Restoring striatal WAVE-1 improves maze exploration performance of GluN1 knockdown mice

Yuxiao Chen; Marija Milenkovic; Wendy Horsfall; Ali Salahpour; Scott H. Soderling; Amy J. Ramsey

doi:10.1371/journal.pone.0199341

Abstract

NMDA receptors are important for cognition and are implicated in neuropsychiatric disorders. GluN1 knockdown (GluN1KD) mice have reduced NMDA receptor levels, striatal spine density deficits, and cognitive impairments. However, how NMDA depletion leads to these effects is unclear. Since Rho GTPases are known to regulate spine density and cognition, we examined the levels of RhoA, Rac1, and Cdc42 signaling proteins. Striatal Rac1-pathway components are reduced in GluN1KD mice, with Rac1 and WAVE-1 deficits at 6 and 12 weeks of age. Concurrently, medium spiny neuron (MSN) spine density deficits are present in mice at these ages. To determine whether WAVE-1 deficits were causal or compensatory in relation to these phenotypes, we intercrossed GluN1KD mice with WAVE-1 overexpressing (WAVE-Tg) mice to restore WAVE-1 levels. GluN1KD-WAVE-Tg hybrids showed rescue of striatal WAVE-1 protein levels and MSN spine density, as well as selective behavioral rescue in the Y-maze and 8-arm radial maze tests. GluN1KD-WAVE-Tg mice expressed normalized WAVE-1 protein levels in the hippocampus, yet spine density of hippocampal CA1 pyramidal neurons was not significantly altered. Our data suggest a nuanced role for WAVE-1 effects on cognition and a delineation of specific cognitive domains served by the striatum. Rescue of striatal WAVE-1 and MSN spine density may be significant for goal-directed exploration and associated long-term memory in mice.

Citation: Chen Y, Milenkovic M, Horsfall W, Salahpour A, Soderling SH, Ramsey AJ (2018) Restoring striatal WAVE-1 improves maze exploration performance of GluN1 knockdown mice. PLoS ONE 13(10): e0199341. https://doi.org/10.1371/journal.pone.0199341

Editor: Alexandra Kavushansky, Technion Israel Institute of Technology, ISRAEL

Received: May 29, 2018; Accepted: October 6, 2018; Published: October 23, 2018

Copyright: © 2018 Chen et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: Data are available and hosted by the Open Science Framework (DOI : 10.17605/OSF.IO/CU74V). Due to file size limitations, lower-sized exports of microscopy images are included in the collection. Raw images are available upon request.

Funding: This study is funded by the Natural Sciences and Engineering Research Council of Canada (grant number: RGPIN-2018-06409) to AJR and by the National Institutes of Health (grant number: NIH R01 MH103374) to SHS. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

The N-methyl-D-aspartate (NMDA) receptor (NMDAR) is a glutamate- and glycine-gated ion channel composed of four subunits: two obligatory GluN1 subunits and a combination of GluN2 or GluN3 family subunits [1]. De novo point mutations in GluN1 or GluN2 subunits have been identified in patients with schizophrenia, autism, intellectual disability, and epilepsy [2]. Cognitive impairments are prominent features of these neurological disorders. The consequences of NMDAR hypofunction can be studied using GluN1 knock-down (GluN1KD) mice, which have a global genetic reduction of NMDARs by more than 90% [3]. Behavioral and cellular phenotypes of GluN1KD mice have been used to model aspects of both schizophrenia and autism [3–6].

At the cellular level, GluN1KD mice have decreased spine density in the striatum that is detected at six weeks of age but not at two weeks. This is temporally correlated with synaptic deficits of the Disrupted in Schizophrenia-1 (DISC1) protein and the onset of cognitive impairments [7,8]. DISC1 reductions may mediate dendritic spine deficits since DISC1 is known to regulate Rac1 and neurite growth downstream of NMDARs [9,10]. Dendritic spines represent important neuronal connections whose alterations in morphology and number are associated with behavioral changes [11,12]. Thus, we hypothesized that the age-dependent reduction of synaptic DISC1 and spine density in GluN1KD mice contributed to cognitive behavioral abnormalities through changes in Rho GTPase signaling [7].

