as found in other native highlanders. For example, I/D heterozygotes may possess an advantage over I/I and D/D homozygotes to protect them from a combination of HAPH, CMS, and arterial hypertension. Previous studies have shown significantly greater prevalence of HAPH and associated right ventricular hypertrophy with the I/I genotype among several high-altitude native populations [5, 13, 24] and essential hypertension in Caucasians [26]. Similarly, the D/D genotype was found to be significantly associated with left ventricular hypertrophy [27–29] and essential hypertension in Asian Indians [30], African-Americans [31] as well as Caucasians [32]. Thus, the ACE gene clearly shows a heterozygous (I/D) advantage over the homozygotes (I/I and D/D) in high and low-altitude populations. Moreover, it was reported that highlander Tibetans, who have shown an overrepresentation of ACE heterozygous (I/D), have pulmonary arterial pressures similar to sea-level values. This phenomenon is considered adaptive because elevated pulmonary arterial pressure at high altitudes is a maladaptive response to chronic hypoxia [33]. Although studies have also highlighted that I/I subjects showed 23% greater aerobic fitness than their D/D counterparts at high altitudes [cf.3], the evidence is conflicting across human populations.

The Tawang Monpa did not reveal any association between resting SaO2 and ACE genotype (p>0.05). A previous study among Peruvian Quechua has reported that the ACE I/I genotype is significantly associated with higher resting and sub-maximal exercise SaO2 [10]. Further, the performance advantage of I/I homozygote individuals at high altitudes might be mediated through their subsequently higher SaO2 [3, 12]. No significant associations (p>0.05) between ACE gene polymorphism and other physiological characteristics were observed among Monpa, which suggests that the ACE gene does not influence lung capacities and [Hb] concentration in the studied population. Hence, the lack of association between ACE genotype and physiological attributes, including SaO2 among the Tawang Monpa, points towards the fact that the polymorphisms in the ACE gene are not under the influence of natural selection in this population. More research involving a similar study design must be required before concluding anything substantially.

Literature on the association between ACE genotype and arterial blood pressure has shown contradicting evidence. For example, previous studies have reported significant associations between ACE D/D homozygotes and essential systemic hypertension in Asian Indians residing at low altitudes [30] and with HAPE among Indians at high altitudes [34]. However, in the present study, there were no significant differences in right arterial pressure between Monpa with I/I, I/D, or D/D genotype. This phenomenon indicates that the ACE gene does not play any role in maintaining the arterial blood pressure level in the studied population. Of course, the study’s limitation is that pulmonary arterial pressure was not included. Similar results revealing no association between ACE I/D genotype and essential hypertension were also reported on Tibetan highlanders [2, 35], USA Caucasians [36], Japanese lowlanders [37], Dutch population [38], and other low-altitude populations [39], which probably suggests that mutations at the ACE locus do not commonly contribute to the pathogenesis of hypertension in the populations mentioned above [39]. In other words, this result further confirms the fact that ACE gene polymorphism is not under selection among the populations mentioned above, including Monpa.

Further, environmental exposure might have played a role here, as several studies mentioned above were performed under normoxic conditions. Nevertheless, the present study is consistent with other studies undertaken on high-altitude Tibetans. Limitations of the present study are that pulmonary arterial pressure and sub-maximal or maximal SaO2 were not measured, which would have given more detailed information on ACE genotype-phenotype associations concerning human adaptation to high-altitude hypoxia. In addition, the sample size of the present study is on the lower side of robust analysis. Therefore, it is essential to conduct further studies with a larger sample size to understand the scenario better.

In conclusion, ACE gene polymorphism allele frequencies vary across ethnic groups (Tibetans and Tawang Monpa vs. Peruvian Quechua and Ladakhi) living under hypobaric hypoxia. There is no signature of natural selection on ACE I/D gene polymorphism among the Tawang Monpa, considering no evidence of any association of resting SaO2, arterial blood pressure, [Hb], and lung functions with ACE I/D gene polymorphism. Further study is necessary to understand the effect of ACE gene polymorphism on arterial blood pressure, SaO2, and [Hb] concentration in different ethnic/indigenous populations living under hypobaric hypoxia to gain a better understanding of the role of ACE gene polymorphism on the human adaptation to high-altitude hypoxia.

Acknowledgments

I extend my gratitude to Dr. Murali Kotal, Anthropological Survey of India North-Eastern Regional Center, Shillong, for his help and support in providing me with the laboratory space for DNA extraction. I thank Prof. D.K. Limbu, Department of Anthropology, NEHU, Shillong, for his valuable editorial comments. My special thanks to all the Monpa participants for their unconditional help and support during the data collection.

