Figures
Abstract
Wheat heading date is an important agronomic trait determining maturation time and yield. A set of common wheat (Triticum aestivum var. Chinese Spring; CS)-wild emmer (T. turgidum L. subsp. dicoccoides (TDIC)) chromosome arm substitution lines (CASLs) was used to identify and allocate QTLs conferring late or early spike emergence by examining heading date. Genetic loci accelerating heading were found on TDIC chromosome arms 3AL and 7BS, while loci delaying heading were located on 4AL and 2BS. To map QTLs conferring late heading on 2BS, F2 populations derived from two cross combinations of CASL2BS × CS and CASL3AL × CASL2BS were developed and each planted at two times, constituting four F2 mapping populations. Heading date varied continuously among individuals of these four populations, suggesting quantitative characteristics. A genetic map of 2BS, consisting of 23 SSR and one single-stranded conformation polymorphism (SSCP) marker(s), was constructed using these F2 populations. This map spanned a genetic length of 53.2 cM with average marker density of 2.3 cM. The photoperiod-sensitivity gene Ppd-B1 was mapped to chromosome arm 2BS as a SSCP molecular marker, and was validated as tightly linked to a major QTL governing late heading of CASL2BS in all mapping populations. A significant dominance by additive effect of Ppd-B1 with the LUX gene located on 3AL was also detected. CS had more copies of Ppd-B1 than CASL2BS, implying that increased copy number could elevate the expression of Ppd-1 in CS, also increasing expression of LUX and FT genes and causing CS to have an earlier heading date than CASL2BS in long days.
Citation: Zhou W, Wu S, Ding M, Li J, Shi Z, Wei W, et al. (2016) Mapping of Ppd-B1, a Major Candidate Gene for Late Heading on Wild Emmer Chromosome Arm 2BS and Assessment of Its Interactions with Early Heading QTLs on 3AL. PLoS ONE 11(2): e0147377. https://doi.org/10.1371/journal.pone.0147377
Editor: Chengdao Li, Department of Agriculture and Food Western Australia, AUSTRALIA
Received: April 20, 2015; Accepted: January 4, 2016; Published: February 5, 2016
Copyright: © 2016 Zhou et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper and its Supporting Information files.
Funding: This work was supported by National Natural Science Foundation of China (31201208 sponsored for WZ and 31071421 sponsored for JKR, the URL is http://www.nsfc.gov.cn/), Zhejiang province public technology applied research projects (2014C32027 sponsored for YRJ, the URL is http://www.zjkjt.gov.cn/), Zhejiang Provincial Natural Science Foundation of China (LQ12C13003 sponsored for WZ, the URL is http://www.zjnsf.gov.cn/index.aspx), Zhejiang province science and technology development special project on breeding new varieties of wheat and barley (2012C12902-2-6 sponsored for WZ, the URL is http://www.zjkjt.gov.cn/) and the Program for Zhejiang Leading Team of S&T Innovation (2011R50026-24 sponsored for WZ and the URL is http://www.zjkjt.gov.cn/). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Heading date is an important agronomic trait that has attracted considerable attention in bread wheat (Triticum aestivum, 2n = 6x = 42, AABBDD) breeding programs. It affects wheat maturation time, and further influences yield potential and quality [1]. Wheat flowering time is complex, exhibiting continuous variation among different varieties. Photoperiod (Ppd), vernalization (Vrn) response, and earliness per se (eps) genes are three important factors involved in regulating wheat flowering time [2–4].
Vernalization is the acquisition of the ability to accelerate flowering following exposure to cold or a chilling treatment; response to vernalization is dependent on the intensity of low temperature and the duration of exposure [5]. Genetic differences in vernalization requirement are mainly caused by allelic variation at the loci Vrn-1, Vrn-2, Vrn-3, and Vrn-4. Vrn-1 series genes consist of three separate orthologous counterparts (Vrn-A1, Vrn-B1, and Vrn-D1), located on chromosomes 5A, 5B, and 5D, respectively [6–9]. Among Vrn-2 series genes, Vrn-A2 and Vrn-B2 have been characterized in diploid and tetraploid wheat [2,10]. Distelfeld et al. [2] demonstrated that Vrn-B2 is generally functional whereas Vrn-A2 is non-functional in tetraploid wheat. The Vrn-3 series includes Vrn-A3, Vrn-B3, and Vrn-D3 loci in hexaploid wheat [11], mapped on chromosomes 7A, 7B, and 7D, respectively [10,12]. In most wheat varieties, Vrn-1 is up-regulated by either vernalization or by mutations in the Vrn-1 gene itself. Vrn-1 activates expression of Vrn-3 (FT1) by binding directly to the promoter of Vrn-3 (FT1) and precedes long-day induction of Vrn-3 [10,13]. As yet, only Vrn-D4 in Vrn-4 alleles has been described, mapping on chromosome 5D [14].
Photoperiod response is an important genetic system determining flowering time and adaptation of wheat to different agro-climatic conditions. Photoperiod response genes play a key role in accelerating or delaying heading time under field conditions in spring-sown cultivars not sensitive to low temperature [15]. According to their response to day length, wheat varieties are mainly classified into two types: photoperiod insensitive (PI) and photoperiod sensitive (PS). PI varieties have a short delay in time to flowering while PS varieties display a significant delay in flowering under short day (SD) conditions (10 h light or less), provided that any vernalization requirements have been met. PI is mainly determined by Photoperiod-1 (Ppd-1) genes located on chromosomes 2A (Ppd-A1), 2B (Ppd-B1), and 2D (Ppd-D1) [4]. Ppd-1 genes are members of the pseudo-response regulator (PRR) family, orthologous to the Ppd-H1 gene of barley (Hordeum vulgare, 2n = 2x = 14, HH). Ppd-H1 has a CCT domain showing high similarity to Arabidopsis PRR7 [16,17], a gene with known circadian clock function [18]. When three wheat Ppd-1 members were individually introduced into the U.K. winter wheat variety ‘Mercia’, lines carrying Ppd-D1 were the earliest to flower under greenhouse conditions, those carrying Ppd-B1 the latest, and those with Ppd-A1 intermediate [15]. Therefore, Ppd-D1 confers a stronger effect on heading date than the other two Ppd-1 homologs [7,15]. Studies in hexaploid wheat revealed that a semi-dominant mutation is present in upstream of the coding region of the PS allele Ppd-D1b. A 2089 bp deletion mutation in Ppd-D1b created the pseudo response regulator (PRR) gene (Ppd-D1a); this converts PS cultivars into PI cultivars [17]. Similarly, two Ppd-A1a alleles, with 1,027 bp or 1,117 bp deletions at the upstream coding region, are also associated with photoperiod insensitivity [19]. In contrast to Ppd-A1 and Ppd-D1, no sequence insertions and/or deletions are present in Ppd-B1a and Ppd-B1b [17]. Previous studies also did not reveal any mutation in the Ppd-B1 gene responsible for flowering in commercial wheat varieties. However, genetic and genomic approaches illustrated that the alleles alter flowering time through increasing gene copy number and further modifying gene expression [20].