Studies of Rho GTPases (Rac1, RhoA, and Cdc42 in particular) suggest that they work with NMDARs to regulate synaptic plasticity and cognition [13,14]. For example, the activity of RhoA and Cdc42 increases in an NMDAR-dependent manner during long-term potentiation [15]. Rho GTPases and their downstream signaling molecules also influence cognition at a macroscopic level. Learning and memory deficits result with RhoA inhibition, Rac1 depletion from forebrain excitatory neurons, or with genetic disruption of a downstream effector of Rac1, the Wiskott-Aldrich syndrome protein-family verprolin-homologous protein family member 1 (WAVE-1, also called Scar1) [16–18]. Disruptions in Rho GTPase signaling are also linked to neuropsychiatric disorders, including schizophrenia [19,20]. We therefore hypothesized that NMDAR hypofunction in GluN1KD mice results in dysregulated Rho GTPase signaling and altered synaptic connectivity that in turn contribute to abnormal GluN1KD mouse behaviors.

To test our hypothesis, we studied the relationship between changes of Rho GTPase pathways proteins, dendritic spines, and behavioral test performance in mice with NMDAR deficiency. We report that GluN1KD mice showed an age-dependent decrease of dendritic spine density in striatal medium spiny neurons (MSNs). Striatal Rac1 signaling was also changed in 3, 6, and 12 week old GluN1KD mice–consistently showing lower Rac1 and WAVE-1 levels in older mice. We tested whether WAVE-1 over expressing (WASF1 –Entrez Gene ID 8936 –BAC transgenic, WAVE-Tg) mice could rescue the cellular or behavioral phenotypes of GluN1KD mice. GluN1KD-WAVE-Tg compound transgenic mice had improved striatal WAVE-1 levels and MSN spine density. They also showed improved performance in the Y-maze and 8-arm radial maze tests, but not in other behavioral tests in our study. Further assessments of WAVE-1 and dendritic spine changes at the hippocampus found no significant changes resulting from the knock-down of GluN1 subunits or the addition of a WASF1 transgene. Our results point to a nuanced role for WAVE-1 in synaptic plasticity and cognition, particularly in the striatum, regarding maze exploration performance.

Methods

Animals

WT, WAVE-Tg, GluN1KD, and GluN1KD-WAVE mice aged 3, 6, or 12–14 weeks were used in this study. All experiments used only adult mice aged 12–14 weeks except for those explicitly involving and comparing 3 and 6-week old mice. Male and female mice were used for all experiments except for dendritic spine studies, RNAscope analysis, and hippocampal WAVE-1 western blots of all four genotypes, which used males. The generation of GluN1KD mice was previously described [3], in which a neomycin cassette was inserted into intron 19 of Grin1 (Entrez Gene ID 14810). The mouse line was backcrossed for more than 20 generations onto two genetic backgrounds, C57B1/6J and 129X1/SvJ. Mice used for comparisons between GluN1KD and WT littermates were generated from intercross breeding of C57B1/6J Grin1+/− and 129X1/SvJ Grin1+/− heterozygotes to produce F1 progeny. This strategy was chosen in accordance with the recommendations of the Banbury Conference to minimize the potential confound of homozygous mutations in parent strains [21].

WAVE-Tg mice were constructed by the pronuclear injection of BAC DNA containing the human WASF1 locus into fertilized eggs of C57B1/6J mice. Human WASF1 was chosen to facilitate transgene screening and detection via species-specific sequences and because it has high sequence homology (>90%) with mouse Wasf1 [22]. Mice used to compare between WT, WAVE-Tg, GluN1KD and GluN1KD-WAVE mice were generated by intercross breeding between C57B1/6J Grin1+/− WAVE-Tg mice and 129X1/SvJ Grin1+/− non-WAVE-Tg mice. All F1 mice were genotyped by polymerase chain reaction analysis of tail sample DNA. The primers used to amplify the GluN1KD Grin1– allele were: 5′ AAG CGA TTA GAC AAC TAA GGG T 3′ and 5′ GCT TCC TCG TGC TTT ACG GTA T 3′. The primers used to amplify the WT Grin1 allele were: 5′ TGA GGG GAA GCT CTT CCT GT 3′ and 5′ AAG CGA TTA GAC AAC TAA GGG T 3′. For WAVE-1 genotyping, the WASF1-targeting primers 5′ CAA CTC ATT GCA AGA ACG TGT GGA C 3′ and 5′ AAT AAA AAA ATT AGC CAG GCG TGG TG 3′ were used. All animal housing and experimentation conditions and protocols were in accordance with institutional (University of Toronto Faculty of Medicine and Pharmacy Animal Care Committee, approved protocol #20011988) and federal (Canadian Council on Animal Care) guidelines. Two main cohorts of mice were used for behavioral testing. One cohort was assessed with all tests except for 8-arm radial maze while the other was specifically used for 8-arm radial maze testing. The behavioral test battery used to assess the first cohort of mice generally kept to the following order: Y-maze test, open field test, social approach test, puzzle box test. Behavioral tests were performed during the light cycle, between 9am and 6pm. Mice were naïve to all behavioral tests before use in this study. To minimize animal suffering, mouse brains were collected after quick and precise cervical dislocation for biochemical measures, and after terminal anesthesia with tribromoethanol for spine density measures.

