Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

The Influence of the Autoimmunity-Associated Ancestral HLA Haplotype AH8.1 on the Human Gut Microbiota: A Cross-Sectional Study

  • Johannes R. Hov ,

    Contributed equally to this work with: Johannes R. Hov, Huanzi Zhong

    j.e.r.hov@medisin.uio.no

    Affiliations Norwegian PSC Research Center, Department of Transplantation Medicine, Division of Cancer Medicine, Surgery and Transplantation, Oslo University Hospital Rikshospitalet, Oslo, Norway, Institute of Clinical Medicine and K.G.Jebsen Inflammation Research Centre, Faculty of Medicine, University of Oslo, Oslo, Norway, Research Institute of Internal Medicine, Oslo University Hospital Rikshospitalet, Oslo, Norway, Section of Gastroenterology, Department of Transplantation Medicine, Division of Cancer Medicine, Surgery and Transplantation, Oslo University Hospital Rikshospitalet, Oslo, Norway

  • Huanzi Zhong ,

    Contributed equally to this work with: Johannes R. Hov, Huanzi Zhong

    Affiliation BGI-Shenzhen, Shenzhen, China

  • Bingcai Qin,

    Affiliations BGI-Shenzhen, Shenzhen, China, Shanghai Majorbio Bio-pharm Technology Co. Ltd., Shanghai, China

  • Jarl Andreas Anmarkrud,

    Affiliation Norwegian PSC Research Center, Department of Transplantation Medicine, Division of Cancer Medicine, Surgery and Transplantation, Oslo University Hospital Rikshospitalet, Oslo, Norway

  • Kristian Holm,

    Affiliation Norwegian PSC Research Center, Department of Transplantation Medicine, Division of Cancer Medicine, Surgery and Transplantation, Oslo University Hospital Rikshospitalet, Oslo, Norway

  • Andre Franke,

    Affiliation Christian-Albrechts-University of Kiel, Institute of Clinical Molecular Biology, Kiel, Germany

  • Benedicte A. Lie,

    Affiliations Institute of Clinical Medicine and K.G.Jebsen Inflammation Research Centre, Faculty of Medicine, University of Oslo, Oslo, Norway, Department of Medical Genetics, University of Oslo and Oslo University Hospital, Oslo, Norway, Department of Immunology, Oslo University Hospital Rikshospitalet, Oslo, Norway

  • Tom H. Karlsen

    Affiliations Norwegian PSC Research Center, Department of Transplantation Medicine, Division of Cancer Medicine, Surgery and Transplantation, Oslo University Hospital Rikshospitalet, Oslo, Norway, Institute of Clinical Medicine and K.G.Jebsen Inflammation Research Centre, Faculty of Medicine, University of Oslo, Oslo, Norway, Research Institute of Internal Medicine, Oslo University Hospital Rikshospitalet, Oslo, Norway, Section of Gastroenterology, Department of Transplantation Medicine, Division of Cancer Medicine, Surgery and Transplantation, Oslo University Hospital Rikshospitalet, Oslo, Norway, Department of Clinical Medicine, University of Bergen, Bergen, Norway

The Influence of the Autoimmunity-Associated Ancestral HLA Haplotype AH8.1 on the Human Gut Microbiota: A Cross-Sectional Study

  • Johannes R. Hov, 
  • Huanzi Zhong, 
  • Bingcai Qin, 
  • Jarl Andreas Anmarkrud, 
  • Kristian Holm, 
  • Andre Franke, 
  • Benedicte A. Lie, 
  • Tom H. Karlsen
PLOS
x

Abstract

Multiple immune-related genes are encoded in the HLA complex on chromosome 6p21. The 8.1 ancestral haplotype (AH8.1) include the classical HLA alleles HLA-B*08:01 and HLA-DRB1*03:01, and has been associated with a large number of autoimmune diseases, but the underlying mechanisms for this association are largely unknown. Given the recently established links between the gut microbiota and inflammatory diseases, we hypothesized that the AH8.1 influences the host gut microbial community composition. To study this further, healthy individuals were selected from the Norwegian Bone Marrow Donor Registry and categorized as either I. AH8.1 homozygote (n=34), II. AH8.1 heterozygote (n=38), III. Non AH8.1 heterozygote or IV. HLA-DRB1 homozygote but non AH8.1 (n=15). Bacterial DNA from stool samples were subjected to sequencing of the V3–V5 region of the 16S rRNA gene on the 454 Life Sciences platform and data analyzed using Mothur and QIIME. The results showed that the abundances of different taxa were highly variable within all pre-defined AH8.1 genotype groups. Using univariate non-parametric statistics, there were no differences regarding alpha or beta diversity between AH8.1 carriers (categories I and II) and non-carriers (categories III and IV), however four different taxa (Prevotellaceae, Clostridium XVIII, Coprococcus, Enterorhabdus) had nominally significant lower abundances in AH8.1 carriers than non-carriers. After including possible confounders in a multivariate linear regression, only the two latter genera remained significantly associated. In conclusion, the overall contribution of the AH8.1 haplotype to the variation in gut microbiota profile of stool in the present study was small.

