Browse Subject Areas

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Survey of Ixodes pacificus Ticks in California Reveals a Diversity of Microorganisms and a Novel and Widespread Anaplasmataceae Species

Survey of Ixodes pacificus Ticks in California Reveals a Diversity of Microorganisms and a Novel and Widespread Anaplasmataceae Species

  • Mark W. Eshoo, 
  • Heather E. Carolan, 
  • Christian Massire, 
  • Danny M. Chou, 
  • Chris D. Crowder, 
  • Megan A. Rounds, 
  • Curtis A. Phillipson, 
  • Steven E. Schutzer, 
  • David J. Ecker


Ixodes pacificus ticks can harbor a wide range of human and animal pathogens. To survey the prevalence of tick-borne known and putative pathogens, we tested 982 individual adult and nymphal I. pacificus ticks collected throughout California between 2007 and 2009 using a broad-range PCR and electrospray ionization mass spectrometry (PCR/ESI-MS) assay designed to detect a wide range of tick-borne microorganisms. Overall, 1.4% of the ticks were found to be infected with Borrelia burgdorferi, 2.0% were infected with Borrelia miyamotoi and 0.3% were infected with Anaplasma phagocytophilum. In addition, 3.0% were infected with Babesia odocoilei. About 1.2% of the ticks were co-infected with more than one pathogen or putative pathogen. In addition, we identified a novel Anaplasmataceae species that we characterized by sequencing of its 16S rRNA, groEL, gltA, and rpoB genes. Sequence analysis indicated that this organism is phylogenetically distinct from known Anaplasma species with its closest genetic near neighbors coming from Asia. The prevalence of this novel Anaplasmataceae species was as high as 21% at one site, and it was detected in 4.9% of ticks tested statewide. Based upon this genetic characterization we propose that this organism be called ‘Candidatus Cryptoplasma californiense’. Knowledge of this novel microbe will provide awareness for the community about the breadth of the I. pacificus microbiome, the concept that this bacterium could be more widely spread; and an opportunity to explore whether this bacterium also contributes to human or animal disease burden.


In the western United States Ixodes pacificus ticks are the vector of Borrelia burgdorferi, the causative agent of Lyme disease [1,2]. I. pacificus ticks are also vectors for several other vector-borne pathogens including Borrelia miyamotoi and Anaplasma phagocytophilum. In addition, I. pacificus ticks have been shown to carry Spiroplasma ixodetis [3], a microorganism that has no known role in human disease. Broad-range PCR and electrospray ionization mass spectrometry (PCR/ESI-MS) can detect multiple pathogens in a single test including tick-borne pathogens [414]. PCR/ESI-MS can also detect novel and uncharacterized organisms [10,12,1519]. We have previously used PCR/ESI-MS to characterize a large collection of ticks, including I. pacificus ticks from California, for the prevalence of B. miyamotoi [6]. Most studies of I. pacificus ticks have employed tests designed to detect single pathogens and not co-infections. In this study we used PCR/ESI-MS to characterize the breadth of microorganisms carried by I. pacificus collected from throughout the state of California. In the ticks analyzed, we detected several previously described endemic zoonotic pathogens as well as Babesia odocoilei, a protozoan not previously known to be carried by I. pacificus. Many of the microbes carried by ticks are obligate intracellular microbes and have not been cultured but have been identified and characterized genetically such as ‘Candidatus Rickettsia andeanae’, ‘Candidatus Rickettsia vini’ and ‘Candidatus Neoehrlichia mikurensis' [2023]. In our study we identified and genetically characterized a novel and widespread Anaplasmataceae species which is genetically most closely related to isolates from Asia.

Methods and Materials

Broad-range PCR/ESI-MS detection of tick-borne microorganisms

Broad-range PCR employs PCR primers designed to generate an amplicon from a wide range of microbes. Depending upon the organism(s) present in the sample the resulting amplicons will be comprised of differing composition of bases (the number of A’s, G’s, C’s and T’s aka base count). When these amplicons are analyzed by electrospray ionization mass spectrometry the base count of the amplicons can be determined and compared to a database to identify the organism(s) present. Nucleic acid extracts from ticks were screened for tick-borne microorganisms with three variations of a broad-range PCR/ESI-MS assay (Table 1). Primer set A includes 16 primer pairs designed to detect and identify a wide and diverse range of bacterial species. Primer set B includes two primer pairs designed to detect all Babesia species [5]. Primer set C consists of nine primer pairs designed to detect a wide range of bacterial and protozoan tick-borne pathogens that were previously described [5]. PCR amplicons were analyzed by electrospray ionization followed by time of flight mass spectrometry system (Abbott Laboratories, Des Plaines IL) as previously described [10,13,14,2427].