Quantitative PCR of transgene

Tail samples were collected from WASF1-Transgenic colony founder mice, WASF1-Transgenic mice from early litters of the intercross breeding between C57B1/6J Grin1+/− WAVE-Tg and 129X1/SvJ Grin1+/− non-WAVE-Tg parents, and WASF1-Transgenic mice from later litters of the same intercross breeding strategy, and non-transgenic littermates. DNA was isolated from these tissue samples via isopropanol precipitation after tissue digestion with Proteinase K (Bioshop, Canada). Isolated DNA samples were then purified with chloroform and ethanol. 20 ng of DNA for each mouse was used for qPCR reaction. WASF1 and Wasf1 were amplified with three primers: 5’ TCTTGCTCATCCTCCCTCT 3’ forward primer (common for both WASF1 and Wasf1), 5’ GTTGATGGATGGCGCTTTG 3’ (specific for WASF1), 5’ GTGGATGGATGGCGCTTTG 3’ (specific for Wasf1). Amplification of the Tfrc gene was used as internal control, via the primers 5’ CAGTCATCAGGGTTGCCTAATA 3’ (forward) and 5’ ATCACAACCTCACCATGTAACT 3’ (reverse). Copy number was quantified by using the 2^-ΔΔCt method and setting the Wasf1 value of non-transgenic mice to 2. Relative DNA abundance from WAVE-Tg mice were subsequently normalized accordingly.

Dendritic spine analysis

Dendritic spine density and morphology were assessed via DiOLISTIC labeling and confocal microscopy as detailed previously [23,24]. Mice were deeply anesthetized with tribromoethanol and perfused transcardially with phosphate buffered saline (PBS) followed by a solution of 4% paraformaldehyde (PFA) in PBS over 10 minutes. Brains were then collected and submerged in 4% PFA for one hour before being stored in PBS at 4°C. Within 48 hours, perfused brains were sliced coronally at a thickness of 100 or 150μm. Slices of the striatum and hippocampus were collected and their neurons were randomly labeled by DiI (1–1'-Dioctadecyl-3,3,3',3'- tetramethylindocarbocyanine perchlorate) labeling. Slices were impregnated with DiI coated tungsten or gold beads using a Helios gene gun (Bio-Rad, CA, USA).

Z-stack images with steps of 0.5–0.9 μm at 60X magnification were collected via an IX81 confocal microscope and Fluoview FV 1000 software (Olympus, Tokyo, Japan). Images comparing WT and GluN1KD mice at 3, 6, and 12 weeks of age were analyzed for changes in spine density with NIS-Elements Basic Research (Version 3.10, Nikon, Tokyo, Japan). Images comparing spine density between all four genotypes were analyzed with ImageJ (Version 1.50; [25] from the National Institutes of Health (NIH, MD, USA) using the NeuronJ (Version 1.4.3) plug-in [26]. Striatal MSN dendrites were assessed randomly in the initial comparison between WT and GluN1KD mice using 100 μm thick brain slices. Later striatal spine assessments comparing WT, WAVE-Tg, GluN1KD and GluN1KD-WAVE mice were focused on 20 μm dendrite segments starting approximately 20 μm away from the soma and used 150 μm thick slices. The whole striatum was analyzed for spine density evaluation; ventral and dorsal subregions were not differentiated. Hippocampal slices 150 μm thick were analyzed at 20 μm segments of secondary and tertiary dendrites from the basolateral and apical sides of CA1 pyramidal neurons. Basolateral dendrites were assessed starting at 30–45 μm away from the soma while apical dendrites were assessed near the initial branching points of secondary or tertiary dendrites closest to the soma, which varied in distance from soma. All dendritic segments selected for analysis avoided branch points. Two to six z-stack image compositions were used for each brain region and mouse assessed. Spine density analyses were performed blind to genotype.