References

  1. 1. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. The Journal of clinical investigation. 1990 Oct 1;86(4):1343–6. pmid:1976655
  2. 2. Gesang L, Liu G, Cen W, Qiu C, Zhuoma C, Zhuang L, et al. Angiotensin-converting enzyme gene polymorphism and its association with essential hypertension in a Tibetan population. Hypertens Res. 2002, 25: 481–5. pmid:12135330
  3. 3. Woods DR,Montgomery HE.Angiotensin-Converting Enzyme and Genetics at High Altitude.High Altitude Medicine & Biology. 2001, 2(2): 201–10.
  4. 4. Milledge JS, Catley DM. Angiotensin converting enzyme activity and hypoxia. Clin. Sci.1987, 72:149. pmid:3026717
  5. 5. Morrell NW, Sarybaev AS, Alikhan A, Mirrakhimov MM, Aldashev AA. ACE genotype and risk of high altitude pulmonary hypertension in Kyrghyz highlanders. Lancet. 1999, 353:814. pmid:10459973
  6. 6. Qadar Pasha MA., Khan AP, Kumar R, Grover SK, Ram RB, Norboo T, et al. Angiotensin converting enzyme insertion allele in relation to high altitude adaptation. Ann. Hum. Genet.2001, 65:531–6. pmid:11851983
  7. 7. Leung PS, Lam SY, Fung ML. Chronic hypoxia upregulates the expression and function of AT (1) receptor in rat carotid body. Journal of Endocrinology. 2000 Dec 1;167(3):517–24. pmid:11115779
  8. 8. Reinhardt D, Sigusch HH, Henβe J, Tyagi SC, Körfer R, Figulla HR. Cardiac remodelling in end stage heart failure: upregulation of matrix metalloproteinase (MMP) irrespective of the underlying disease, and evidence for a direct inhibitory effect of ACE inhibitors on MMP. Heart. 2002, 88(5): 525–530. pmid:12381651
  9. 9. Heeneman S, Sluimer JC, Daemen MJ. Angiotensin-converting enzyme and vascular remodeling. Circulation research. 2007, 101(5): 441–54. pmid:17761934
  10. 10. Bigham AW, Kiyamu M, León-Velarde F, Parra EJ, Rivera M, Shriver MD, et al. Angiotensin-Converting Enzyme Genotype and ArterialOxygen Saturation at High Altitude in Peruvian Quechua. High Altitude Medicine & Biology. 2008, 9(2): 167–178. pmid:18578648
  11. 11. Rupert JL, Devine DV, Monsalve MV, Hochachka PW. Angiotensin-converting enzyme (ACE) alleles in theQuechua, a high altitude South American native population. Ann. Hum. Biol.1999, 26:375–80. pmid:10462157
  12. 12. Woods DR, Pollard AJ, Collier DJ, Jamshidi Y, Vassiliou V, Hawe E, et al. Insertion/deletion polymorphism of the angiotensin I-converting enzyme gene and arterial oxygen saturation at high altitude. Am J Respir Crit Care Med. 2002, 166(3): 362–66. pmid:12153971
  13. 13. Aldashev AA, Sarybaev AS, Sydykov AS, Kalmyrzaev BB,Kim EV, Mamanova LB, et al. Characterization of high-altitude pulmonary hypertension inthe Kyrgyz: association with angiotensin-converting enzyme genotype. Am. J. Respir. Crit. Care Med. 2002, 166:1396–402. pmid:12406857
  14. 14. Buroker NE, Ning X,Zhou Z, Li K, Cen W, Wu X, et al. Genetic associations with mountain sickness in Han and Tibetan residents at the Qinghai-Tibetan Plateau. Clinica Chimica Acta. 2010, 411: 1466–73. pmid:20570668
  15. 15. Barua S. Mating pattern among the DirangMonpa of West Kameng District, Arunachal Pradesh. Current Anthropology. 1986, 27: 188–90.
  16. 16. Durnin JV, Womersley J. Body fat assessed from total body density and its estimation from skinfold thickness: measurements on 481 men and women aged from 16 to 72 years. Br. J. Nutr.1974, 32:77–97. pmid:4843734
  17. 17. Ghosh S, Kiyamu M, Contreras P, León‐Velarde F, Bigham A, Brutsaert TD. Exhaled nitric oxide in ethnically diverse high‐altitude native populations: A comparative study. American journal of physical anthropology. 2019, 170(3): 451–8. pmid:31396964
  18. 18. Adams H, Adams R, Del Zoppo G, Goldstein LB. Guidelines for the early management of patients with ischemic stroke: 2005 guidelines update a scientific statement from the Stroke Council of the American Heart Association/American Stroke Association. Stroke. 2005 Apr 1;36(4):916–23. pmid:15800252
  19. 19. Comey CT, Koons BW, Presley KW, Smerick JB, Sobieralski CA, Stanley DM, et al. DNA extraction strategies for amplified fragment length polymorphism analysis. Journal of Forensic Science. 1994, 39(5): 1254–69.
  20. 20. Evans AE, Poirier O, Kee F, Lecerf L, McCrum E, Falconer T, et al. Polymorphisms of the angiotensin-converting-enzyme gene in subjects who die from coronary heart disease. Q. J. Med. 1994, 87:211–4. pmid:8208911