Tick collection and DNA extraction

I. pacificus ticks were collected from 2007 to 2009 in thirteen counties throughout the state of California by flagging (S1 Fig). All ticks tested were adults with the exception of 126 nymphal ticks collected in Sonoma County. All ticks were visually pre-identified as I. pacificus, and the species was confirmed in 96.9% of the ticks tested by the detection of the Rickettsia endosymbiont of I. pacificus [10]. No ethical clearance was required to conduct research on invertebrate ectoparasites. All samples were submitted by private collectors or collected by county vector control agencies from locations that did not require specific permission. These studies did not involve endangered or protected species. Ticks were either alive, frozen, or ETOH preserved prior to DNA extraction using a modified Qiagen column-based protocol described previously [28] with the substitution of the Qiagen DNAeasy columns (Qiagen, Valencia, CA) for the Qiagen Virus MinElute columns (Qiagen, Valencia, CA). A negative extraction control consisting of lysis buffer was included with each set of extractions and carried through the analysis to monitor for potential contamination.

Sequence confirmation of Anaplasmataceae detections

Nucleic acid extracts from three ticks (collected from different California counties) that showed the novel PCR/ESI-MS microorganism signature were selected for further sequence analysis. The 16S rRNA, groEL, gltA, and rpoB genes were sequenced by single molecule real-time DNA sequencing using the RS II DNA sequencer (Pacific Biosciences, Menlo Park CA). In addition, a tick positive for A. phagocytophilum from Placer County, CA was also selected for sequence analysis. The previously published primer pair 27F/1492R was used to amplify a 1,459-bp region of the 16S rRNA gene [29]. The groEL gene was amplified using a primer pair targeting an 851-bp region of the groEL gene present in Anaplasma, ‘Candidatus Neoehrlichia’, and Ehrlichia species (F-groEL: ATCTCTAAAGCTAAAGCTGCTGG and R-groEL: ACACCAACCTTAAGTACAGCAAC). The gltA gene was amplified using a primer pair derived from the published F4b-R1b primer pair [30] (F-gltA: ACCGGGTTTTATGTCTACTGC and R-gltA: CACGATGACCAAAACCCAT). The rpoB gene was amplified using primers designed to amplify a 600–650-bp region across Rickettsiales (F-rpoB: ATCGTTCCTGTTGAAGATATGCC and R-rpoB: GCAATGCCCAGCATTCCAT). PCR amplification of the target genes was performed in a 50-μL reaction with 1 unit of Platinum Taq DNA Polymerase High Fidelity, 1x High Fidelity PCR Buffer, 2 mM MgSO4, 0.2 mM dNTP mix, and 250 nM of each primer (Life Technologies, Carlsbad, CA). All PCR amplification reactions were performed on the MJ Dyad thermocycler (Bio-Rad Inc., Hercules, CA). The following PCR conditions were used to amplify the 16S rRNA gene locus: 94°C for 2 min, followed by 40 cycles of 94°C for 15 s, annealing at 47°C for 30 s, and 68°C for 2 min for cycle extension. The cycle ended with a final extension of 4 min at 68°C. Amplification of the groEL and gltA loci was performed using the same conditions with the exceptions of a 50°C annealing temperature and a 1.5-min cycle extension time. PCR amplification of the rpoB locus was performed as described for the groEL and gltA loci except that a 1-min extension time was used. PCR products from each sample were purified using the Qiagen MinElute PCR Purification Kit. After purification, libraries were prepared using 500 ng of amplicons and a modified version of Pacific Biosciences library preparation protocol that consisted of end-repair, adapter ligation, and exonuclease treatment of the PCR amplicons. The final sequencing library was purified using the Qiagen MinElute PCR purification kit. One SMRT cell was used to sequence each amplicon library following diffusion loading. Sequencing data were analyzed using Pacific Bioscience’s RS_Long_Amplicon_Analysis.1 protocol in the SMRT Analysis v2.2.0 software package to cluster, error correct, filter out chimeras, and build consensus sequences. Sequences were deposited in GenBank under accession numbers KP276585 to KP276611.

Sequence alignments and phylogenetic analyses

Alignments of the full-length 16S rRNA, gltA, groEL, and rpoB were constructed from representative Anaplasmataceae sequences using data from complete genomes or type strains. Sequences GU075704 and JN715833 were identified by preliminary BLAST searches as the closest relatives of the novel Anaplasmataceae species and were included in the ribosomal alignment. Sequence alignments were generated using ClustalW and were manually curated using secondary structure pairing constraints with Bioedit software [31] (S1, S2, S3 and S4 Alignments) to yield, after exclusion of the primer sequences and non-conserved indels, ungapped alignments for 16S rRNA (1,347 bp, N = 26 sequences), groEL (804 bp, N = 23), gltA (720 bp, N = 23) and rpoB (555 bp, N = 19) (S1, S2, S3 and S4 Text). Identity score matrices were generated with Bioedit from the curated alignments (S1, S2, S3 and S4 Data). Phylogenetic analyses were performed using the online program suite at using the “A la Carte” menu [32] on the curated alignments. Maximum-likelihood trees were constructed as described [33,34] and edited using TreeDyn [35].