Introduction

The human leukocyte antigen (HLA) complex is located at chromosome 6p21. Almost one third of the 252 expressed protein coding genes in the region have putative functions related to immune function [1]. Genetic HLA variants are major determinants of susceptibility to infection and inflammatory diseases [2,3], but for most diseases it has proven challenging to determine the involved mechanisms and exact allelic determinants. The HLA complex is both extremely polymorphic and characterised by low recombination [4].

Among several conserved so-called ancestral HLA haplotypes [5], the 8.1 ancestral haplotype (AH8.1), which spans several million base-pairs and includes the HLA-B*08:01 and HLA-DRB1*03:01 alleles, is particularly conserved. The AH8.1 is strongly associated with multiple immune-mediated diseases including celiac disease, type 1 diabetes, primary sclerosing cholangitis and systemic lupus erythematosus [6]. This haplotype contains several genetic variants with biological implications [7], including the classical HLA alleles influencing antigen presentation and genetic variants influencing the levels of tumor necrosis factor (TNF) and complement factors. While for some diseases the AH8.1 association may be linked most strongly to single disease-related alleles (e.g.HLA-DQ2 involving in celiac disease), multiple independent associations are observed in several diseases [8,9] and epistatic effects between several risk variants within this haplotype are likely conferring a general risk for the development of autoimmune disease [6].

The bacterial content of the gut (the gut microbiota) has been linked to multiple human diseases, including typical autoimmune and inflammatory conditions [1012]. Environmental influences like diet are important determinants of the gut microbial composition [13]. However, there is firm evidence from twin studies that also the effects of host genetic factors are considerable [14,15]. Strong evidence implicating single genes in the shaping of the gut microbiota have been found in mouse models with genetically altered levels of e.g. defensins, IgA and the bacterial sensing protein NOD2 [1619], the latter also seen in humans [19]. Importantly, similar gene-microbiota interactions have also been associated with genetic variants commonly observed in the healthy population, e.g. in the FUT2 gene, responsible for the presence of blood antigens on epithelial surfaces [20]. There is also evidence from both mice and humans suggesting an impact of classical HLA alleles on the gut microbiota composition [2123]. Development of AH8.1 associated diseases like type 1 diabetes, rheumatoid arthritis and celiac disease have also been linked to alterations in the gut microbiota [10,24,25]. Given the unexplained associations between the AH8.1 and autoimmune diseases, we hypothesized that the sum of multiple genetic variants on the AH8.1 haplotype with biological implications causes alterations in the gut microbiota that increase disease risk and are detectable in the normal population.

Materials and Methods

Study population

One hundred and seventeen individuals from the Norwegian Bone Marrow Donor registry were included, based on HLA genotypes determined upon the inclusion in the registry. The study cohort consisted of four pre-defined groups as defined in Table 1: I. AH8.1 homozygotes, II. AH8.1 heterozygotes, III. Non AH8.1 heterozygotes and IV. Non AH8.1 DRB1 homozygotes. The complete HLA characteristics of the 117 study subjects are given in S1 Table.

Ethics statement

Written informed consent was obtained from all study participants. The study was approved by the Regional Committee for Medical and Health Research Ethics in South-Eastern Norway (project code 2012/286b) and the institutional review board of BGI-Shenzhen.

Stool sample collection and DNA extraction

The stool samples were collected at home and returned by conventional mail. Standardization of sampling was obtained by the use of a sampling kit consisting of an information letter, a small sampling related questionnaire (covering sampling time point, height, weight, drug use (in particular, antibiotics), smoking status, domestic animals and one question on whether they are on a selective diet), detailed instructions, stool collection tubes with a stool DNA stabilizer preservative optimized for the subsequent DNA extraction (Stratec, Berlin, Germany), a Protocult stool collection device (Ability Building Center, Rochester, MN, USA) [26], and a return envelope. The stool samples with stabilizer were stored until extraction at -20 degrees, according to the manufacturer’s recommendations. Only samples from individuals without antibiotic use the previous 4 weeks, and with a transport time within the range recommended by the manufacturer (time from sampling to the freezer<72 hours) were considered for inclusion in the study. DNA extraction was performed with the PSP Spin Stool DNA kit (Stratec) according to the manufacturer’s protocol as previously described [27,28]. The presence of high-molecular DNA was verified by gel electrophoresis.