  21. 21. Lalnuneng A. Age variation in blood pressure: Rural–urban and sex differences among the Hmar adults of Manipur, Northeast India. American Journal of Human Biology. 2022, 34(3):e23656. pmid:34387918
  22. 22. Kshatriya GK and Acharya SK. Gender disparities in the prevalence of undernutrition and the higher risk among the young women of Indian tribes. PloS One. 2016, 11(7):e0158308.
  23. 23. Ghosh S, Peseyie V. Prevalence of hypertension among the indigenous population in North‐East India: Is this a consequence of “nutritional transition”?. American Journal of Human Biology. 2022, 34(10): e23789.
  24. 24. Aldashev AA, Sarybaev AS, Sadykov AS, Kalmyrzaev BB, Kim EV, Mamanova LB, et al. High altitude pulmonary hypertension in Kyrgyz: association with the ACE genotype. In: Health & Height.V World Congress on Mountain Medicine and High Altitude Physiology. Edicions Universitat Barcelona. 2003.
  25. 25. Droma Y, Hanaoka M, Basnyat B, Arjyal A, Neupane P, Pandit A, et al. Adaptation to high altitude in Sherpas: association with the insertion/deletion polymorphism in the Angiotensin-converting enzyme gene. Wilderness & environmental medicine. 2008, 19(1): 22–29. pmid:18333655
  26. 26. Zee RYZ, Lo Y, Griffiths LR, Morris BJ. Association of a polymorphism of the angiotensin I converting enzyme gene with essential hypertension. Biochem Biophys Res Commun. 1992, 184:9–15. pmid:1314601
  27. 27. Iwai N, Ohmichi N, Nakamura Y, Kinoshita M. DD genotype of the angiotensin-converting enzyme gene is a risk factor for left ventricular hypertrophy. Circulation. 1994, 90(6): 2622–28. pmid:7994801
  28. 28. Doolan G, Nguyen L, Chung J, Ingles J, Semsarian C. Progression of left ventricular hypertrophy and the angiotensin-converting enzyme gene polymorphism in hypertrophic cardiomyopathy. International journal of cardiology. 2004, 96(2): 157–63. pmid:15314809
  29. 29. Schunkert H, Hense HW, Holmer SR, Stender M, Perz S, Keil U, et al.Association between a deletion polymorphism of the angiotensin-converting-enzyme gene and left ventricular hypertrophy. New England Journal of Medicine. 1994, 330(23): 1634–8. pmid:8177269
  30. 30. Das M, Pal S, Ghosh A. Angiotensin Converting Enzyme Gene Polymorphism (Insertion/Deletion) and Hypertension in Adult Asian Indians: A Population-Based Study from Calcutta, India. Human Biology.2008, 80(3): 303–12. pmid:19130799
  31. 31. Duru K, Farrow S, Wang JM, Lockette W, Kurtz T. Frequency of a deletion polymorphism in the gene for angiotensin converting enzyme is increased in African-Americans with hypertension. American journal of hypertension. 1994, 7(8): 759–62. pmid:7986468
  32. 32. Abbud ZA, Wilson AC, Cosgrove NM, Kostis JB. Angiotensin-converting enzyme gene polymorphism in systemic hypertension. American Journal of Cardiology. 1998, 81(2): 244–6. pmid:9591915
  33. 33. Groves BM, Droma T, Sutton JR, McCullough RG, McCullough RE, Zhuang J, et al. Minimal hypoxic pulmonary hypertension in normal Tibetans at 3,658 m. J. Appl. Physiol. 1993,74(1):312–8. pmid:8444708
  34. 34. Bhagi S, Srivastava S, Tomar A, Singh SB, Sarkar S. Positive association of D allele of ACE gene with high altitude pulmonary edema in Indian population. Wilderness & environmental medicine. 2015, 26(2): 124–32. pmid:25683681
  35. 35. Liu YW, Qin WJ, Hou SQ, Shan G, Zhuo M, Chen Y, et al. A-6Gvariant of the angiotensinogen gene and essential hypertension in Han, Tibetan, and Yi populations.Hypertens. Res. 2001,24: 159–63.
  36. 36. Hoeper MM, Tacacs A, Stellmacher U, Lichtinghagen R. Lack of association between angiotensin converting enzyme (ACE) genotype, serum ACE activity, and haemodynamics in patients with primary pulmonary hypertension. Heart. 2003, 89(4): 445–6. pmid:12639879
  37. 37. Higashimori K, Zhao Y, Higaki J, Kamitani A, Katsuya T, Nakura J, et al. Association analysis of a polymorphism of the angiotensin converting enzyme gene with essential hypertension in the Japanese population. Biochemical and biophysical research communications. 1993, 191(2): 399–404. pmid:8384838
  38. 38. Schmidt S, van Hooft IM, Grobbee DE, Ganten D, Ritz E. Polymorphism of the angiotensin I converting enzyme gene is apparently not related to high blood pressure: Dutch Hypertension and Offspring Study. Journal of Hypertension. 1993, April 11(4):345–348. pmid:8390500.
  39. 39. Jeunemaitre X, Lifton RP, Hunt SC, Williams RR, Lalouel JM. Absence of linkage between the angiotensin converting enzyme locus and human essential hypertension. Nature genetics. 1992, 1(1): 72–75. pmid:1338766