Survey of tick-borne pathogens by broad-range PCR/ESI-MS

A total of 982 individual ticks were tested by broad-range PCR/ESI-MS for the presence of tick-borne pathogens and other microorganisms. All ticks tested were adults except for 126 nymphal ticks collected at a single site in Sonoma County. The summary of the non-endosymbiont microorganism detections is reported in Table 2. The Rickettsia endosymbiont of I. pacificus [10] was detected in 96.9% (952/982) of the ticks tested (Table 3), confirming the tick species assignments. In addition to the endosymbiont, at least one tick-borne microorganism was detected in 14.9% of the ticks surveyed (146/982), with co-infections detected in 1.2% of the ticks (Table 2).

Table 2. Prevalence of microorganisms in I. pacificus ticks in California by PCR/ESI-MS.

Table 3. PCR/ESI-MS signatures of Rickettsiaceae and Anaplasmataceae species.

Though our Babesia primers are able to detect a wide range of Babesia species, the only species detected in California ticks was B. odocoilei, found in 3% (18) of the 574 ticks tested for Babesia. Not all of the specimens were tested due to limited nucleic acid extracts. This organism is known to be transmitted by Ixodes scapularis but has not previously been detected in I. pacificus ticks. Borrelia miyamotoi was found in 2% of the ticks tested, which we have previously reported [6]. Borrelia burgdorferi was found in 1.4% of the ticks, consistent with infection rates that have been reported by others [36]. In this study, Anaplasma phagocytophilum was detected in only 3 of the 982 ticks tested. Two of the A. phagocytophilum-positive ticks came from the same site in Placer County and the third detection was in a B. burgdorferi co-infected tick from Marin County. Spiroplasma ixodetis was found in 2% (16/770) of the ticks tested using the primer set that detects this organism. In addition to the Rickettsia endosymbiont of I. pacificus, 37 ticks tested yielded a PCR/ESI-MS base count signature similar, but not identical, to that of a spotted fever group Rickettsia species (Table 3). Though these signatures are highly consistent with one or more Rickettsia species, further analysis is needed to confirm the identity.

Identification and characterization of a novel Anaplasmataceae species

The most prevalent non-endosymbiont was a novel bacteria found in 4.9% (48/982) of the ticks tested. Ticks from China Camp State Park in Marin County had the highest observed infection rate of 22% (7/33) for this organism. The bacterium was detected in ticks collected throughout the state with detections in ticks collected in Aliso & Wood Canyons Wilderness Park in Orange County and at Patrick Creek in Del Norte County in the far northern part of the state. The PCR/ESI-MS signature of this novel bacterium was similar to that of A. phagocytophilum (Table 3). Given the breadth of coverage provided by the primer pairs used in the PCR/ESI-MS assay, this signature is consistent with the detection of a novel Anaplasmataceae species. Three representative tick samples containing this signature (samples CP-1, MR-9, and CC-14 from Napa, Placer, and Marin Counties, respectively) were selected for DNA sequence analysis. We also selected for sequencing one of the three ticks positive for A. phagocytophilum (sample MR-23 from Placer County) for sequencing. The four loci sequenced, the 16S rRNA gene, gltA, groEL and rpoB, were chosen to clarify the relationship of the novel species with named Anaplasma, Ehrlichia and ‘Candidatus Neoehrlichia’ species.

Phylogenetic trees were constructed based on the four sequenced genes and publicly available sequences of representative Anaplasmataceae and more distantly related Rickettsiales (Fig 1A–1D). The four single gene trees are largely congruent and show previously established features like the monophyly of the genera Anaplasma, Ehrlichia, and ‘Candidatus Neoehrlichia’ [23,37]. The split of Anaplasma species into two branches is also shown in the 16S rRNA, groEL and gltA trees, where all named Anaplasma species are represented [38]. Minor differences are observed within the exact branching order of species within the established clades, in particular for A. bovis [39]. Each tree firmly places the novel Anaplasmataceae microorganism on the branch leading to the Anaplasma clade [37]. The four gene sequences of the A. phagocytophilum isolate (MR-23) had 99.4% to 100% identity to the A. phagocytophilum genome sequence (GenBank NC_007797). The observed deviations from the reference genome sequence in the 16S rRNA gene (1 SNP) and gltA (2 SNPs) were shared with independent sequences of California isolates of A. phagocytophilum (AF172167, AF304137), suggesting that these differences are mostly likely unique to isolates from California.

Fig 1. Maximum-likelihood tree relationships among know Anaplasmataceae species and novel microorganism identified in this study inferred from (a) 16S rRNA, (b) groEL, (c) gltA, and (d) rpoB sequences.

Sequences determined in this study are highlighted in bold. Numbers at nodes indicate percentages of bootstrap support based on 100 replicates. The horizontal bars correspond to substitutions per nucleotide position in panel (a) and to substitutions per amino acid position in panels (b-d).