Western blotting

The striatum and hippocampus of test mice were dissected to prepare protein extracts. Each brain region was homogenized in 400 μl of PHEM buffer (0.5% TritonX 100, 60mM PIPES, 25mM HEPES, 10mM EGTA, and 2mM MgCl₂) with protease and phosphatase inhibitors (1.5 μg/ml aprotinin, 10 μg/ml leupeptin, 10 μg/ml pepstatin A, 0.1mg/ml benzamidine, 0.25mM PMSF, 5mM Na orthovanadate, 10mM NaF, 2.5mM Na pyrophosphate, 1mM β-glycerophosphate). Loading samples were prepared from protein homogenates with standard sample buffer and 5% β‑mercaptoethanol, then heated at 100°C for 5 minutes. Depending on the protein of interest, 15–25 μg of protein for each sample were electrophoresed in 7.5–12% bis-acrylamide gels and transferred onto polyvinylidene difluoride membranes, both steps at 80-100V. Blots were blocked with 5% milk or bovine serum albumin in tris-buffered saline and Tween 20, according to primary antibody supplier instructions. Blots were incubated with fluorescent secondary antibodies and imaged with the Odyssey Infrared Imaging System (LI-COR, NE, USA). Densitometry was performed using Odyssey (Version 3, LI-COR), Image Studio (Version 5, LI-COR), or ImageJ (Version 1.45, NIH). Primary antibodies used were as follows: α-WAVE-1 (1:1000–2000, catalog number 75–048, NeuroMab, CA, USA), α-Rac1 (1:500, catalog number ARC03, Cytoskeleton, CO, USA), and α-GAPDH (1:4000–5000, catalog number G8795, Sigma, MO, USA). Secondary antibodies were as follows: donkey α-mouse IgG-800 (1:5000, catalog number 610-731-002, Rockland, PA, USA), goat α-rabbit IgG-680 (1:5000, catalog number A21076, Invitrogen, CA, USA), donkey α-mouse IgG-680 (1:15000, catalog number 926–68072, LI-COR, NE, USA) and goat α-rabbit IgG-800 (1:15000, catalog number 926–32211, LI-COR). Blots were normalized to loading control protein (GAPDH) bands or to REVERT total protein stain (LI-COR, NE, USA) before analysis.

Fluorescent in situ hybridization via RNAscope

Wasf1 and WASF1 expression in adult male mice of all four genotypes was visualized by RNAscope, a chromogenic in situ hybridization technique, following the RNAscope Multiplex Fluorescent Reagent Kit v2 from ACD Bio (CA, USA). Fresh-frozen brains were sliced sagittally (lateral 1.2 mm Bregma) at a thickness of 20μm and mounted onto charged slides. Slices were then fixed by submersion into 4% PFA in 1X PBS and dehydrated by serial submersion in 50%, 70%, and 100% ethanol. Slices were then incubated in hydrogen peroxide before being treated with RNAscope Protease IV. The multiplex fluorescent assay was then performed: slices were hybridized to negative control (reference ID 320871, ACD Bio), positive control (ref ID 320881), or both human WASF1 (ref ID 533691) and mouse (ref ID 533701) Wasf1 probes; amplification reagents were then used to incubate the slides to increase signal strength; finally, fluorescent signals were developed using TSA Plus cyanine 3 (PerkinElmer, Llantrisant, UK) for channel 1 and cyanine 5 (also PerkinElmer) for channel 2 using channel-specific horseradish peroxidases. Vectashield with DAPI (Vector Laboratories, CA, USA) was then applied to the slices before glass coverslip placement. Slides were dried overnight and then imaged with an Axio Scan.Z1 slide scanner (Zeiss, Oberkochen, DEU) at 20X magnification.

Behavioral tests

Y-maze spontaneous alternation test.

