Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Correction

Correction: First Demonstration of Antigen Induced Cytokine Expression by CD4-1+ Lymphocytes in a Poikilotherm: Studies in Zebrafish (Danio rerio)

  • Sohye Yoon,
  • Suman Mitra,
  • Cathy Wyse,
  • Ayham Alnabulsi,
  • Jun Zou,
  • Eveline M. Weerdenburg,
  • Astrid M. van der Sar,
  • Difei Wang,
  • Christopher J. Secombes,
  • Steve Bird
  • Article
  • Metrics
  • Comments
  • Media Coverage

The CD4-1-R primer sequence is listed incorrectly in S2 Table. The correct primer sequence is: 5'CTGGTCGGTCTTAAATGAAACT3'. Please see the correct S2 Table here.

Supporting Information

S2 Table. Primers used in real time PCR for gene expression in zebrafish.

https://doi.org/10.1371/journal.pone.0169149.s001

(DOCX)

Reference

  1. 1. Yoon S, Mitra S, Wyse C, Alnabulsi A, Zou J, Weerdenburg EM, et al. (2015) First Demonstration of Antigen Induced Cytokine Expression by CD4-1+ Lymphocytes in a Poikilotherm: Studies in Zebrafish (Danio rerio). PLoS ONE 10(6): e0126378. pmid:26083432

Citation: Yoon S, Mitra S, Wyse C, Alnabulsi A, Zou J, Weerdenburg EM, et al. (2016) Correction: First Demonstration of Antigen Induced Cytokine Expression by CD4-1+ Lymphocytes in a Poikilotherm: Studies in Zebrafish (Danio rerio). PLoS ONE 11(12): e0169149. https://doi.org/10.1371/journal.pone.0169149

Published: December 21, 2016

Copyright: © 2016 Yoon et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.