Library preparation and pyrosequencing

The samples were amplified and sequenced according to the HMP 454 16S Protocol Version 4.20 [29]. Briefly, PCR amplification targeting the V3–V5 region of 16S rDNA was individually performed by using fusion primers composed of FLX Titanium adapters (A: 5’-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3’ and B: 5’-CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-3’), a unique-10 base pairs sequence (barcode) and universal primers (338F: ACTCCTACGGGAGGCAGCAG and 907R: CCGTCAATTCMTTTGAGTTT). Following the PCR, amplicons were purified using the AMPure beads (Beckman Coulter). Subsequent sequencing on the 454 platform (Roche Applied Science, Basel, Switzerland) was performed according to manufacturer’s recommendations [29]. The sequence data are deposited at the EMBL Nucleotide Sequence Database (Accession number ERP010886).

Data processing and taxonomic assignment of effective reads

The following steps were applied to the raw sequences by using mothur (v1.25) [30]: All sequences were assigned to corresponding samples by allowing 1 mismatch to the barcode and 2 mismatches to the reverse primer (907R). After denoising using the PyroNoise algorithm [31], sequences with an ambiguous base call, a homopolymer >8 nucleotides, or length <200 or >1000 nucleotides were removed. After removing the barcode and primers portions from reads, sequences were then aligned using a NAST-based sequence aligner to a custom reference based on the SILVA alignment (v102). Sequences which did not align to the anticipated region of the reference alignment were removed. The rest were pre-clustered by merging sequence counts that were no more than 2 nucleotides different from a more abundant sequence. Chimeric sequences identified using UCHIME algorithm were then removed [32]. Sequences were classified using a Bayesian classifier with RDP database (v7). Definition of a sequence’s taxonomy was determined using a pseudobootstrap threshold of 80%. Sequences that classified as "Cyanobacteria_Chloroplast", "Mitochondria", or "unknown" (i.e., sequences that could not be classified at the kingdom level) were removed. The remaining sequences were clustered into operational taxonomic units (OTUs) at a 3% distance cutoff using the average neighbor-clustering algorithm. All OTUs were broadly categorized as either gram positive or gram negative according to known phylum characteristics.

Statistical analyses

Alpha diversity, beta diversity, OTU heatmap, principal coordinate analysis (PCoA) and samples’ hierarchical clustering were all performed using QIIME (v1.5), an integrated software package for microbial community analysis [33]. Enterotype analysis was performed as described by Arumugam et al. [34] and Qin et al. [35]. Differences in alpha diversity and relative abundances of individual genera between groups were tested using nonparametric statistics (Wilcoxon Rank Sum Test). False Discovery Rate (FDR) was calculated according to Benjamini-Hochberg to evaluate the reliability of test results. Multivariate linear regressions were performed including all covariates and using arcsine square root transformed relative bacterial abundances as dependent variables, as performed in the Human Microbiome Project [36].

Results

Study population

The characteristics of the study population are shown in Table 2. There were no significant differences between the four pre-defined HLA genotype groups with respect to age, gender, body mass index, smoking status, household animals and drug use. Oral drug use was reported by n = 41 (35%). The most common drugs were anti-histamines and drugs reducing blood pressure and serum lipids. Very few reported special diets (n = 7, including low carbohydrate, little or no gluten and low calorie diets).

thumbnail
Table 2. Characteristics of the study population according to HLA genotypea.

https://doi.org/10.1371/journal.pone.0133804.t002

Diversity measures were similar in all HLA genotype groups

The 117 samples were sequenced in two individual 454 runs, providing in total 1,903,524 raw reads, i.e. median 12,895 reads per sample. After quality control and OTU picking the median number of effective reads per sample was 6,392 (range 4,287 to 23,100). For the assessment of the influence of the AH8.1 haplotype on the microbiota composition, we first assessed the main question, i.e. comparing the microbiota profile of AH8.1 carriers vs. non-carriers.

There were no differences regarding alpha diversity, i.e. diversity within each individual, between AH8.1 carriers and non-carriers, irrespective of alpha diversity measure applied (see Fig 1 for phylogenetic diversity, other measures not shown). Analyzing the beta diversity, i.e. diversity between individuals within the groups, there were no signs of clustering of the different HLA genotype groups in a principal coordinate plot (Fig 2). It has been proposed that the gut microbiota can be categorized in three main enterotypes [34,37]. Fig 3 illustrates the stratification of the samples into three fractions, according to the methods described by Arumugam and Raes et al. [34], showing groups characterized by Prevotella, Bacteroides and a third group with a more mixed composition. However, there was no association between the assigned “enterotypes” and HLA genotype (Fig 3).

thumbnail
Fig 1. Phylogenetic diversity according to the ancestral HLA haplotype AH8.1 status.