The sequences of the genes from the three samples of the novel Anaplasmataceae shared 99.5% to 100% sequence identity, confirming the detection of a common species in the three samples. The closest 16S rRNA sequence found in GenBank (98.0% identity or 1320/1347 identical positions) came from an uncultured Anaplasma sp. isolated from Haemaphysalis longicornis ticks from Jeju Island, Korea (accession numbers GU075699 to GU075704) [40] and Beijing, China (JN715833) (Fig 1). No groEL, gltA, or rpoB sequence is currently available for those isolates. The 16S rRNA sequence from our novel Anaplasmataceae bacterium shared 93.4% to 94.2% identity with characterized Anaplasma species and 91.1% to 91.6% identity with characterized Ehrlichia species (Fig 1A). In comparison, previously characterized Anaplasma species share over 95.2% identity across the 16S rRNA gene and only 90.4% to 92.9% identity with Ehrlichia species. The groEL, gltA, and rpoB sequences from the novel microorganism had relatively low homology with other sequences in GenBank; the groEL sequences were slightly more similar to Ehrlichia than to Anaplasma sequences. Accordingly, the four gene trees place the novel California isolate (together with the related Chinese and Korean clones for 16S rRNA) on an intermediate branch that predates the radiation of all validated Anaplasma species (Fig 1A–1D).

Phylogenetic analysis of the Rickettsia endosymbiont of I. pacificus

In our next generation DNA sequencing of the four ticks with Anaplasma we also determined the sequences of the Rickettsia endosymbiont 16S rRNA (GI: KP276589, KP276590 and KP276591), gltA (GI: KP276596, KP276597, KP276598, and KP276599), and rpoB (GI: KP276608, KP276609, KP276610, and KP276611) loci from four ticks. The groEL locus was not sequenced as it was not amplified due to primer design. No sequence variation was detected in the four tick specimens sequenced, and the sequences of the I. pacificus endosymbiont shared 100% identity with the recently published genome sequence. (Fig 1A–1D).


In this study of the microorganisms carried by I. pacificus ticks, we found B. burgdorferi and B. miyamotoi at frequencies consistent with those found by others [41]. Our broad-range PCR primers are capable of detecting and distinguishing a wide range of Borrelia species including B. americana, B. bissettii, and B. californiensis previously detected in I. pacificus ticks [4244]. Only B. miyamotoi and B. burgdorferi were observed in this study. As the study was performed over the course of several years, we were able to improve the throughput of the assay by reducing the number of primers used from 16 to 8 without affecting sensitivity or breadth of coverage for tick-borne pathogens.

This is the first observation of the protozoan parasite Babesia odocoilei in I. pacificus ticks. We detected this organism in 3.0% of the ticks tested from areas ranging from Humboldt County in the far northern part of California to San Bernardino County in Southern California, indicating that this pathogen is probably widespread among its known Cervidae and Bovidae hosts [45] in the state. B. odocoilei is known to be widely distributed in I. scapularis ticks throughout the eastern United States [45,46], where it is has been reported from as far north as Saskatchewan, Canada [47] to as far south as Tennessee [48] and is not known to cause human illness.

Approximately 4% of the ticks were infected with a microorganism with a base count signature consistent with a spotted fever group Rickettsia that was distinct from the characterized Rickettsia endosymbiont of I. pacificus. Further analysis is needed to determine whether this signature represents a novel spotted fever group Rickettsia or a genotypic variant of a known species.

Other than the endosymbiont, the most prevalent organism we found in the ticks was a previously undescribed Anaplasmataceae species; the base count signature of this novel species was detected in 4.9% of ticks analyzed. Analyses of the 16S rRNA gene, groEL, gltA, and rpoB sequences from three samples concur to place this novel organism in the Anaplasma/Ehrlichia/‘Candidatus Neoehrlichia’ clade, in a position ancestral to all known Anaplasma species. The 16S rRNA sequence was found to share a maximum of 94.2% identify with any named Anaplasma species (Anaplasma platys isolate Okinawa, AY077619), well below the threshold of 97% conservatively associated with distinct species. Indeed, this less than 95% homology indicates a distinct genus may also be warranted [49]. As different bacterial clades may evolve at differing rates it is important to look at the clade of interest and determine the precedence for establishing new genera. In the examination of the family Anaplasmataceae the now well-established ‘Candidatus Neoehrlichia’ taxon was recognized as a genus distinct from the related Ehrlichia genus following analysis of the 16S rRNA gene and groEL sequences [50]. With the recognition of a second ‘Candidatus Neoehrlichia’ species and further sequencing of the gltA and rpoB genes, the ‘Candidatus Neoehrlichia’ and Ehrlichia genera share an average sequence identity of 93.4%, 88.2%, 59.5% and 86.4% across 16S rRNA, groEL, gltA and rpoB (S1, S2, S3 and S4 Data). In comparison, the average identity computed between the novel California isolate and the established Anaplasma species is 93.6%, 84.7%, 58.6% and 83.0% across the same loci. In other words, the divergence seen between the California isolate and all named Anaplasma species is greater than the divergence seen between the established genera Ehrlichia and ‘Candidatus Neoehrlichia’, therefore providing strong phylogenetic evidence for the recognition of a new taxon at the genus level.