When environmental requirements for vernalization and photoperiod have been fulfilled, different wheat varieties still flower at different times even growing in the same environment. Such genetic differences are termed ‘earliness per se’ (eps) [21,22]. Photoperiod and vernalization response genes control flowering time of wheat in response to specific day length and temperature, whereas eps genes affect flowering time independent of environmental stimuli [1]. Genetic analyses indicate that eps genes have relatively smaller effects on flowering time than vernalization or photoperiod response genes, and are generally mapped as quantitative trait loci (QTL) rather than as major genes [23,24]. Since discovery of the first eps gene on the long arm of chromosome 2B by Scarth and Law [3], almost all wheat chromosomes have been found to carry Eps genes/QTL. They are most frequent on chromosomes 3A [21], 5A [23–26], 2B [3,27–29], 5B, 7B, and 4D [21, 30,31].
Numerous studies have revealed that common wheat, both hexaploid and tetraploid, has relatively narrow genetic variations. This not only increases vulnerability to environmental stresses but seriously limits wheat productivity and end-use quality [32–35]. Wild emmer wheat (Triticum turgidum L. subsp. Dicoccoides (TDIC), 2n = 4x = 28; genomes BBAA) is the progenitor of durum wheat and the donor of the A and B genomes of hexaploid wheat. It potentially contains novel alleles that would be useful in modern breeding programs, such as grain yield, grain protein, disease resistance and tolerance to stresses [36–40].
Chromosome engineering was used to create a set of chromosome arm substitution lines (CASLs) of wild emmer line TDIC140 in the background of common wheat cultivar ‘Chinese Spring’ (CS) [39–41]. The present study employed a field experiment to examine heading date variation among these CASLs. The heading dates of CASLs 4AL and 2BS were 21.4 and 13.8 days later than CS, respectively, while those of CASLs 3AS, 7BS, and 3AL were 4.6, 6.2, and 8.4 days earlier than CS. Use of F2 populations derived from crosses between CASL2BS and CS or CASL3AL revealed that an important heading date related QTL was consistently mapped on chromosome 2BS. Based on locations corresponding with the QTL, Ppd-B1 was deduced to be the best candidate gene for the late heading of CASL2BS.
Materials and Methods
Plant materials and mapping populations
The materials used in this study included 28 CASLs and their parents (TDIC140 and CS, Table 1), which were kindly provided by Dr. Feldman at the Weizmann Institute of Science, Israel. TDIC140 is a wild emmer accession collected in its primary habitat between Rosh Pinna and Zefat, Eastern Galsee, Israel and has high grain protein content and large grains [37, 39]. These CASLs were developed by Feldman et al. [37] through crosses between TDIC and CS DT lines and seven backcrosses of the resultant offspring to corresponding DT lines, coupled with cytogenetic verification of the chromosome constitution in each generation [37, 39]. In each CASL, a pair of targeted TDIC chromosome arms was confirmed by SSR markers as having replaced its homologous CS pair [40]. To determine the QTLs for later heading date of CASL2BS, two cross combinations of CASL2BS × CS and CASL3AL ×CASL 2BS were made to develop F2 mapping populations, which were planted at two sowing times (November 10, 2012 and January 26, 2013) forming four F2 segregating populations named E1-E4 (Table 2).
Field experiment and statistical analysis
Twenty-eight CASLs and their parents (CS and TDIC140) were planted in our university farm at normal sowing season (November 10th) of 2012 using a randomized block design to evaluate heading date. About 10 seedlings of each genotype were planted at spacing of 15 cm in a row, with rows 40 cm apart and 1.5 m in length. Each genotype was repeated five times. F2 plants were also planted at spacing of 15 cm in a row, with rows 20 m long. The heading date of each F2 plant was recorded when 50% of the ears emerged from their flag leaves. Duncan’s multiple comparisons were used as a measurement of significance among CASLs and between CASLs and CS (P = 0.01).
DNA extraction and molecular marker analysis
Approximately 0.2 g fresh leaf tissue was collected for DNA extraction by the cetyl trimethyl ammonium bromide method (CTAB) described by Khavkin and Coe [42]. To map the Ppd-B1 gene, its conserved sequence was used to design primers (forward: 5’-GTTACTATCTCTCATGGTGTAT-3’ and reverse: 5’-AGCAGTTTCCTCGTACAGTTTA-3’) for development of a corresponding SSCP (Single-Strand Conformation Polymorphism) marker. A total of 45 SSR markers were first selected from the published genetic maps of chromosome 2BS to screen for polymorphisms between the two parents (CS and TDIC140) [43–48]. All primer pairs were synthesized by Shanghai Sangon Biotechnology Company Limited. The PCR mixture contained 50 ng DNA, 2.5 mM MgCl2, 1.5 mM deoxyribonucleotide triphosphate, 1.5 μL 10x PCR buffer (Sangon, Shanghai, China), 1.5 μM of each primer, and 1 U Taq DNA polymerase in a total volume of 15 μL. The PCR conditions varied slightly among different primers according to their annealing temperature, but most use cycling conditions similar to: 3 min at 95°C followed by 30 cycles of 45 s at 94°C, 40 s at the optimized annealing temperature, and 45 s at 72°C. After cycling, the reactions were incubated at 72°C for 7 min. The PCR products were separated with 8% polyacrylamide gels. Gels were electrophoresed at constant voltage (180 V) for 1h and processed with a silver staining method described by Bassam et al. [49]. SSCP analysis of Ppd-B1 was carried out as reported [50].