Phylogenetic diversity, an alpha diversity measure of bacterial richness, is shown according to carrier status of the AH8.1 haplotype (left), as well as the pre-defined HLA genotype groups (right, AH8.1 homozygotes, i.e. homozygosity for both HLA-B*08 and HLA-DRB1*03; AH8.1 heterozygotes, i.e. at least 1 copy of HLA-B*08 and HLA-DRB1*03; Non AH8.1 heterozygotes, i.e. HLA-B*08 and HLA-DRB1*03 both not present. Non AH8.1 homozygotes, i.e. HLA-DRB1 homozygous but non AH8.1). There were no significant differences between the groups.

https://doi.org/10.1371/journal.pone.0133804.g001

thumbnail
Fig 2. Beta diversity according to the ancestral HLA haplotype AH8.1 status.

A principal coordinate plot of the beta diversity measure unweighted unifrac shows all samples colored according to the HLA genotype groups. There were no significant differences between the groups. Yellow: AH8.1 homozygous, i.e. homozygosity for both HLA-B*08 and HLA-DRB1*03. Violet: AH8.1 heterozygotes, i.e. at least 1 copy of HLA-B*08 and HLA-DRB1*03. Turquoise: Non AH8.1 heterozygotes, i.e. HLA-B*08 and HLA-DRB1*03 both not present. Grey: HLA-DRB1 homozygous but non AH8.1.

https://doi.org/10.1371/journal.pone.0133804.g002

thumbnail
Fig 3. Enterotype groups according to ancestral HLA haplotype AH8.1 status.

The figure shows the individual samples as colored symbols according to their HLA genotype groups (see below) distributed according to similarity of their distribution of bacterial genera in a two-dimensional plot according to the methods by Arumugam et al. [34]. The samples were classified into three fractions, enterotypes, dominated by either Prevotella (blue), Bacteroides (green) or a mix of bacteria (red), where the colored square indicate the centre of the distribution of the enterotype, the straight lines connect the included samples and the colored ellipses cover the individuals near the center of gravity for each cluster (1.5σ). Bacterial taxa overrepresented in the corresponding enterotypes are listed. As evident from the symbol color of the individual dots, the different HLA genotype groups (see below) were not preferentially distributed to one particular enterotype fraction. Yellow diamonds: AH8.1 homozygotes, i.e. homozygosity for both HLA-B*08 and HLA-DRB1*03. Violet squares: AH8.1 heterozygous, i.e. at least 1 copy of HLA-B*08 and HLA-DRB1*03. Turquoise circles: Non AH8.1 heterozygotes, i.e. HLA-B*08 and HLA-DRB1*03 both not present. Grey triangles: HLA-DRB1 homozygotes but non AH8.1.

https://doi.org/10.1371/journal.pone.0133804.g003

Several taxa associated with HLA genotype

The OTU distribution showed large inter-individual variation both when dividing the individuals into HLA genotype groups according to AH8.1 carrier status or the four pre-defined HLA genotype groups (Fig 4). When comparing AH8.1 carriers with non-carriers, no differences were detected at phylum level, while the abundance of the Prevotellaceae family (P = 0.02) and the Coprococcus (P = 0.01), Enterorhabdus (P = 0.03) and Clostridium XVIII (P = 0.05) genera were reduced in AH8.1 carriers (Table 3). The FDR values of these associations were high (>0.5). There was no difference in the prevalence of gram positive or negative bacteria (data not shown).

thumbnail
Fig 4. Genus level taxonomic distribution in 117 Norwegian stool samples according to ancestral HLA haplotype AH8.1 status.

(A) The genus abundances sorted according to the relative abundance of Bacteroides, of n = 72 AH8.1 carriers (left) are shown compared with the n = 45 non-AH8.1 samples (right). In (B) the genus abundances are shown according to all four pre-defined genotype groups; Left: AH8.1 homozygotes, i.e. homozygosity for both HLA-B*08 and HLA-DRB1*03; Middle left: AH8.1 heterozygotes, i.e. at least 1 copy of HLA-B*08 and HLA-DRB1*03; Middle right: Non AH8.1 heterozygotes, i.e. HLA-B*08 and HLA-DRB1*03 both not present; Right: HLA-DRB1 homozygous but non AH8.1.

https://doi.org/10.1371/journal.pone.0133804.g004

thumbnail
Table 3. Bacterial taxa associated with being a carrier of the ancestral HLA haplotype AH8.1.

https://doi.org/10.1371/journal.pone.0133804.t003

When comparing only AH8.1 homozygotes with non-carriers, the genera Anaeroplasma (P = 0.03) and Pseudoflavinoflactor (P = 0.03) were reduced in AH8.1 homozygotes. Since an heterozygote advantage has been observed in the HLA complex in some inflammatory diseases [38], we also assessed the phenotype of HLA-DRB1 homozygosity in general (merging the AH8.1 homozygote and other DRB1 homozygote groups) vs. HLA-DRB1 heterozygosity, Anaeroplasma (P = 0.05) and Clostridium XI (P = 0.01) were significantly less abundant in the homozygotes. The FDR values were high (>0.5) for both analyses.