A survey of available 16S rRNA gene sequences for uncharacterized Anaplasmataceae led to the identification of several 16S rRNA sequences that are closely related to our novel Anaplasmataceae species, suggesting that this new genus may be globally widespread. For example, isolates from Korea and China with near full-length 16S sequences were found to have the closest identity to our isolate at 97.9%. Several groups have reported finding “Anaplasma-like” partial 16S rRNA gene sequences in ticks and animals. Though these available 16S sequences are comparatively short (~200–274 nt), they show higher levels of homology to our novel Anaplasmataceae than to named Anaplasma species. For example, GenBank sequence GU734325, obtained from an extract from an Ixodes ricinus tick collected in the outskirts of Paris [50], has 270/274 identity (98.6%) with the 16S sequence of our novel Anaplasmataceae. Moreover, this same sequence was also identified in a survey of tick populations in Tunisia and Morocco (GenBank AY672415, AY672420) [51] and in a survey of rodents from Slovakia (GenBank EF121953, EF121954) [52]. These studies hint at the dissemination in East Asia, Europe, and North Africa of at least two novel Anaplasmataceae species more closely related to the novel California species than to characterized Anaplasma species. In summary, the evidence presented indicates that the bacterium identified in the present study represents a lineage distinct from known Anaplasma species. In agreement with the guidelines for the provisional naming of partially characterized species [53], we propose the name ‘Candidatus Cryptoplasma californiense ‘which should provide a clearer basis for future species recognition and naming. Further studies are needed to culture this organism and to determine its range of hosts.

Description of ‘Candidatus Cryptoplasma californiense’ Eshoo et al. 2015

Cryptoplasma (’ma. Gr. adj. kruptos, hidden; Gr. neut. n. plasma, anything formed or molded, image, figure; N.L. neut. n. Cryptoplasma, a thing (a bacterium) of hidden form;′se. L. neut. adj. californiense, pertaining to the State of California, where the organism was found). Members of the α-Proteobacteria, placed phylogenetically within the family Anaplasmataceae. Not cultivated. Parasitic to Ixodes pacificum ticks.

Candidatus Cryptoplasma californiense’ [(α -Proteobacteria) NC; G-; U; NAS (GenBank no. KP276586), oligonucleotide sequence complementary to unique region of 16S rRNA gene 5’- TGGCTTGCCATAAAAGAGTTTAG – 3’; P (Ixodes pacificum ticks); M]. Eshoo et al., this study.

Supporting Information

S1 Alignment. Raw sequence alignment of the 16S rRNA for the 26 sequences included in the phylogenetic analysis.

Sequences of the PCR/ESI-MS primers and sequencing primers are reported in the top two rows. The analysis mask indicates with ‘N’ the positions included in the analysis.


S2 Alignment. Raw sequence alignment of the groEL gene for the 23 sequences included in the phylogenetic analysis.

Sequences of the sequencing primers are reported in the top row. The analysis mask indicates with ‘N’ the 804 nucleotide positions included in the analysis. Positions were aligned with respect of the encoded protein sequence.


S3 Alignment. Raw sequence alignment of gltA for the 23 sequences included in the phylogenetic analysis.

Sequences of the PCR/ESI-MS primers and sequencing primers are reported in the top rows. The analysis mask indicates with ‘N’ the 720 nucleotide positions included in the analysis. Positions were aligned with respect of the encoded protein sequence.


S4 Alignment. Raw sequence alignment of rpoB for the 19 sequences included in the phylogenetic analysis.

Sequences of the PCR/ESI-MS primers and sequencing primers are reported in the top rows. The analysis mask indicates with ‘N’ the 555 nucleotide positions included in the analysis. Positions were aligned with respect of the encoded protein sequence.


S1 Data. Identity score matrix computed across the 1,347 nucleotide positions of the 16S rRNA alignment (see S1 Text).


S2 Data. Identity score matrix computed across the 268 amino acid positions of the groEL alignment (see S2 Text).


S3 Data. Identity score matrix computed across the 240 amino acid positions of the gltA alignment (see S3 Text).


S4 Data. Identity score matrix computed across the 185 amino acid positions of the rpoB alignment (see S4 Text).


S1 Fig. Dispersion of the collection sites (red dots) across thirteen California counties.

Dot size is proportional to the number of isolates collected.


S1 Text. Trimmed alignment of the 1,347 nucleotide positions of the 16S rRNA for the 26 sequences included in the phylogenetic analysis.


S2 Text. Trimmed alignment of the 268 amino acid positions of groEL for the 23 sequences included in the phylogenetic analysis.


S3 Text. Trimmed alignment of the 240 amino acid positions of gltA for the 23 sequences included in the phylogenetic analysis.


S4 Text. Trimmed alignment of the 185 amino acid positions of rpoB for the 19 sequences included in the phylogenetic analysis.