Linkage map construction
Linkage analysis was performed using MapMaker/exp Version 3.0. The Kosambi mapping function [51] with a minimum LOD (Logarithm of the odds) threshold of 3.0 and a linkage threshold significance of P = 0.05 was applied to transform recombination frequencies into genetic distances in centiMorgans. Linkage groups were assigned to chromosomes based on the published genetic maps (available at the Grain Genes website at http://wheat.pw.usda.gov).
QTL analysis on chromosome arm 2BS and estimation of epistatic effects
QTLs were detected with the WinQTLCart2.5 software by composite interval mapping (CIM) [52,53] using the Zmapqtl model 6 with a window size of 10 cM and a 1 cM walk speed. The statistical significance thresholds used to declare the presence of QTLs were determined by 1,000 random permutations with a genome-wide type I error rate of 5% [54]. The 90% likelihood interval of QTL locations was determined by one LOD intervals surrounding the QTL peak [55].
The epistatic and additive effects among QTLs were examined with QTL Network 2.0 [56,57]. The 1D search for the main effect QTL was done with a 10-cM testing window, 1-cM walking speed, and 10-cM filtration window. The total effects of two examined QTLs must have a P value less than 1×10−5 and interaction effects must have a P value less than 0.01 to be deemed significant.
Copy number analysis of Ppd-B1 by TaqMan® assays
TaqMan assays used 20 μL reactions comprising water (6.4 μL), Passive Reference Dye (50X, 0.4μL) TransStart® Probe qPCR SuperMix (10μL), Probe plus primers (10μM, 0.4μL) and DNA (2μL). Samples were denatured at 95°C for 3 min followed by 40 cycles of [95°C for 15 sec, 57°C for 20 sec, 72°C for 30 sec]. Forward and reverse primers for Ppd-B1 were gcgtaagttactatctctcatggtgtatc and tttgttttagtacccagtaccataccag (0.2 μM each) and the probe sequence was FAM-ctgctgcttcagttcctagtttcacttgtgtcc-BHQ1(0.2 μM). Forward and reverse primers for the TaCO2 control were tgctaaccgtgtggcatcac and ggtacatagtgctgctgcatctg (0.2 μM each) and the probe sequence was FAM-catgagcgtgtgcgtgtctgcg-bhq1 (0.2 μM). Ppd-B1 was analyzed together with the control in multiplexed reactions [20].
Time-course RT-qPCR
RNA was extracted from seedlings of CS, TDIC140 and CASL2BS, grown in a controlled environment room with short day treatment (15 hrs light at 16°C and 9 hrs dark at 14°C) for 30 days after germination. Leaves were harvested every 3 hrs over a 24 hr period from at least three plants per time point per genotype (biological replicates) and immediately frozen in liquid nitrogen. RNA extraction was performed by using PureLinkRNA mini kits (Invitrogen) in combination with TRIzol reagent (Invitrogen) as described by the manufacturer. DNA was removed by DNaseI digestion. cDNA was synthesized with Superscript II (Invitrogen) using the manufacturer’s protocols with 5μg of total RNA as template and a mixture of Oligo dT(12–18) (250 ng) and random hexamers (150 ng) as primers. Real-time PCR used 1/40 by volume of the final cDNA aliquot as described below. Primer pairs for time course expression of clock genes including Photoperiod-1 (Ppd-1), FLOWERING LOCUS T (FT), LUXARRHYTHMO (LUX) were as follows; Ppd-1 specific primers: agacgattcattccgctcc and agcagcaccatttgacagg. FT specific primers: gcaggaggtgatgtgctacgag and aggttgtagagctcggcgaagt. LUX specific primers: cggctacggttttgacttcggg and ccctgcatccgcttgacgtagag [58].
Results
Variation of heading dates regulated by different TDIC chromosome arms
The 28 CASLs and the recipient parent CS grown in the field showed obvious and statistically significant variations in heading date. CASLs 3AS, 3AL, 4AL, 2BS, and 7BS displayed the most significant differences in heading date compared with CS (Table 1). There was approximately 1 month’s difference in heading date between the earliest (3AL) and latest (4AL). CASLs 4AL and 2BS started ear emergence about 21.4 and 13.8 days later than CS, respectively, while CASLs 3AS, 7BS, and 3AL were 4.6, 6.2, and 8.4 days earlier than CS (Table 1). This suggests that genetic loci accelerating heading of CS were located on chromosomes 3AS, 3AL and 7BS of wild emmer, with loci on chromosome arms 4AL and 2BS delaying heading of CS.
Segregation analysis of heading date in the F2 populations
CASL2BS started ear emergence about 13.8 days later than CS, while CASL3AL was about 8.4 days earlier than CS when planted at the normal sowing time (Nov. 10, 2012) in Zhejiang, China. When sowed in the cold season (January 26, 2013), heading dates of these lines were about 40 days less than when grown at the normal winter sowing time.CS and CASL3AL were crossed with CASL2BS to map QTLs related to later heading on TDIC chromosome arm 2BS. All tested F2 mapping populations displayed continuous variation in heading date. No transgressive segregation was found in three of the four populations, with maximum and minimum heading dates not significantly different from those of their corresponding parents. In population E3, CASL2BS was a little earlier than the latest F2 plants. F2 populations of two cross combinations showed a similar segregation pattern for heading date (Fig 1) when planted at two different times, though the average heading date of the later plantings (E2 and E4) was much earlier than the earlier plantings (E1 and E3), approximately 120 vs. 160 days (Table 2). The heading dates of the four F2 populations showed a continuous distribution, but skewed toward the two earlier heading parents, CS and 3AL. A Shapiro-Wilk test confirmed that distributions were all non-normal (P < 0.001), suggesting that alleles controlling heading date located on CS chromosome 2BS might dominate those of TDIC140. Using the middle heading date as the dividing point, most F2 plants in all four populations were classified as having earlier heading (Table 3). The ratios of F2 plants in ‘earlier’ versus ‘later’ groups did not deviate significantly from 3:1 segregation (E1: χ20.05, (1) = 0.19; E2: χ20.05, (1) = 0.18; E3: χ20.05, (1) = 0.15; E4: χ20.05, (1) = 0.30<χ20.05, (1) = 3.84), indicating that a dominant allele on 2BS might be responsible to early heading.