Potentially confounding parameters

Although possible confounding variables were evenly distributed (Table 2), we also investigated the effect of these variables. There were significant negative correlations between body mass index and multiple alpha diversity measures; phylogenetic diversity (Spearman rank correlation coefficient [CC) -0.25, P = 0.006), chao1 (CC -0.25, P = 0.007) and observed species (CC -0.24, P = 0.009). There were also significant associations between the use of any oral drug and all alpha diversity measures (S1 Fig), while there were no significant associations between alpha diversity measures and age (Spearman rank CCs ranging -0.03 to -0.07), gender (CCs ranging -0.02 to -0.09), current smoking (correlation coefficients ranging -0.02 to 0.01) or the time samples were stored at room temperature during transport (correlation coefficients ranging -0.02 to 0.03). When re-assessing the association with taxonomic abundances after including age, gender, BMI, the use of oral drugs, smoking and time in room temperature as covariates in a multivariate linear model, significant associations with Coprococcus and Enterorhabdus and AH8.1 carrier status were still observed, while the associations with Prevotellaceae (P = 0.07) and Clostridium_XVIII (P = 0.12) were no longer significant (Table 3)

Discussion

In this first study of the influence of the autoimmunity-associated HLA haplotype AH8.1 on the gut microbiota composition, nominally significant associations between the prevalence of two bacterial taxa and the presence of AH8.1 were observed. However, the overall contribution of this haplotype to the variation in gut microbiota profile seemed small, suggesting that the accumulated effects of other factors are more important determinants of the gut microbiota.

There is very limited literature for comparison with the present data. However, a related hypothesis has been explored in a series of studies from a Spanish group on gut microbiota and genetic risk factors for celiac disease [23,39,40]. In their first study [23], there was a higher prevalence of gram negative bacteria and more Prevotella in children carrying HLA-DQ2 (the strongest risk factor for celiac disease). In contrast, in the present study there was a reduced prevalence of the Prevotellaceae family, in which Prevotella is a member, and no difference related to gram staining properties. There are however, major differences between these studies, including the large age difference and the use of DNA probes for profiling instead of sequencing. In addition, while the major genetic determinant in celiac disease, HLA-DQ2, is present on the AH8.1 haplotype, it can also be present on other haplotypes (e.g. HLA-B*18-DRB1*03) or be encoded in trans, meaning that the results are not directly transferable. In a later, sequencing-based study from the group targeting the V5-V6 region of the 16S rRNA gene [40], a higher prevalence of Firmicutes and Proteobacteria was observed in HLA-DQ2 carriers. This was also not observed in our study. The contrast between these studies highlight the need for standardization of methods and replication of findings prior to establishing associations in studies of the gut microbiota [41].

The overall differences between the HLA genotype groups observed in this study were small. Several hypotheses may explain this, including the possibility that the AH8.1 primarily acts on the host physiology and not the gut microbial content. One possibility is that the presence of AH8.1 alone is not sufficient to induce an observable effect. Individuals affected by disease and suffering from a relatively impaired immune system may show more sensitive interaction with gut microbes [1012], suggesting that patients affected by an AH8.1 associated disease should be included in later studies. It is also possible that AH8.1 influences the microbiota early in life and that this genetic effect has been replaced by environmental influences at the age of ~50 years as in the present study. There is therefore a strong rationale for similar analyses in children [23,39,40]. The accessibility of biological material from a healthy population was the main reason for analyzing microbiota profile of the stool and not intestinal mucosa. A spatial distribution of gut microbiota has been shown by detailed analyzes of the microbiota in the mucosal folds compared with the central lumen [42]. Several immunomodulatory bacteria are known to adhere to the mucosa [43,44]. Future studies in patients need to account for this fact [45].

Power calculations for microbiota studies are not well developed, except for some specific statistical models [46]. Power calculations are challenging since little is known about the effect sizes to be expected from the variables under study. Genetic risk factors in polygenic diseases detected outside the HLA typically have odds ratios of 1.1–1.5 and require thousands of study participants to be detected. In contrast, disease associations in the HLA complex typically have odds ratios of 2.0–5.0, suggesting a large influence on the host physiology (and according to our hypothesis; the gut microbiota) potentially detectable also in healthy individuals, highlighting this genetic region as a good starting point in candidate gene-microbiota interaction studies. The many possible confounders in gut microbiota studies, exemplified by the confirmation of an inverse relationship between body-mass index and alpha diversity [47,48], may also reduce the power in multivariate analyses. Importantly, the main limiting factor regarding the size of this study was the access to healthy AH8.1 homozygote individuals volunteering to provide a stool sample, while it is difficult to conclude on the ideal study size based on the present study. Related to this it should also be noted that to maximize the number of participants this study only required homozygozity for the segment HLA-B*08-DRB1*03, which has the strongest disease associations [6], and not the entire classically defined AH8.1 which includes e.g. HLA-A*01. In addition, the grouping of all other HLA haplotypes in one category (which was necessary due to low frequencies of homozygosity for other haplotypes) could potentially hide differences between specific haplotypes with diverse influences on the gut microbiota.