We would like to thank Wakoli Wekesa, Robert Cummings, Paul Binding, David James, Ronald Keith, Angella Falco, Ann Donohue, Jamesina Scott, Stacy Berden, and Jack Cavier from the California Department of Public Health Vector Borne Disease Section for collection of the California I. pacificus ticks. We would like to thank Jianmin Zhong at California State University Humboldt and Sylviane Schwarz for ticks from Humboldt County. We would also like to thank Anne Kjemtrup from the California Department of Public Health for comments and Stephen Dumler from the University of Maryland for useful comments and edits. We would also like to acknowledge Jacqueline Wyatt from J & L Scientific Editing for editing of this manuscript. This work was supported by National Institutes of Health grant number 2R44AI077156 and Abbott.

Author Contributions

Conceived and designed the experiments: MWE DJE SES HEC DMC CDC CM. Performed the experiments: DMC CDC MAR CAP. Analyzed the data: MWE HEC CM CDC MAR DMC. Contributed reagents/materials/analysis tools: CDC DMC CM. Wrote the paper: MWE CM HEC DMC.


  1. 1. Lane RS, Loye JE (1991) Lyme disease in California: interrelationship of ixodid ticks (Acari), rodents, and Borrelia burgdorferi. J Med Entomol 28: 719–725. pmid:1941942
  2. 2. Burgdorfer W, Lane RS, Barbour AG, Gresbrink RA, Anderson JR (1985) The western black-legged tick, Ixodes pacificus: a vector of Borrelia burgdorferi. Am J Trop Med Hyg 34: 925–930. pmid:3898886
  3. 3. Tully JG, Rose DL, Yunker CE, Carle P, Bove JM, Williamson DL, et al. (1995) Spiroplasma ixodetis sp. nov., a new species from Ixodes pacificus ticks collected in Oregon. Int J Syst Bacteriol 45: 23–28. pmid:7857803
  4. 4. Marques A, Telford SR 3rd, Turk SP, Chung E, Williams C, Dardick K, et al. (2014) Xenodiagnosis to detect Borrelia burgdorferi infection: a first-in-human study. Clin Infect Dis 58: 937–945. pmid:24523212
  5. 5. Eshoo MW, Crowder CD, Carolan HE, Rounds MA, Ecker DJ, Haag H, et al. (2014) Broad-range survey of tick-borne pathogens in Southern Germany reveals a high prevalence of Babesia microti and a diversity of other tick-borne pathogens. Vector Borne Zoonotic Dis 14: 584–591. pmid:25072989
  6. 6. Crowder CD, Carolan HE, Rounds MA, Honig V, Mothes B, Haag H, et al. (2014) Prevalence of Borrelia miyamotoi in Ixodes ticks in Europe and the United States. Emerg Infect Dis 20: 1678–1682. pmid:25280366
  7. 7. Eshoo MW, Schutzer SE, Crowder CD, Carolan HE, Ecker DJ (2013) Achieving molecular diagnostics for Lyme disease. Expert Rev Mol Diagn 13: 875–883. pmid:24151851
  8. 8. Duncan DD, Vogler AJ, Wolcott MJ, Li F, Sarovich DS, Birdsell DN, et al. (2013) Identification and typing of Francisella tularensis with a highly automated genotyping assay. Letters in applied microbiology 56: 128–134. pmid:23121644
  9. 9. Rounds MA, Crowder CD, Stratton CW, Ecker DJ, Eshoo MW, Tang Y-W (2012) Detection of Plasmodium vivax in a child returning from India by use of broad-range PCR and electrospray ionization mass spectrometry. Emerg Microbes Infect 1: e48. pmid:26038414
  10. 10. Rounds MA, Crowder CD, Matthews HE, Philipson CA, Scoles GA, Ecker DJ, et al. (2012) Identification of endosymbionts in ticks by broad-range polymerase chain reaction and electrospray ionization mass spectrometry. J Med Entomol 49: 843–850. pmid:22897044
  11. 11. Eshoo MW, Crowder CC, Rebman AW, Rounds MA, Matthews HE, Picuri JM, et al. (2012) Direct molecular detection and genotyping of Borrelia burgdorferi from whole blood of patients with early Lyme disease. PLoS ONE 7: e36825. pmid:22590620
  12. 12. Grant-Klein RJ, Baldwin CD, Turell MJ, Rossi CA, Li F, Lovari R, et al. (2010) Rapid identification of vector-borne flaviviruses by mass spectrometry. Mol Cell Probes 24: 219–228. pmid:20412852
  13. 13. Eshoo MW, Crowder CD, Li H, Matthews HE, Meng S, Sefers SE, et al. (2010) Detection and identification of Ehrlichia species in blood by use of PCR and electrospray ionization mass spectrometry. J Clin Microbiol 48: 472–478. pmid:19955274
  14. 14. Crowder CD, Matthews HE, Schutzer S, Rounds MA, Luft BJ, Nolte O, et al. (2010) Genotypic variation and mixtures of Lyme Borrelia in Ixodes ticks from North America and Europe. PLoS ONE 5: e10650. pmid:20498837