M: Middle value; CS: Chinese Spring; 2BS: CASL2BS; 3AL: CASL3AL; E1:CASL2BS×CS (Planting time: 11/10/2012); E2: CASL2BS×CS (Plant time:1/26/2013); E3: CASL3AL×CASL 2BS (Planting time: 11/10/2012); E4:CASL3AL×CASL 2BS (Planting time: 1/26/2013).
Linkage map construction of chromosome arm 2BS
Among forty-five SSR primer pairs previously mapped on chromosome arm 2BS [40,43,46], 13 (28.9%) displayed polymorphism between the two parents (CS and CASL2BS). To add to the density of the genetic map, an additional 120 SSR primer pairs located in the interval between Xwmc661 and Xbarc128 according to the published whole genome sequences [40,43,46] were developed and named with our university abbreviation (ZAFU) followed by numbers for different primers. Among these 120 SSRs, only 9 (7.5%) showed polymorphism between the two parents (S1 Table). A Ppd-B1 primer pair, designed based on conserved regions of the Ppd-B1 gene, also detected polymorphism between CS and TDIC by the SSCP method [50]. The whole set of CASLs was screened using this marker, with only CASL2BS showing the same amplification band as TDIC140 (Fig 2), confirming that the Ppd-B1 gene is located on chromosome arm 2BS as reported by Laurie [4]. All F2 plants from these four populations were combined to construct a linkage map of chromosome 2BS, including 23 DNA markers spanning 53.1 cM with an average distance between markers of 2.3 cM (Fig 3). Ppd-B1 was mapped between ZAFU4 and ZAFU5 at distances of 1.3 and 2.2 cM, respectively.
C: CS; and T: TDIC140. The black arrow indicates the TDIC band in CASL2BS (#17).
QTL analysis on chromosome arm 2BS and estimation of interactions with QTL on 3AL
An important QTL related to ear emergence was consistently detected in four mapping populations with large LOD scores at an interval of 3.5 cM between ZAFU4 and ZAFU5 (Table 4, Fig 3). This indicated a key gene exists on 2BS involved in regulating the ear emergence of CASL2BS, and its function is not significantly affected by the range of environmental conditions in this study. In this QTL region, the Ppd-B1 gene locus explained the largest portions of phenotypic variation, of 57.24% and 76.72% in E1 and E2 F2 populations, with LOD scores of 15.63 and 19.09 respectively. Ppd-B1 explained lower portions of phenotypic variation in E3 and E4 populations from CASL3AL × CASL2BS, at 23.64% and 29.31% with similarly large LOD scores of 9.96 and 15.77 respectively (Table 4). Therefore, Ppd-B1b of TDIC140 is a critical allele for the later heading of CASL2BS.
The QTL Network 2.0 program was used to detect interactions among QTLs conferring later and earlier heading in the CASL3AL × CASL2BS F2 population. A significant (P<0.05) dominance by additive effect was observed between the Ppd-B1a locus on chromosome arm 2BS and LUX locus on 3AL(S1 Fig), with an estimated dominance by additive value of 1.92[58].
Copy number variation (CNV) of Ppd-B1 and expression analysis of flowering genes
To determine copy number of Ppd-B1 in CS, TDIC140 and CASL2BS, a specific quantitative TaqMan® assay was developed. Part of the wheat CONSTANS2 gene (TaCO2, also called TaHd1 [20]) was used as an internal control. By this assay, TDIC140 and CASL2BS were confirmed to carry one haploid copy (i.e. one copy per 2B chromosome), while CS had four copies (Fig 4).
Solid circles are genotypes known to have a photoperiod sensitive (Ppd-B1b) allele and open circles are genotypes known to have a day neutral (Ppd-B1a) allele. Copy number was estimated based on the Ppd-B1/Internal Positive Control (IPC) signal ratio. Means and standard deviations of three measurements are shown. T-tests show the classes that differed significantly from one another (*p<0.001).
To reveal if increased copy number changed the expression of key flowering genes and further affected the heading time of CS and CASL 2BS, RT-qPCR was applied to analyze their expression per time point per genotype over 24 hrs. The expression of Ppd-1, LUX and FT genes in CS were generally higher than CASL2BS and TDIC140 from dawn (6:00 AM) to night (21:00 PM). In constant sunlight, the expression of LUX and FT genes gradually increased from dawn (6:00 AM) to night (21:00 PM) in CS, while the LUX and FT genes in CASL2BS did not change noticeably in expression over the whole time period (Fig 5), suggesting that increased copy number of Ppd-B1 could enhance the expression of Ppd-1. As a result, LUX and FT genes may be expressed at higher levels in CS than CASL2BS, conferring earlier heading in long days.
Sampling was performed on 30-day-old seedlings starting at 6:00 AM (Time = 0) of the second day under long days (15 h light / 9 h dark). Leaves were harvested every 3 hrs from at least three plants per time point per genotype (biological replicates). Error bars indicate standard error of the mean. A sterisks show probabilities that the respective alleles in CS, CASL2BS and TDIC140 have expression levels that are not significantly different, based upon T tests (* p<0.001).
