Skip to main content
Browse Subject Areas

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Origin, Divergence, and Phylogeny of Asexual Epichloë Endophyte in Elymus Species from Western China

  • Hui Song,

    Affiliations Key Laboratory of Grassland Agro-Ecosystems, Lanzhou, 730020, P. R. China, College of Pastoral Agriculture Science and Technology, Lanzhou University, Lanzhou, 730020, P. R. China

  • Zhibiao Nan

    Affiliations Key Laboratory of Grassland Agro-Ecosystems, Lanzhou, 730020, P. R. China, College of Pastoral Agriculture Science and Technology, Lanzhou University, Lanzhou, 730020, P. R. China


Asexual Epichloë species are likely derived directly from sexual Epichloë species that then lost their capacity for sexual reproduction or lost sexual reproduction because of interspecific hybridization between distinct lineages of sexual Epichloë and/or asexual Epichloë species. In this study we isolated asexual Epichloë endophytes from Elymus species in western China and sequenced intron-rich regions in the genes encoding β-tubulin (tubB) and translation elongation factor 1-α (tefA). Our results showed that there are no gene copies of tubB and tefA in any of the isolates. Phylogenetic analysis showed that sequences in this study formed a single clade with asexual Epichloë bromicola from Hordeum brevisubulatum, which implies asexual Epichloë endophytes that are symbionts in a western Chinese Elymus species likely share a common ancestor with asexual E. bromicola from European H. brevisubulatum. In addition, our results revealed that asexual E. bromicola isolates that are symbionts in a western Chinese Elymus species and sexual Epichloë species that are symbionts in a North American Elymus species have a different origin. Further analysis found that Epichloë species likely originated in Eurasia. In addition, the results support the hypothesis that migratory birds or humans might have aided the dispersal of these fungal endophytes to other continents.


Fungi species in the genus Epichloë (Clavicipitaceae, Ascomycota) and closely related asexual Epichloë species are common endophytes of cool-season grasses in the subfamily Pooideae [1,2]. Epichloë species often provide numerous benefits to their hosts, such as increased tolerance to drought [35], disease-resistance [6], resistance to herbivory and parasitism [7,8], and enhanced above-ground and below-ground vegetative and reproductive growth [9]. Previous studies have confirmed that certain alkaloids in Epichloë species play a crucial role in pasture persistence. For example, lolines and peramine are toxic and confer significant deterrent activity against insect pests [10,11].

Many new Epichloë species have recently been identified based on interfertility tests, morphology, molecular phylogenetics and host specificity [12]. However, Leuchtmann et al. [12] re-examined the classification of several described sexual Epichloë and asexual Epichloë species and varieties, and proposed new combinations and states. This resulted in the acceptance of 43 new Epichloë taxa, including species, subspecies and varieties [12].

Asexual Epichloë species elicit no visible symptoms of infection and are efficiently transmitted through host seeds (vertical transmission) [13]. In contrast, sexual Epichloë species transmit to new hosts through the stigmata based on horizontal transmission [14]; however, sexual Epichloë species can also be vertically transmitted through seeds [1517]. Although some asexual Epichloë species are considered incapable of horizontal transmission [18], it has been confirmed that the asexual Epichloë poae is capable of horizontal transmission through conidia [19]. In addition, the success of vertical and horizontal transmission can depend on environmental conditions [20,21]. For example, humidity may be critical for successful infection by contagious spores [22], whereas successful establishment of vertically infected seedlings may depend on soil moisture [23]. Molecular phylogenetic analyses of endophytes suggest that host jumps are common events between different species and genera of Pooideae [24,25], which is consistent with host generalism of other members of Hypocreales that are recognized for inter-kingdom host jumps with a high frequency [26].

Researchers have determined that there are two possible origins of asexual Epichloë species. The first hypothesis suggests that asexual Epichloë species evolved from sexual Epichloë species and then lost the ability to sexually reproduce as determined from phylogenetic analyses of β-tubulin (tubB) and rDNA-ITS sequences [27]. Alternatively, asexual Epichloë species may have derived from interspecific hybrids between sexual Epichloë and/or asexual Epichloë species [28,29]. There is evidence that many of the recognized asexual Epichloë species are hybrids [12]. Hybrids might be selected because hybridization would relieve the effects of Muller’s ratchet, the irreversible accumulation of deleterious mutations that cannot be purged by recombination in clonal species [30]. Hybridization would also allow for the accumulation of genes for alkaloid production, a defence that improves the host's fitness and, owing to vertical transmission, the fitness of the fungus itself [30].

Elymus L. is the largest genus of grasses in the tribe Triticeae (Poaceae), which contains about 150 perennial species distributed across temperate zones throughout most of the world [31], except for Africa and Antarctica [32]. In the present study, we isolated 16 asexual Epichloë endophytes from western Chinese Elymus species, and cloned their encoding β-tubulin (tubB) and translation elongation factor 1-α (tefA) housekeeping gene sequences. The goals of this study were to (1) elucidate the origin and divergence of 16 asexual Epichloë endophytes from western Chinese Elymus species; (2) compare sexual Epichloë species from North American Elymus species and the 16 asexual Epichloë endophytes from western China; and (3) estimate the geographical origin and gene-flow of Epichloë species.