  15. 15. Whitehouse CA, Kesterson KE, Duncan DD, Eshoo MW, Wolcott M (2012) Identification and characterization of Francisella species from natural warm springs in Utah, USA. Lett Appl Microbiol 54: 313–324. pmid:22283482
  16. 16. Sampath R, Russell KL, Massire C, Eshoo MW, Harpin V, Blyn LB, et al. (2007) Global surveillance of emerging Influenza virus genotypes by mass spectrometry. PLoS ONE 2: e489. pmid:17534439
  17. 17. Sampath R, Hall TA, Massire C, Li F, Blyn LB, Eshoo MW, et al. (2007) Rapid identification of emerging infectious agents using PCR and electrospray ionization mass spectrometry. Ann N Y Acad Sci 1102: 109–120. pmid:17470915
  18. 18. Eshoo MW, Whitehouse CA, Zoll ST, Massire C, Pennella TT, Blyn LB, et al. (2007) Direct broad-range detection of alphaviruses in mosquito extracts. Virology 368: 286–295. pmid:17655905
  19. 19. Sampath R, Hofstadler SA, Blyn LB, Eshoo MW, Hall TA, Massire C, et al. (2005) Rapid identification of emerging pathogens: coronavirus. Emerg Infect Dis 11: 373–379. pmid:15757550
  20. 20. Jiang J, Blair PJ, Felices V, Moron C, Cespedes M, Anaya E, et al. (2005) Phylogenetic analysis of a novel molecular isolate of spotted fever group Rickettsiae from northern Peru: Candidatus Rickettsia andeanae. Ann N Y Acad Sci 1063: 337–342. pmid:16481537
  21. 21. Palomar AM, Portillo A, Santibanez P, Santibanez S, Garcia-Alvarez L, Oteo JA (2012) Genetic characterization of Candidatus Rickettsia vini, a new rickettsia amplified in ticks from La Rioja, Spain. Ticks Tick Borne Dis 3: 319–321. pmid:23140892
  22. 22. Naitou H, Kawaguchi D, Nishimura Y, Inayoshi M, Kawamori F, Masuzawa T, et al. (2006) Molecular identification of Ehrlichia species and 'Candidatus Neoehrlichia mikurensis' from ticks and wild rodents in Shizuoka and Nagano Prefectures, Japan. Microbiol Immunol 50: 45–51. pmid:16428872
  23. 23. Kawahara M, Rikihisa Y, Isogai E, Takahashi M, Misumi H, Suto C, et al. (2004) Ultrastructure and phylogenetic analysis of 'Candidatus Neoehrlichia mikurensis' in the family Anaplasmataceae, isolated from wild rats and found in Ixodes ovatus ticks. Int J Syst Evol Microbiol 54: 1837–1843. pmid:15388752
  24. 24. Ecker DJ, Sampath R, Blyn LB, Eshoo MW, Ivy C, Ecker JA, et al. (2005) Rapid identification and strain-typing of respiratory pathogens for epidemic surveillance. Proc Natl Acad Sci U S A 102: 8012–8017. pmid:15911764
  25. 25. Ecker DJ, Sampath R, Li H, Massire C, Matthews HE, Toleno D, et al. (2010) New technology for rapid molecular diagnosis of bloodstream infections. Expert Rev Mol Diagn 10: 399–415. pmid:20465496
  26. 26. Ecker DJ, Drader JJ, Gutierrez J, Gutierrez A, Hannis JC, Schink A, et al. (2006) The Ibis T5000 universal biosensor: an automated platform for pathogen identification and strain typing. Journal of the Association for Laboratory Automation 11: 341–351.
  27. 27. Crowder CD, Matthews HE, Rounds MA, Li F, Schutzer SE, Sampath R, et al. (2012) Detection of heartworm infection in dogs via PCR amplification and electrospray ionization mass spectrometry of nucleic acid extracts from whole blood samples. American Journal of Veterinary Research 73: 854–859. pmid:22620700
  28. 28. Crowder CD, Rounds MA, Phillipson CA, Picuri JM, Matthews HE, Halverson J, et al. (2010) Extraction of total nucleic acids from ticks for the detection of bacterial and viral pathogens. J Med Entomol 47: 89–94. pmid:20180313
  29. 29. Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173: 697–703. pmid:1987160
  30. 30. Inokuma H, Brouqui P, Drancourt M, Raoult D (2001) Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia. J Clin Microbiol 39: 3031–3039. pmid:11526124
  31. 31. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
  32. 32. Dereeper A, Guignon V, Blanc G, Audic S, Buffet S, Chevenet F, et al. (2008) robust phylogenetic analysis for the non-specialist. Nucleic Acids Res 36: W465–469. pmid:18424797
  33. 33. Guindon S, Gascuel O (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 52: 696–704. pmid:14530136
  34. 34. Anisimova M, Gascuel O (2006) Approximate likelihood-ratio test for branches: A fast, accurate, and powerful alternative. Syst Biol 55: 539–552. pmid:16785212