The Y-maze spontaneous alternation test was performed as an assessment of cognitive function of test mice, as described in previous studies [8,27]. For 8 minutes, mice were allowed to freely explore a Y-maze consisting of three identical arms with the dimensions 38 × 7.6 × 12.7 cm that met at the center separated by an angle of 120^o between each pair of arms (San Diego Instruments, CA, USA). Mice were tracked once they were placed at the end of one arm with Biobserve Viewer (Version 2; St. Augustin, Germany). Zones were digitally defined for each arm starting at 5 cm away from the center of the maze. Spontaneous 3-arm alternations were defined as a mouse executing consecutive entries into each of the three zones without repeat entries into any one zone. The percent of spontaneous three-arm alteration zone entries relative to all Y-maze zone entries after the first two was taken as the Y-maze performance score.

8-arm radial maze test.

WT, WAVE-Tg, GluN1KD, and GluN1KD-WAVE mice were also assessed for their cognitive function based on the 8-arm radial maze as described (Dzirasa et al., 2009). The maze consisted of 8 arms with the dimensions 22.86 × 7.62 × 15.24 cm that met together as sides of an octagon, which served as the maze center (San Diego Instruments, CA, USA). Mice were food restricted to 90% of their free-feeding body weight. After habituation to the maze center for one week, the arms were baited with a piece of cherrio cereal and mice explored the arena for 5 minutes or until all 8 arms were explored. Mice were tested daily for four days, and the performance of the four days was averaged for each week (each trial block). Cognition was assessed by measures of working memory error (WME, the number of entries into already-visited arms) and by measures of entries-to-repeat (ETR, the number of arms visited before the mouse makes a repeat entry into any arm) recorded by Biobserve Viewer (Version 3).

Puzzle box test.

Problem-solving, short-term memory and long-term memory were assessed by the puzzle box test as described previously [8,28]. The puzzle box has an arena with two adjacent compartments measuring 58 × 28 × 27.5cm and 14 × 28 × 27.5cm that are separated by one of two removable dividers: one has an open door allowing free passage while the other leaves only an underpass connection. To start each trial, mice were placed in the larger arena compartment under bright-light conditions facing away from the divider. As the other compartment beyond the divider has a roof cover providing dim-light conditions, mice are motivated to enter it. The time that it took the mouse to completely enter the smaller area was manually recorded. There were 9 trials spread out to 3 per day with new obstacles introduced during the second trial of each day to block the path between the two arena compartments. Replacement of the open door divider with the door-less divider was introduced in trial 2 and was used for every subsequent trial. The underground pass was filled with cage bedding in trials 5–7, then instead with a cardboard plug in trials 8–9. 5 minutes were given for each mouse to reach the dim-light area during each trial and 2 minutes separated trials for the same mouse on the same day. Mice that failed the first trial, a training trial, were excluded from the test.

Open field test.

The protocol for the open field test of locomotor activity has been described previously [3,29]. Test mice were placed in a novel environment, clear Plexiglas chambers measuring 20 × 20 × 45cm, for 2 hours. Their locomotor activity was recorded and tracked by digital activity monitors from Omnitech Electronics (OH, USA) via infrared beam sensors. Distance travelled was analyzed in five-minute bins to assess locomotor activity.

Social approach behavior test.

Test mice were also assessed for their social cognition via approach behavior towards novel age- and sex- matched mice, which served as social stimuli. A social approach behavior test was performed as previously described [30,31]. Test mice were placed in a white Plexiglas arena (62 × 40.5 × 23cm). Their subsequent interactions with an empty inverted wire cup and another containing the social stimulus mouse were recorded with a video camera for 10 minutes. Biobserve Viewer (Version 2) was used to track center of body mass and quantify the amount of time mice spent in 5cm circular zones surrounding each cup. The amount of time spent by test mice in both the social stimulus and nonsocial zones were taken as a measure of social cognition and a related novelty control measure, respectively.

Statistical analysis.