Discussion
CASLs of TDIC140 in the CS background are powerful genetic tools for mapping qualitative and quantitative traits
Due to its importance in wheat breeding, extensive research about heading date has been carried out, and numerous related QTLs have been mapped on nearly all chromosomes of the three homoeologous groups (A, B, and D) of hexaploid wheat. The main reasons for this are the small effects of each QTL and the effects of environmental factors on heading date. Another important explanation for these phenomena is non-linear interactions among different genes and genetic systems [10,11,59].
Many kinds of mapping populations have been explored in heading date QTL studies, including doubled haploid (DH) lines and single seed descent recombinant inbred lines (RILs) [25–28, 30, 60, 61]. Using RILs, Maccaferri et al. [29] mapped QTLs related to heading date on chromosome arms 2A, 2B, and 7B in tetraploid wheat. As CASLs used in this study each carry only one TDIC140 arm, they can reduce interference from genes on other chromosomes; making them very powerful for locating qualitative genes. By using parallel CASLs with the same TDIC chromosome arm in the common wheat background (Bethlehem), genes of red coleoptile, waxless plant, brittle rachis, and resistance to several powdery mildew races were allocated to chromosomes 7A, 2BS, 3AS and 3BS, and 2BS, respectively [39,41]. In this study, CASLs 4AL, 2BS, 3A, and 7BS were found to have significantly different heading dates from the recipient parent (CS) following examination over 2 years. This suggests that CASLs 4AL, 2BS, 3A, and 7BS carry important genes related to heading date, and will be of great use in mapping QTLs conferring this complicated trait. An important heading date QTL was consistently mapped in the same region in two mapping populations in both years, and provides a good example of the power of CASLs for mapping complex traits. Presently, this set of CASLs is being used to map genes related to heading date on chromosomes 3AL, 4AL, and 7BS.
QTLs are linked to or contain genes associated with small effects on one specific phenotype; these are difficult to map and are further cloned using temporary mapping populations. Inbred lines are stable and powerful for mapping QTLs. For example, use of sub-introgression lines (ILs) allowed the mapping of QTLs governing leaf morphology and yield related traits in tomato [62–64]. The CASLs used in the present study were confirmed as mainly carrying specific chromosomal arms [40], so resemble an IL. A whole chromosome arm is still large for mapping as it likely carries many genes in addition to the one(s) of interest; these may mask or disturb the function of the targeted genes. ILs with smaller TDIC segments may be created by crossing CASLs with their common wheat parent, and then backcrossing the resulting F1 population a few times, using common wheat as the recurrent parent. The resulting ILs will prove powerful for gene identification and cloning, and are presently being constructed in our laboratory.
Probable mechanism of the Ppd-B1 gene in regulating flowering time
Different wheat germplasm has varied responses to day length, some being very sensitive while others are insensitive. These differences in response are mainly determined by genes located on homoeologous group 2 chromosomes [4]. Most wild wheat races are sensitive to day length. TDIC140 is a landrace native to Israel, and shows a sensitive response to day length [65,66]. Compared with CS, genes on TDIC140 chromosome 2BS are more sensitive to day length, leading to the heading date of CASL2BS being later than that of CS.
An important QTL identified in the four F2 segregating populations involving CASL2BS could explain much of the heading date variation between CASL2BS and CS, suggesting that a key gene determining heading date is located on chromosome arm 2BS. Consistent with findings reported by Mohler et al.[67], the QTL mapped in this study corresponded to Ppd-B1 on the genetic map, implying that Ppd-B1 is the most likely candidate gene for the QTL. There are many explanations for how photoperiod sensitive alleles of Ppd-1 affect variation of heading time among different wheat varieties. For instance, insertions, deletions, or point mutations in these alleles can all be underlying reasons causing flowering time variation in different wheat varieties [17,19,68,69]. Díaz et al. [20] reported that alleles with increased Ppd-B1 copy number confer an early flowering day neutral phenotype, indicating that copy number variation plays a critical role in wheat adaptation. We found that CASL2BS had one haploid copy of Ppd-B1, while ‘Chinese Spring (CS)’ had four copies. We infer that the later heading of CASL2BS than CS was caused by the Ppd-B1 copy number difference between them. This study also revealed that increased copy number of Ppd-B1 has a close relationship with higher expression of flowering gene Ppd1 from dawn (6:00 AM) to night (21:00 PM) in CS than CASL2BS, which probably cause FT and LUX (a candidate gene in CS responsible for the earliness per se 3 (Eps-3Am) locus on chromosome 3AL [58]) to have higher expression in CS than in CASL2BS, and finally lead CS to have a day neutral and earlier flowering phenotype than CASL2BS. Analysis of Ppd-B1 protein sequences between CS and TDIC140 revealed one AA mutant and one AA deletion locus (S2 Fig). The AA deletion locus was speculated to be a key motif within a phosphoacceptor site phosphorylated by histidine kinase homologues. Whether the AA deletion can affect Ppd-B1 protein activity and alter flowering time in CASL2BS needs further investigation.
Complexity of the genetic system regulating flowering time
Some QTLs related to flowering time cannot easily be detected, even when two parents with large differences in flowering time are used to develop the mapping population. For example, differences in flowering time between genotypes that are a consequence of interactions among different genes and genetic systems are difficult to detect as QTLs in some populations. QTLs governed by Ppd-B1 could consistently be detected in two environments (spring sowing and winter sowing), indicating that Ppd-B1 was stably expressed.
When the software QTL Network 2.0 was used to investigate interactions among QTLs conferring later and earlier heading, a significant (P < 0.05) dominance by additive interaction was observed between a locus on 3AL (probably LUX) and the Ppd-B1 locus on 2BS. The Ppd-1b allele influences flowering time by down-regulating the vernalization genes VRN3/FT and TaHd1 under short day conditions [59]. Furthermore, the vernalization gene Vrn-3 promotes the transcription of Vrn-1 alleles located on different chromosomes and thereby accelerates flowering [10,11]. Genetic interactions affecting flowering time are common in wheat. The strong interaction between genes on chromosome arms 2BS and 3AL reported in this study provides an important addition to the model explaining the complex mechanism of wheat flowering time. Whether other interactions exist between QTLs conferring later heading (4AL) and earlier heading (3AS, 3AL, and 7BS) in wheat requires further study, which is ongoing in our laboratory.