Despite the small differences observed between the groups in the present study, these could be speculated to have an impact on immune function. One example of a possible mechanism is the Clostridium XVIII genus, which had reduced prevalence in the AH8.1 carriers in the univariate analysis. This genus has been shown to induce T regulatory lymphocytes (Tregs) in mice [49] and less Clostridium XVIII could be speculated to lead to fewer Tregs and thereby susceptibility to autoimmunity [50]. Recent data from a large twin study provide strong evidence that the gut microbiota profile is in part heritable, and that the heritable components may be associated with a disease-related phenotype (obesity) [14]. On a more general level, the literature therefore provides support for further efforts to delineate which chromosomal regions contribute to the heritable components of the gut microbiota.

In conclusion, the bacterial genera Coprococcus and Enterorhabdus had nominally significant reduced abundance in AH8.1 haplotype carriers compared with non-carriers. However, the overall contribution of the AH8.1 haplotype to the variation in microbiota profile in the study population was small. The findings therefore need independent validation and further exploration, preferably using intestinal biopsies from a larger study panel also including patients affected by an AH8.1 associated disease.

Supporting Information

S1 Fig. Phylogenetic diversity according to the use of oral drugs or not.

The figure shows that individuals not using any drugs have higher phylogenetic diversity than individuals using any drugs (P = 0.002). The results were similar for other alpha diversity measures (data not shown).

https://doi.org/10.1371/journal.pone.0133804.s001

(TIF)

S1 Table. Overview of included individuals, their HLA-B and HLA-DRB1 types and genotype category.

https://doi.org/10.1371/journal.pone.0133804.s002

(XLSX)

Acknowledgments

The Norwegian Bone Marrow Donor Registry at Oslo University Hospital is acknowledged for generously contributing Norwegian control data, and we would in particular like to thank all study participants willing to contribute stool samples for this study. The members of the Norwegian PSC Research Center are acknowledged for contributions to the biobanking process.

Author Contributions

Conceived and designed the experiments: JRH AF THK. Performed the experiments: JRH HZ BQ JAA KH. Analyzed the data: JRH HZ BQ KH. Contributed reagents/materials/analysis tools: JRH HZ BQ BAL THK. Wrote the paper: JRH HZ BQ JAA AF THK. Critically revised and approved of the final version: JRH BQ HZ JAA KH AF BAL THK.