All data were graphed and analyzed using Prism (Version 6.01, GraphPad Software, CA, UAS), except for two-way ANOVAs with repeated measures, which were analyzed using SPSS (Version 20.0.0, IBM, NY, USA). Assumptions of equal variance and data-distribution normality were tested for all independent measures tests while assumptions of sphericity were tested for all repeated-measures tests. Comparisons between WT and GluN1KD mice were assessed with independent, two-tailed t-tests while those between WT, WAVE-Tg, GluN1KD, and GluN1KD-WAVE mice were assessed with one-way ANOVAs except in cases with repeated measurements over time or in cases where equal variance or normally distributed data could not be assumed. Comparisons of repeated-measures data, including locomotor activity and 8-arm radial maze performance, were completed using two-way ANOVAs with repeated measures. Bonferroni corrections were used after ANOVAs for post hoc comparisons between all groups. Data with unequal variance or non-normal distributions were compared with Kruskal-Wallis tests followed by post hoc Dunn’s multiple comparisons tests. Behavioral test and WAVE-1 western blot results were also analyzed preliminarily for sex differences by including sex as an independent variable. A cut-off of p-value of 0.05 was chosen for statistical significance. Sample sizes are indicated within each figure for all experiments. Data are expressed as mean ± standard error of the mean. Where mentioned, post hoc power analyses and sample size calculations were performed with G*Power (Version 3.1.9.2; [32,33] from the Heinrich Heine University Düsseldorf).

Results

GluN1KD mice have age-dependent deficits in striatal MSN dendritic spine density and aberrant levels of Rac1 signaling components

We previously reported that striatal spine density of GluN1KD mice was normal at two weeks of age but was decreased at six weeks of age relative to WT littermates [7]. We therefore assessed spine density at 3, 6, and 12 weeks of age to further study the onset and progression of developmental spine loss. In the striatum, GluN1KD mice have spine deficits at 6 and 12 weeks of age, but not at 3 weeks (Fig 1). GluN1KD mice had a 11% reduction in spine density at 6 weeks (WT: 138 ± 2 spines/100 μm, GluN1KD: 124 ± 2 spines/100 μm) (independent, two-tailed t₍₄₎ = 5.55, p < 0.01). At 12 weeks of age GluN1KD mice had a 16% reduction in spines (WT: 136 ± 2 spines/100 μm, GluN1KD: 114 ± 1 spines/100 μm) (t₍₄₎ = 9.74, p < 0.01). Thus, we determined that spine loss first occurs between 3 and 6 weeks of age, and that these reductions are maintained in the adult brain.

Download:

Fig 1.

Representative images (left) and quantifications (right) of dendritic spines of striatal MSNs in male and female GluN1KD and WT mice at 3, 6, and 12 weeks of age. GluN1KD mice have significantly reduced spine density compared to WT mice at 6 and 12 weeks of age. Mouse sample sizes are denoted within each bar. 3–7 dendrite sample images were analyzed for each mouse. Scale bar represents 20μm. Data was analyzed by two-tailed, independent t-tests, ** p < 0.01.

https://doi.org/10.1371/journal.pone.0199341.g001

We measured the protein levels of key components of Rho GTPase signaling cascades in the striatum of 3, 6, and 12-week-old mice. The proteins assessed were RhoA, Rac1, Cdc42, cortactin, WAVE-1, N-WASP, LIMK1, cofilin, pS3-cofilin, and actin. Of these, significant differences were consistently found for Rac1 and WAVE-1 (Fig 2). GluN1KD mice show an increase in Rac1 at 3 weeks, and reductions in Rac1 at 6 and 12 weeks of age. Expressed as a percentage of WT levels, GluN1KD levels of Rac1 are 126% at 3 weeks, 70% at 6 weeks, and 76% at 12 weeks of age (independent, two-tailed t₍₆₎ = 2.45–6.00, p < 0.05 for all three). WAVE-1, a downstream effector of Rac1, is reduced in the GluN1KD striatum at all three ages. Expressed as a percentage of WT, WAVE-1 levels are 75% at 3 weeks, 63% at 6 weeks, and 80% at 12 weeks of age (t₍₆₎ = 2.44–3.04, p ≤ 0.05 for all three). Of the Rho GTPase signaling proteins, the Rac1 pathway proteins are especially altered in GluN1KD mice—specifically Rac1 itself and its downstream effector, WAVE-1. [34,35].

Download:

Fig 2.