  35. 35. Chevenet F, Brun C, Banuls AL, Jacq B, Christen R (2006) TreeDyn: towards dynamic graphics and annotations for analyses of trees. BMC Bioinformatics 7: 439. pmid:17032440
  36. 36. Lane RS, Mun J, Peribanez MA, Fedorova N (2010) Differences in prevalence of Borrelia burgdorferi and Anaplasma spp. infection among host-seeking Dermacentor occidentalis, Ixodes pacificus, and Ornithodoros coriaceus ticks in northwestern California. Ticks Tick Borne Dis 1: 159–167. pmid:21359090
  37. 37. Dumler JS, Barbet AF, Bekker CP, Dasch GA, Palmer GH, Ray SC, et al. (2001) Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol 51: 2145–2165. pmid:11760958
  38. 38. Li H, Zheng YC, Ma L, Jia N, Jiang BG, Jiang RR, et al. (2015) Human infection with a novel tick-borne Anaplasma species in China: a surveillance study. Lancet Infect Dis 15: 663–670. pmid:25833289
  39. 39. Ybanez AP, Sashika M, Inokuma H (2014) The phylogenetic position of Anaplasma bovis and inferences on the phylogeny of the genus Anaplasma. J Vet Med Sci 76: 307–312. pmid:24189581
  40. 40. Oh JY, Moon BC, Bae BK, Shin EH, Ko YH, Kim YJ, et al. (2009) Genetic Identification and Phylogenetic Analysis of Anaplasma and Ehrlichia Species in Haemaphysalis longicornis Collected from Jeju Island, Korea. J Bact Virol 39: 257–267.
  41. 41. Padgett K, Bonilla D, Kjemtrup A, Vilcins IM, Yoshimizu MH, Hui L, et al. (2014) Large Scale Spatial Risk and Comparative Prevalence of Borrelia miyamotoi and Borrelia burgdorferi Sensu Lato in Ixodes pacificus. PLoS One 9: e110853. pmid:25333277
  42. 42. Lane RS, Fedorova N, Kleinjan JE, Maxwell M (2013) Eco-epidemiological factors contributing to the low risk of human exposure to ixodid tick-borne borreliae in southern California, USA. Ticks Tick Borne Dis 4: 377–385. pmid:23643357
  43. 43. Rudenko N, Golovchenko M, Lin T, Gao L, Grubhoffer L, Oliver JH Jr. (2009) Delineation of a new species of the Borrelia burgdorferi Sensu Lato Complex, Borrelia americana sp. nov. J Clin Microbiol 47: 3875–3880. pmid:19846628
  44. 44. Postic D, Garnier M, Baranton G (2007) Multilocus sequence analysis of atypical Borrelia burgdorferi sensu lato isolates—description of Borrelia californiensis sp. nov., and genomospecies 1 and 2. Int J Med Microbiol 297: 263–271. pmid:17374507
  45. 45. Schoelkopf L, Hutchinson CE, Bendele KG, Goff WL, Willette M, Rasmussen JM, et al. (2005) New ruminant hosts and wider geographic range identified for Babesia odocoilei (Emerson and Wright 1970). J Wildl Dis 41: 683–690. pmid:16456156
  46. 46. Steiner FE, Pinger RR, Vann CN, Abley MJ, Sullivan B, Grindle N, et al. (2006) Detection of Anaplasma phagocytophilum and Babesia odocoilei DNA in Ixodes scapularis (Acari: Ixodidae) collected in Indiana. J Med Entomol 43: 437–442. pmid:16619631
  47. 47. Pattullo KM, Wobeser G, Lockerbie BP, Burgess HJ (2013) Babesia odocoilei infection in a Saskatchewan elk (Cervus elaphus canadensis) herd. J Vet Diagn Invest 25: 535–540. pmid:23780934
  48. 48. Fritzen C, Mosites E, Applegate RD, Telford SR 3rd, Huang J, Yabsley MJ, et al. (2014) Environmental investigation following the first human case of babesiosis in Tennessee. J Parasitol 100: 106–109. pmid:23971411
  49. 49. Tindall BJ, Rossello-Mora R, Busse HJ, Ludwig W, Kampfer P (2010) Notes on the characterization of prokaryote strains for taxonomic purposes. Int J Syst Evol Microbiol 60: 249–266. pmid:19700448
  50. 50. Reis C, Cote M, Paul RE, Bonnet S (2011) Questing ticks in suburban forest are infected by at least six tick-borne pathogens. Vector Borne Zoonotic Dis 11: 907–916. pmid:21158500
  51. 51. Sarih M, M'Ghirbi Y, Bouattour A, Gern L, Baranton G, Postic D (2005) Detection and identification of Ehrlichia spp. in ticks collected in Tunisia and Morocco. J Clin Microbiol 43: 1127–1132. pmid:15750072
  52. 52. Stefancikova A, Derdakova M, Lencakova D, Ivanova R, Stanko M, Cislakova L, et al. (2008) Serological and molecular detection of Borrelia burgdorferi sensu lato and Anaplasmataceae in rodents. Folia Microbiol (Praha) 53: 493–499.
  53. 53. Murray RG, Stackebrandt E (1995) Taxonomic note: implementation of the provisional status Candidatus for incompletely described procaryotes. Int J Syst Bacteriol 45: 186–187. pmid:7857801