References

  1. 1. Horton R, Wilming L, Rand V, Lovering RC, Bruford EA, Khodiyar VK, et al. (2004) Gene map of the extended human MHC. Nat Rev Genet 5: 889–899. pmid:15573121
  2. 2. Fellay J, Shianna KV, Ge D, Colombo S, Ledergerber B, Weale M, et al. (2007) A whole-genome association study of major determinants for host control of HIV-1. Science 317: 944–947. pmid:17641165
  3. 3. Thorsby E, Lie BA (2005) HLA associated genetic predisposition to autoimmune diseases: Genes involved and possible mechanisms. Transpl Immunol 14: 175–182. pmid:15982560
  4. 4. Traherne JA (2008) Human MHC architecture and evolution: implications for disease association studies. Int J Immunogenet 35: 179–192. pmid:18397301
  5. 5. Horton R, Gibson R, Coggill P, Miretti M, Allcock RJ, Almeida J, et al. (2008) Variation analysis and gene annotation of eight MHC haplotypes: The MHC Haplotype Project. Immunogenetics 60: 1–18. pmid:18193213
  6. 6. Candore G, Lio D, Colonna Romano G, Caruso C (2002) Pathogenesis of autoimmune diseases associated with 8.1 ancestral haplotype: effect of multiple gene interactions. Autoimmun Rev 1: 29–35. pmid:12849055
  7. 7. Price P, Witt C, Allcock R, Sayer D, Garlepp M, Kok CC, et al. (1999) The genetic basis for the association of the 8.1 ancestral haplotype (A1, B8, DR3) with multiple immunopathological diseases. Immunol Rev 167: 257–274. pmid:10319267
  8. 8. Morris DL, Taylor KE, Fernando MM, Nititham J, Alarcon-Riquelme ME, Barcellos LF, et al. (2012) Unraveling multiple MHC gene associations with systemic lupus erythematosus: model choice indicates a role for HLA alleles and non-HLA genes in Europeans. Am J Hum Genet 91: 778–793. pmid:23084292
  9. 9. Naess S, Lie BA, Melum E, Olsson M, Hov JR, Croucher PJ, et al. (2014) Refinement of the MHC risk map in a scandinavian primary sclerosing cholangitis population. PLoS One 9: e114486. pmid:25521205
  10. 10. Scher JU, Sczesnak A, Longman RS, Segata N, Ubeda C, Bielski C, et al. (2013) Expansion of intestinal Prevotella copri correlates with enhanced susceptibility to arthritis. Elife 2: e01202. pmid:24192039
  11. 11. Willing BP, Dicksved J, Halfvarson J, Andersson AF, Lucio M, Zheng Z, et al. (2010) A pyrosequencing study in twins shows that gastrointestinal microbial profiles vary with inflammatory bowel disease phenotypes. Gastroenterology 139: 1844–1854 e1841. pmid:20816835
  12. 12. Vrieze A, van Nood E, Holleman F, Salojarvi J, Kootte RS, Bartelsman JF, et al. (2012) Transfer of Intestinal Microbiota From Lean Donors Increases Insulin Sensitivity in Subjects With Metabolic Syndrome. Gastroenterology 143: 913–916. pmid:22728514
  13. 13. David LA, Maurice CF, Carmody RN, Gootenberg DB, Button JE, Wolfe BE, et al. (2014) Diet rapidly and reproducibly alters the human gut microbiome. Nature 505: 559–563. pmid:24336217
  14. 14. Goodrich JK, Waters JL, Poole AC, Sutter JL, Koren O, Blekhman R, et al. (2014) Human genetics shape the gut microbiome. Cell 159: 789–799. pmid:25417156
  15. 15. Spor A, Koren O, Ley R (2011) Unravelling the effects of the environment and host genotype on the gut microbiome. Nature reviews Microbiology 9: 279–290. pmid:21407244
  16. 16. Salzman NH, Hung K, Haribhai D, Chu H, Karlsson-Sjoberg J, Amir E, et al. (2010) Enteric defensins are essential regulators of intestinal microbial ecology. Nat Immunol 11: 76–83. pmid:19855381
  17. 17. Suzuki K, Meek B, Doi Y, Muramatsu M, Chiba T, Honjo T, et al. (2004) Aberrant expansion of segmented filamentous bacteria in IgA-deficient gut. Proc Natl Acad Sci U S A 101: 1981–1986. pmid:14766966
  18. 18. Couturier-Maillard A, Secher T, Rehman A, Normand S, De Arcangelis A, Haesler R, et al. (2013) NOD2-mediated dysbiosis predisposes mice to transmissible colitis and colorectal cancer. J Clin Invest.
  19. 19. Rehman A, Sina C, Gavrilova O, Hasler R, Ott S, Baines JF, et al. (2011) Nod2 is essential for temporal development of intestinal microbial communities. Gut 60: 1354–1362. pmid:21421666
  20. 20. Rausch P, Rehman A, Kunzel S, Hasler R, Ott SJ, Schreiber S, et al. (2011) Colonic mucosa-associated microbiota is influenced by an interaction of Crohn disease and FUT2 (Secretor) genotype. Proceedings of the National Academy of Sciences of the United States of America 108: 19030–19035. pmid:22068912
  21. 21. Toivanen P, Vaahtovuo J, Eerola E (2001) Influence of major histocompatibility complex on bacterial composition of fecal flora. Infection and Immunity 69: 2372–2377. pmid:11254595
  22. 22. Gomez A, Luckey D, Yeoman CJ, Marietta EV, Berg Miller ME, Murray JA, et al. (2012) Loss of sex and age driven differences in the gut microbiome characterize arthritis-susceptible 0401 mice but not arthritis-resistant 0402 mice. PloS one 7: e36095. pmid:22553482
  23. 23. De Palma G, Capilla A, Nadal I, Nova E, Pozo T, Varea V, et al. (2010) Interplay between human leukocyte antigen genes and the microbial colonization process of the newborn intestine. Curr Issues Mol Biol 12: 1–10. pmid:19478349
  24. 24. Kriegel MA, Sefik E, Hill JA, Wu HJ, Benoist C, Mathis D (2011) Naturally transmitted segmented filamentous bacteria segregate with diabetes protection in nonobese diabetic mice. Proc Natl Acad Sci U S A 108: 11548–11553. pmid:21709219