Representative western blots (top) and their quantifications (bottom) assessing differences in Rac1 and WAVE-1 levels at the striatum of male and female GluN1KD mice and WT littermates aged 3, 6, and 12 weeks. In GluN1KD mice, Rac1 was significantly increased at 3 weeks before decreasing to lower than WT levels at 6 and 12 weeks of age. In contrast, WAVE-1 was consistently decreased at all time points. All blots were first normalized to GAPDH loading controls. A sample size of 4 mice per group, denoted in the graph legends beside genotype labels, was used for every genotype and age group. Data was analyzed by two-tailed, independent t-tests, * p ≤ 0.05, ** p < 0.01.

https://doi.org/10.1371/journal.pone.0199341.g002

Striatal WAVE-1 levels are increased in WAVE-Tg mice and restored in GluN1KD-WAVE hybrids

In other model systems, reductions in Rac1 and WAVE-1 cause dendritic spine loss [18,36], but chronic increases in Rac1 activity can also cause spine abnormalities [9,37,38]. Therefore, we considered the possibilities that reductions in Rac1 and WAVE-1 could either contribute to the observed spine loss or could be compensatory responses to prevent further spine loss. To test these two possibilities, we restored WAVE-1 protein levels in GluN1KD mice by intercross breeding with a transgenic mouse line that overexpresses WAVE-1.

WAVE-1 transgenic mice were generated by pronuclear injection of a bacterial artificial chromosome bearing the entire the human WASF1 genomic sequence with 86.5 kb of upstream and 70.3kb of downstream genomic sequence. This procedure resulting in the successful incorporation of 10–11 copies of the transgene, which remained consistent across cohorts of experimental mice regardless of their Grin1 genotype (Fig 3). WASF1 transgenic mice (WAVE-Tg and GluN1KD-WAVE-Tg hybrids, called GluN1KD-WAVE hereafter) show increased WAVE-1 message expression compared to non-transgenic littermates at the striatum (Fig 4) and hippocampus (Fig 5). These increases are specific to the human transgene and similar to endogenous mouse Wasf1 expression in pattern. We also performed western blotting of striatal protein to measure the relative levels of Rac1 and WAVE-1 in this new line of mice (Fig 6). One-way ANOVA found no significant genotype effect on Rac1 levels, though this experiment was determined to be underpowered post hoc (One-way ANOVA F_3,20 = 1.514, p = 0.24, β = 0.66). However, Kruskal-Wallis test did find a significant effect of genotype on levels of WAVE-1 (p < 0.01). The presence of the WASF1 transgene increases the levels of WAVE-1 in the striatum of both WT and GluN1KD mice, though the difference between WAVE-Tg and WT mice only trended towards significance. WAVE-1 is 119% of WT levels in WAVE-Tg mice (Dunn’s multiple comparisons test p = 0.09 vs WT), 73% in GluN1KD mice (p = 0.03), and 105% in GluN1KD-WAVE-Tg hybrids (not significantly different vs WT, p > 0.99). No sex differences were observed in striatal WAVE-1 protein level when assessed with a preliminary Scheirer-Ray-Hare test that included sex as an additional independent variable (S1 Table) Our results indicate that GluN1KD mice have reduced WAVE-1 levels and that the WASF1 transgene is sufficient to rescue striatal WAVE-1 levels in GluN1KD mice.

Download:

Fig 3. Relative copy number of the WASF1/Wasf1 gene in non-transgenic and different generations of WASF1-transgenic mice of both sexes.

Transgenic mice, regardless of Grin1 genotype, generally had 10–11 copies of the WASF1/Wasf1 gene. Gene copy number was consistent between different generations of transgenic mice. Mouse sample sizes are denoted within each bar. Data was analyzed by Kruskal-Wallis test followed by post hoc Dunn’s multiple comparisons for all pairings, * p < 0.01 for all comparisons between non-transgenic mice and a transgenic mouse group.

https://doi.org/10.1371/journal.pone.0199341.g003

Download:

Fig 4. Fluorescent in situ hybridization of male WT, WAVE-Tg, GluN1KD, and GluN1KD-WAVE striatum.

Endogenous, mouse Wasf1 message is shown in red (left column) while transgenic, human WASF1 is shown in green (middle column). Human WASF1 was expressed abundantly and specifically in transgenic mice with a pattern of expression similar to mouse Wasf1.

https://doi.org/10.1371/journal.pone.0199341.g004

Download:

Fig 5. Fluorescent in situ hybridization of male WT, WAVE-Tg, GluN1KD, and GluN1KD-WAVE hippocampus.

Endogenous, mouse Wasf1 message is shown in red (left column) while transgenic, human WASF1 is shown in green (middle column). Human WASF1 was expressed abundantly and specifically in transgenic mice with a pattern of expression similar to mouse Wasf1.

https://doi.org/10.1371/journal.pone.0199341.g005

Download:

Fig 6.