Supporting Information
S1 Fig. Identification of the LUX-A gene on chromosome arm 3AL by SSCP analysis of 28 CASLs (#1-#28) and their parents.
To map the LUX-A gene, its special region between A and B genome was used to design primers (forward: 5’-CGGCGGCTATGGAGGGTACGA-3’ and reverse: 5’-GAGGTGGCTGGCGACGTTCT-3’) for development of a corresponding SSCP marker. C: CS; and T: TDIC140. The black arrow indicates the TDIC band in CASL3AL (#6).
https://doi.org/10.1371/journal.pone.0147377.s001
(TIF)
S2 Fig. Sequence comparison of Ppd-B1 proteins between CS, TDIC140 and Ppd-B1a (the day neutral allele, the NCBI accession number is AB646974).
Black boxes indicate the sites of variation: one A.A deletion, and one A.A mutation.
https://doi.org/10.1371/journal.pone.0147377.s002
(TIF)
Acknowledgments
The 28 CASLs and their parents (CS and TDIC 140) were kindly provided by Prof. M. Feldman at Weizmann Institute of Science, Israel. This work was supported by NSFC (31071421), Zhejiang province public technology applied research projects (2014C32027), ZJNSF(LQ12C13003), the Zhejiang province science and technology development special project on breeding new varieties of wheat and barley (2012C12902-2-6) and the Program for Zhejiang Leading Team of S&T Innovation (2011R50026-24).
Author Contributions
Conceived and designed the experiments: JKR. Performed the experiments: SSW JJL MQD ZBS WW JLG HZ YRJ. Analyzed the data: SSW WZ JKR. Contributed reagents/materials/analysis tools: JKR WZ. Wrote the paper: JKR WZ SSW.
References
- 1. Worland AJ. The influence of the flowering time genes on environmental adaptability in European wheats. Euphytica 1996; 89: 49–57.
- 2. Distelfeld A, Tranqusli G, Li C, Yan L, Dubcovsky J. Genetic and molecular characterization of the VRN2 loci in tetraploid wheat. Plant physiol. 2009; 149:245–257. pmid:19005084
- 3. Scarth R, Law CN. The location of the photoperiodic gene, Ppd2, and an additional genetic factor for ear-emergence on chromosome 2B of wheat. Heredity 1983; 51: 607–619.
- 4. Laurie DA. Comparative genetics of flowering time. Plant Mol Biol. 1997; 35:167–177. pmid:9291970
- 5. Rawson HM, Zajac M, Penrose LDJ. Effect of seedling temperature and its duration on development of wheat cultivars differing in vernalizing response. Field Crop Res. 1998; 57: 289–300.
- 6. Pugsley AT. A genetic analysis of the spring-winter habit of growth in wheat. Aust J Agr Res. 1971; 22:21–31.
- 7. Law CN, Sutka J, Worland AJ. A genetic study of day-length response in wheat. Heredity 1978; 41:185–191.
- 8. Dubcovsky J, Lijavetzky D, Appendino L, Tranquilli G, Dvorak JD. Comparative RFLP mapping of Triticum monococcum genes controlling vernalization requirement. Theor Appl Genet. 1998; 97: 968–975.
- 9. Fu D, Szűcs P, Yan L, Helguera M, Skinner JS, Zitzewitz J, et al. Large deletions within the first intron in VRN-1 are associated with spring growth habit in barley and wheat. Mol Genet Genomics 2005; 273:54–65. pmid:15690172
- 10. Yan L, Fu D, Li C, Blechl A, Tranqusli G, Bonafede M, et al. The wheat and barley vernalization gene VRN3 is an orthologue of FT. Proc Natl Acad Sci USA 2006;103: 19581–19586. pmid:17158798
- 11. Yoshida T, Nishida H, Zhu J, Nitcher R, Distelfeld A, Akashi Y, et al. Vrn-D4 is a vernalization gene located on the centromeric region of chromosome 5D in hexaploid wheat. Theor Appl Genet. 2010;120:543–552. pmid:19847391
- 12. Bonnin I, Rousset M, Madur D, Sourdille P, Dupuits C, Brunel D, et al. FT genome A and D polymorphisms are associated with the variation of earliness components in hexaploid wheat. Theor Appl Genet. 2008;116: 383–394. pmid:18040656
- 13. Deng W, Casao MC, Wang P, Sato K, Hayes PM, Finnegan EJ, et al. Direct links between the vernalization response and other key traits of cereal crops. Nat Commun. 2015; 6:5882. pmid:25562483
- 14.
Kato K, Yamashita M, Ishimoto K, Yoshino H, Fujita M. Genetic analysis of two genes for vernalization response, the former Vrn2 and Vrn4, by using PCR based molecular markers. In: Pogna NE, Romano M, Pogna EA, Galterio G, editors. Proceedings of the 10th international wheat genetics symposium. Paestum: Instituto Sperimentale per la Cerealicoltura; 2003.pp. 971–973.
- 15. Snape JW, Butterworth K, Whitechurch E, Worland AJ. Waiting for fine times, genetics of flowering time in wheat. Euphytica 2001;119:185–190.