  25. 25. Marild K, Ye W, Lebwohl B, Green PH, Blaser MJ, Card T, et al. (2013) Antibiotic exposure and the development of coeliac disease: a nationwide case-control study. BMC Gastroenterol 13: 109. pmid:23834758
  26. 26. Ahlquist DA, Schwartz S, Isaacson J, Ellefson M (1988) A stool collection device: the first step in occult blood testing. Annals of Internal Medicine 108: 609–612. pmid:3348567
  27. 27. Wu GD, Lewis JD, Hoffmann C, Chen YY, Knight R, Bittinger K, et al. (2010) Sampling and pyrosequencing methods for characterizing bacterial communities in the human gut using 16S sequence tags. BMC microbiology 10: 206. pmid:20673359
  28. 28. Henderson G, Cox F, Kittelmann S, Miri VH, Zethof M, Noel SJ, et al. (2013) Effect of DNA extraction methods and sampling techniques on the apparent structure of cow and sheep rumen microbial communities. PLoS One 8: e74787. pmid:24040342
  29. 29. Jumpstart Consortium Human Microbiome Project Data Generation Working G (2012) Evaluation of 16S rDNA-based community profiling for human microbiome research. PLoS One 7: e39315. pmid:22720093
  30. 30. Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, et al. (2009) Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl Environ Microbiol 75: 7537–7541. pmid:19801464
  31. 31. Quince C, Lanzen A, Davenport RJ, Turnbaugh PJ (2011) Removing noise from pyrosequenced amplicons. BMC Bioinformatics 12: 38. pmid:21276213
  32. 32. Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R (2011) UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 27: 2194–2200. pmid:21700674
  33. 33. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. (2010) QIIME allows analysis of high-throughput community sequencing data. Nature methods 7: 335–336. pmid:20383131
  34. 34. Arumugam M, Raes J, Pelletier E, Le Paslier D, Yamada T, Mende DR, et al. (2011) Enterotypes of the human gut microbiome. Nature 473: 174–180. pmid:21508958
  35. 35. Qin J, Li Y, Cai Z, Li S, Zhu J, Zhang F, et al. (2012) A metagenome-wide association study of gut microbiota in type 2 diabetes. Nature 490: 55–60. pmid:23023125
  36. 36. The Human Microbiome Project Consortium (2012) Structure, function and diversity of the healthy human microbiome. Nature 486: 207–214. pmid:22699609
  37. 37. Arumugam M, Raes J, Pelletier E, Le Paslier D, Yamada T, Mende DR, et al. (2014) Addendum: Enterotypes of the human gut microbiome. Nature 506: 516.
  38. 38. Goyette P, Boucher G, Mallon D, Ellinghaus E, Jostins L, Huang H, et al. (2015) High-density mapping of the MHC identifies a shared role for HLA-DRB1*01:03 in inflammatory bowel diseases and heterozygous advantage in ulcerative colitis. Nat Genet.
  39. 39. Palma GD, Capilla A, Nova E, Castillejo G, Varea V, Pozo T, et al. (2012) Influence of milk-feeding type and genetic risk of developing coeliac disease on intestinal microbiota of infants: the PROFICEL study. PLoS One 7: e30791. pmid:22319588
  40. 40. Olivares M, Neef A, Castillejo G, Palma GD, Varea V, Capilla A, et al. (2014) The HLA-DQ2 genotype selects for early intestinal microbiota composition in infants at high risk of developing coeliac disease. Gut.
  41. 41. Lozupone CA, Stombaugh J, Gonzalez A, Ackermann G, Wendel D, Vazquez-Baeza Y, et al. (2013) Meta-analyses of studies of the human microbiota. Genome Res 23: 1704–1714. pmid:23861384
  42. 42. Nava GM, Friedrichsen HJ, Stappenbeck TS (2011) Spatial organization of intestinal microbiota in the mouse ascending colon. ISME J 5: 627–638. pmid:20981114
  43. 43. Ivanov II, Atarashi K, Manel N, Brodie EL, Shima T, Karaoz U, et al. (2009) Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 139: 485–498. pmid:19836068
  44. 44. Atarashi K, Tanoue T, Shima T, Imaoka A, Kuwahara T, Momose Y, et al. (2011) Induction of colonic regulatory T cells by indigenous Clostridium species. Science 331: 337–341. pmid:21205640
  45. 45. Gevers D, Kugathasan S, Denson LA, Vazquez-Baeza Y, Van Treuren W, Ren B, et al. (2014) The treatment-naive microbiome in new-onset Crohn's disease. Cell Host Microbe 15: 382–392. pmid:24629344
  46. 46. La Rosa PS, Brooks JP, Deych E, Boone EL, Edwards DJ, Wang Q, et al. (2012) Hypothesis testing and power calculations for taxonomic-based human microbiome data. PLoS One 7: e52078. pmid:23284876
  47. 47. Turnbaugh PJ, Hamady M, Yatsunenko T, Cantarel BL, Duncan A, Ley RE, et al. (2009) A core gut microbiome in obese and lean twins. Nature 457: 480–484. pmid:19043404
  48. 48. Le Chatelier E, Nielsen T, Qin J, Prifti E, Hildebrand F, Falony G, et al. (2013) Richness of human gut microbiome correlates with metabolic markers. Nature 500: 541–546. pmid:23985870
  49. 49. Atarashi K, Tanoue T, Oshima K, Suda W, Nagano Y, Nishikawa H, et al. (2013) Treg induction by a rationally selected mixture of Clostridia strains from the human microbiota. Nature 500: 232–236. pmid:23842501
  50. 50. Geiger TL, Tauro S (2012) Nature and nurture in Foxp3(+) regulatory T cell development, stability, and function. Hum Immunol 73: 232–239. pmid:22240298