Representative western blots (top) and their quantifications (bottom) assessing differences in striatal levels of Rac1 and WAVE-1 of adult male and female, WT, WAVE-Tg, GluN1KD, and GluN1KD-WAVE mice. WAVE-1 was confirmed to be decreased in GluN1KD mice, increased in WAVE-Tg mice, and attenuated towards WT levels in GluN1KD-WAVE mice. No sex differences were observed for striatal WAVE-1 levels (S1 Table). Rac1 was not found to be significantly different between genotypes. A sample size of 6 mice was used for every genotype. Data was analyzed by one-way ANOVAs followed by Bonferroni post hoc comparisons for all pairings, # p = 0.09, * p < 0.05, ** p < 0.01.

https://doi.org/10.1371/journal.pone.0199341.g006

Striatal spine density deficits are attenuated in GluN1KD-WAVE hybrids

As we have rescued WAVE-1 expression in GluN1KD-WAVE mice, we next asked whether this attenuates the synaptic deficits of GluN1KD mice in striatal MSNs. We therefore assessed the dendritic spine density of adult WT, WAVE-Tg, GluN1KD, and GluN1KD-WAVE mice. Representative dendrite images and spine density quantifications are shown in Fig 7A. Kruskal-Wallis test reported a significant effect of genotype on spine density (p = 0.04). GluN1KD mice had a spine density of 145 ± 9 spines/100 μm, significantly lower than WT levels of 185 ± 11 spines/100 μm when comparing ranks (Dunn's multiple comparisons test p = 0.0478). In contrast, GluN1KD-WAVE mice had a more WT-like spine density of 172 ± 6 spines/100 μm (p > 0.99 vs WT). These results point to the improved WAVE-1 levels of GluN1KD-WAVE mice having biological significance at the synapse by increasing spine density. They also led us to test whether GluN1KD-WAVE mice have improved behavioral test performance, which would more definitively assess the biological significance of restoring WAVE-1 in NMDAR-deficient mice.

Download:

Fig 7.

Striatal MSN spine density (a), Y-maze performance (b), and 8-arm radial maze performance (c) are deficient in GluN1KD mice and improved in GluN1KD-WAVE mice. a) Representative images of MSN dendrites (left) and spine density quantifications (right) show lower spine density in GluN1KD mice compared to WT littermates but not in GluN1KD-WAVE hybrids. Mouse sample sizes are denoted within each bar. Male mice were used in this experiment. 3–6 dendrite sample images were analyzed for each mouse. Scale bar represents 20μm. Data was analyzed by Kruskal-Wallis test followed by Dunn’s multiple comparisonsfor all pairings, * p = 0.048. b) GluN1KD, but not GluN1KD-WAVE, mice had significantly lower % 3-arm alternation scores compared to WT and WAVE-Tg mice. GluN1KD-WAVE mice also had a significantly higher score compared to GluN1KD mice. Data was analyzed by one-way ANOVA followed by Bonferroni post hoc comparisons for all pairings, * p < 0.05, ** p < 0.01. Sample sizes are indicated by numbers in each bar. c) Mean WME (top) and ETR (bottom) scores from the 8-arm radial maze test show different effects of intercrossing GluN1KD and WAVE-Tg mice. GluN1KD and GluN1KD-WAVE mice performed worse on both measures compared to WT and WAVE-Tg mice, but GluN1KD-WAVE mice also had significantly less WMEs over the course of the experiment compared to GluN1KD mice. Two-way repeated measures ANOVAs reported significant effects of genotype on both WME and ETR (p < 0.01). # Bonferroni post hoc analysis reported an adjusted p < 0.01 for each comparison between a GluN1KD and a non-GluN1KD genotype. * p = 0.02 for GluN1KD-WAVE mice WMEs compared to GluN1KD mice. In the context of 8-arm radial maze WMEs, intercrossing GluN1KD and WAVE-Tg mice resulted in a partial rescue. Male and female mice were used in behavioral experiments. No gene-sex interaction effects were observed in these behavior tests, thought male mice did perform better than female littermates in the Y-maze test (S1 Table). Sample sizes are indicated next to their respective genotypes in the legend.

https://doi.org/10.1371/journal.pone.0199341.g007