- 16. Turner A, Beales J, Faure S, Dunford RP, Laurie DA. The pseudo-response regulator Ppd-H1 provides adaptation to photoperiod in barley. Science 2005; 310: 1031–1034. pmid:16284181
- 17. Beales J, Turner A, Griffiths S, Snape JW, Laurie DA. A Pseudo-Response Regulator is misexpressed in the photoperiod insensitive Ppd-D1a mutant of wheat (Triticum aestivum L.) Theor Appl Genet. 2007; 115:721–733. pmid:17634915
- 18. Nakamichi N. Molecular mechanisms underlying the Arabidopsis circadian clock. Plant Cell Physiol. 2011; 52:1709–1718. pmid:21873329
- 19. Wilhelm EP, Turner AS, Laurie DA. Photoperiod insensitive Ppd-A1a mutations in tetraploid wheat (Triticum durum Desf.). Theor Appl Genet. 2009;118: 285–294. pmid:18839130
- 20. Díaz A, Zikhali M, Turner AS, Isaac P, Laurie DA. Copy number variation affecting the Photoperiod-B1 and Vernalization-A1 genes is associated with altered flowering time in wheat (Triticum aestivum.). Plos One 2012; 7:e33234. pmid:22457747
- 21. Hoogendoorn J. A reciprocal F1 monosomic analysis of the genetic control of the time of ear emergence, number of leaves and number of spikelets in wheat (Triticum aestivum L.). Euphytica 1985; 34:545–558.
- 22. Kato K, Taketa S, Ban T, Iriki N, Miura K. The influence of a spring habit gene, Vrn-D1, on heading time in wheat. Plant Breeding 2001;120:115–120.
- 23. Kato K, Miura H, Sawada S. Detection of an earliness per se quantitative trait locus in the proximal region of wheat chromosome 5AL. Plant Breeding 1999a; 118:391–394.
- 24. Kato K, Miura H, Sawada S. QTL mapping of genes controlling ear emergence time and plant height on chromosome 5A of wheat. Theor Appl Genet. 1999b; 98:472–477.
- 25. Griffiths S, Simmonds J, Leverington M, Wang Y, Fish L, Sayers L, et al. Meta-QTL analysis of the genetic control of ear emergence in elite European winter wheat germplasm. Theor Appl Genet. 2009;119: 383–395. pmid:19430758
- 26. Bennett D, Izanloo A, Edwards J, Kuchel H, Chalmers K, Tester M, et al. Identification of novel quantitative trait loci for days to ear emergence and flag leaf glaucousness in a bread wheat (Triticum aestivum L.) population adapted to southern Australian conditions. Theor Appl Genet. 2012; 124: 697–711. pmid:22045047
- 27. Sourdille P, Cadalen T, Guyomarch H, Snape JW, Perretant MR, Charmet G, et al. An update of the Courtot-Chinese Spring intervarietal molecular marker linkage map for the QTL detection of agronomic traits in wheat. Theor Appl Genet. 2003;106:530–538. pmid:12589554
- 28. Shindo C, Sasakuma T, Tsujimoto H. Segregation analysis of heading traits in hexaploid wheat utilizing recombinant inbred lines. Heredity 2003; 90:56–63. pmid:12522426
- 29. Maccaferri M, Sanguineti MC, Corneti S, Ortega JLA, Salem MB, Bort J, et al. Quantitative trait loci for grain yield and adaptation of durum wheat (Triticum durum Desf.) across a wide range of water availability. Genetics 2008; 178:489–511. pmid:18202390
- 30. Kulwal PL, Roy JK, Balyan HS. QTL mapping for growth and leaf characters in bread wheat. Plant Sci. 2003;164:267–277.
- 31. Lin F, Xue DG, Tian CJ, Cao Y, Zhang ZZ, Zhang ZQ, et al. Mapping chromosomal regions affecting flowering time in a spring wheat RIL population. Euphytica 2008;164:768–777.
- 32. Chao S, Sharp PJ, Worland AJ, Warham EJ, Koebner RMD, Gale MD. RFLP-based genetic map of wheat homoeologous group 7 chromosomes. Theor Appl Genet. 1989;78:495–504. pmid:24225676
- 33. Reif JC, Zhang P, Dreisigacker S, Warburton ML, van Ginkel M, Hoisington D, et al.Wheat genetic diversity trends during domestication and breeding. Theor Appl Genet. 2005;110: 859–864. pmid:15690175
- 34. Dubcovsky J, Dvorak J. Genome plasticity a key factor in the success of polyploid wheat under domestication. Science 2007; 316:1862–1866. pmid:17600208
- 35. Haudry A, Cenci A, Ravel C, Bataslon T, Brunel D, Poncet C, et al. Grinding up wheat, a massive loss of nucleotide diversity since domestication. Mol Biol Evol. 2007; 24:1506–1517. pmid:17443011
- 36. Feldman M, Sears ER. The wild gene resources of wheat. Sci Am. 1981; 244:102–112.
- 37.
Feldman M, Millet E, Abbo S. Exploitation of wild wheat to increase yield and protein content in durum and common wheat. In: Balfourier F, Perretant MR, editors. Proceedings of European Association for Research on Plant Breeding meeting of the Genetic Resources Section. Clermont-Ferrand, France: European Association for Plant Breeding Research (EUCARPIA); 1994. pp. 151–161.
- 38.
Feldman M, Millet E. Methodologies for identification, allocation and transfer of quantitative genes from wild emmer into cultivated wheat. In: Li ZS, Xin ZY, editors. Proceedings of the 8th International Wheat genetics Symposium. Beijing, China: China Agriculture Science Technology Press; 1995. pp19–27.
- 39. Millet E, Rong JK, Qualset C, McGuire P, Bernard M, Sourdsle P, et al. Production of chromosome-arm substitution lines of wild emmer in common wheat. Euphytica 2013;190:1–17.
- 40. Zhou W, Jiang YR, Zhang W, Xu GF, Rong JK. Characterization of large chromosome segment introgressions from Triticum turgidum subsp. dicoccoides into bread wheat with simple sequence repeat markers. Crop Sci. 2013;53: 1555–1565.
- 41. Rong JK, Millet E, Manisterski J, Feldman M. A new powdery mildew resistance gene, introgression from wild emmer into common wheat and RFLP-based mapping. Euphytica 2000;115: 121–126.
- 42. Khavkin E, Coe E. Mapped genomic locations for developmental functions and QTLs reflect concerted groups in maize (Zea mays L.) Theor Appl Genet.1997; 95:343–352.
- 43. Röder MS, Korzun V, Gsl BS, Ganal MW. The physical mapping of microsatellite markers in wheat. Genome 1998;41: 278–283.
- 44. Pestsova E, Salina E, Börner A, Korzun V, Maystrenko OI, Röder MS. Microsatellites confirm the authenticity of inter-varietal chromosome substitution lines of wheat (Triticum aestivum L.). Theor Appl Genet. 2000;101:95–99.
- 45. Paillard S, Schnurbusch T, Winzeler M, Messmer M, Sourdsle P, Abderhalden O, et al. An integrative genetic linkage map of winter wheat (Triticum aestivum L.). Theor Appl Genet. 2003;107:1235–1242. pmid:12898031
- 46. Somers DJ, Isaac P, Edwards K. A high-density microsatellite consensus map for bread wheat (Triticum aestivum L.). Theor Appl Genet. 2004;109:1105–1114. pmid:15490101
- 47. Song QJ, Shi JR, Singh S, Fickus EW, Costa JM, Lewis J, et al. Development and mapping of microsatellite (SSR) markers in wheat. Theor Appl Genet 2005;110:550–560. pmid:15655666
- 48. Xue SL, Zhang ZZ, Lin F, Kong Z, Cao Y, Li CJ, et al. A high density intervarietal map of the wheat genome enriched with markers derived from expressed sequence tags. Theor Appl Genet. 2008;117:181–189. pmid:18437345
- 49. Bassam BJ, Caetano-Anollés G, Gresshoff PM. Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal Biochem. 1991;196: 80–83. pmid:1716076
- 50. He SE, Zheng YN, Chen AQ, Ding MQ, Lin LF, Cao YF, et al. Converting restriction fragment length polymorphism to single-strand conformation polymorphism markers and its application in the fine mapping of a trichome gene in cotton. Plant Breeding 2013;132: 337–343.
- 51. Kosambi DD.The estimation of map distance from recombination values. Annals of Eugenics 1944;12:172–175.
- 52. Zeng ZB. Theoretical basis for separation of multiple linked gene effects in mapping quantitative trait loci. Proc Natl Acad Sci USA 1993; 90:10972–10976. pmid:8248199
- 53. Zeng ZB. Precision mapping of quantitative trait loci. Genetics 1994; 136:1457–1468. pmid:8013918
- 54. Doerge RW, Churchill GA. Permutation tests for multiple loci affecting a quantitative character. Genetics 1996;142:285–294. pmid:8770605
- 55. Mangin B, Goffinet B, Rebai A. Constructing confidence intervals for QTL location. Genetics 1994;138:1301–1308. pmid:7896108
- 56. Yang J, Zhu J, Wsliams RW. Mapping the genetic architecture of complex traits in experimental populations. Bioinformatics 2007; 23:1527–1536. pmid:17459962
- 57. Yang J, Hu C, Hu H, Yu R, Xia Z, Ye X, et al. QTL Network, mapping and visualizing genetic architecture of complex traits in experimental populations. Bioinformatics 2008; 24:721–723. pmid:18202029
- 58. Gawroński P, Ariyadasa R, Himmelbach A, Poursarebani N, Kilian B, Stein N, et al. A distorted circadian clock causes early flowering and temperature-dependent variation in spike development in the Eps-3Am mutant of einkorn wheat. Genetics, 2014;196: 1253–1261. pmid:24443443
- 59. Kitagawa S, Shimada S, Murai K. Effect of Ppd-1 on the expression of flowering-time genes in vegetative and reproductive growth stages of wheat. Genes Genet Syst. 2012; 87:161–168. pmid:22976391
- 60. Börner A, Schumann E, Fürste A, Cöster H, Leithold B, Röder M. Mapping of quantitative trait loci determining agronomic important characters in hexaploid wheat. (Triticum aestivum L.). Theor Appl Genet. 2002;105:921–936. pmid:12582918
- 61. Zhang K, Tian J, Zhao L, Liu B, Chen G. Detection of quantitative trait loci for heading date based on the doubled haploid progeny of two elite Chinese wheat cultivars. Genetica 2009;135:257–265. pmid:18500653
- 62. Eshed Y, Zamir D. An introgression line population of Lycopersicon pennellii in the cultivated tomato enables the identification and fine mapping of yield-associated QTL. Genetics 1995;141:1147–1162. pmid:8582620
- 63. Alpert KB, Tanksley SD. High-resolution mapping and isolation of a yeast artificial chromosome contig containing fw2.2: a major fruit weight quantitative trait locus in tomato. Proc Natl Acad Sci USA 1996; 93:15503–15507. pmid:11038534
- 64. Holtan HE, Hake S. Quantitative trait locus analysis of leaf dissection in tomato using Lycopersicon pennellii segmental introgression lines. Genetics 2003;165: 1541–1550. pmid:14668401
- 65. Joppa LR.Chromosome engineering in tetraploid wheat. Crop Sci. 1993; 33: 908–913.
- 66. Peng JH, Ronin Y, Fahima T, Röder MS, Li YC, Nevo E, et al. Domestication quantitative trait loci in Triticum dicoccoides, the progenitor of wheat. Proc Natl Acad Sci USA 2003;100:2489–2494. pmid:12604784
- 67. Mohler V, Lukman R, Ortiz-Islas S, William M, Worland AJ, Beem J, et al. Genetic and physical mapping of photoperiod insensitive gene Ppd-B1 in common wheat. Euphytica 2004; 138: 33–40.
- 68. Shaw LM, Turner AS, Laurie DA.The impact of photoperiod insensitive Ppd-1a mutations on the photoperiod pathway across the three genomes of hexaploid wheat (Triticum aestivum). Plant J. 2012;71:71–84. pmid:22372488
- 69. Nishida H, Yoshida T, Kawakami K, Fujita M, Long B, Akashi Y, et al. Structural variation in the 5’upstream region of photoperiod-insensitive alleles Ppd-A1a and Ppd-B1a identified in hexaploid wheat (Triticum aestivum L.) and their effect on heading time. Mol Breeding 2013;31:27–37.