Materials and Methods

Ethics statement

No specific permissions were required since in this study we only collected a limited amount of seeds and stalks from native grassland, and this grassland is not privately-owned or protected in any way. Our field study did not involve any endangered or protected species.

Plant collection and endophyte isolation

In the present study, between 2011 and 2013 we collected 871 individual plants of nine polyploid Elymus species from western China, including the provinces of Ningxia, Gansu, Qinghai, Sichuan, Xinjiang and Tibet. We examined endophyte-infected grasses using the aniline blue coloring (0.1% aqueous) method [33] and isolated fungal endophytes on potato dextrose agar, incubated in darkness at 25°C for four weeks [34].

DNA extraction, amplification and sequencing

Endophyte total genomic DNA was extracted from fresh mycelia using the HP fungal DNA kit (OMEGA, Beijing, China). Intron-rich portions of the housekeeping genes β-tubulin (tubB) and translation elongation factor 1-α (tefA) were amplified by polymerase chain reaction (PCR) using universal primers according to the previous study of Moon et al. [15]. The primers in this study were as follows: tub2-exon 1d-1: GAGAAAATGCGTGAGATTGT and tub2-exon 4u-2: GTTTCGTCCGAGTTCTCGAC; and tef1-exon 1d-1: GGGTAAGGACGAAAAGACTCA and tef1-exon 5u-1: CGGCAGCGATAATCAGGATAG. The PCR standard reaction was carried out with 0.5 μ l of genomic DNA, 1 μ l of each primer (10 pmol), 12.5 μ l 2 × taq master-mix and RNAse-free water added to a total of 25 μ l. The tubB PCR cycling program was as follows: 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 45°C for 45 s and 72°C for 2 min, followed by a final extension at 72°C for 10 min. The tefA PCR cycling program was as follows: 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 55°C for 45 s and 72°C for 2 min, followed by a final extension at 72°C for 10 min. PCR products were cloned into the pMD 18-T vector (TaKaRa, Dalian, China) based on the manual. Five positive clones per genes were sequenced by TaKaRa Biotechnology Co. Ltd (Dalian, China).

Sequences were deposited in GenBank: tefA: KJ585716- KJ585730; tubB: KJ585731- KJ585745. In addition, 43 unique taxa in the Epichloë sequences of endophyte tubB and tefA genes were obtained from GenBank (S1 Table).

Data analysis

Endophyte tubB and tefA sequences were aligned using the MAFFT 7.0 program [35] and alignments were adjusted by eye. Maximum parsimony (MP) trees were constructed in the PAUP 4.0b10 package [36]. MP trees were estimated using a heuristic search with tree bisection-reconnection (TBR) branch swapping and 100 random addition replicates. Alignment gaps were treated as missing information. Nucleotide substitutions were unordered and unweighted. Maximum likelihood (ML) trees were constructed in the MEGA 6.0 program [37]. The optimal model of nucleotide evolution was HKY+G for tubB and tefA, according to MrModeltest 2.3 [38] and this model was used in the ML analysis. ML heuristic searches were performed with 100 random addition sequence replications and TBR branch swapping algorithm. Bootstrap support values were calculated with 1000 replicates.

Nucleotide diversity was calculated using Tajima's π [39] and Watterson's θ [40] statistics. The Tajima's π measure quantifies the mean percentage of nucleotide differences among all pairwise comparisons for a set of sequences; whereas, Watterson's θ is simply an index of the number of segregating (polymorphic) sites. To tests the neutral evolution, Tajima's D and Fu and Li's D statistics were inferred as described by Tajima [39] and Fu and Li [41]. The software program DnaSP 5.0 [42] was used to perform the above calculations.

Median-joining (MJ) network analysis was applied to display the genealogical relationships between taxa [43,44]. Previously there has been very little information published that related to the phylogenetic network of the endophytes. In the present study, we determined the haplotype of sequences excluding the outgroup based on the DnaSP 5.0 program [42] and constructed a network of the endophytes using the Network 4.1 program (Fluxus Technology Ltd, Clare, Suffolk, UK).


Sequence variation

Sixteen asexual Epichloë endophytes were isolated from western Chinese Elymus species (S1 Table). The fragment sequence of the Epichloë tubB sequence in this study includes four exons and three introns, while the fragment sequence of the Epichloë tefA sequences contains three exons and three introns. Furthermore, no gene copies of tubB and tefA were observed in any of the isolates. In addition, tubB and tefA sequence of isolates NI_201207 and NI_201209 could not be obtained (S1 Table). Analyses of the Epichloë tubB and tefA sequences found that the exon sequences are more conserved than the intron sequences (data not shown). More importantly, previous studies [15,45] used intron sequences to provide insight into the phylogenetic relationships of endophytes. Therefore we also used the intron sequences.

The length of the tubB intron sequences in this study varied from 244 to 403 bp. The length of the alignment of the tubB intron sequences was 495 bp, including 62 invariable sites and 115 variable sites, 55 of which were parsimony informative sites. The length of the tefA intron sequences varied from 348 to 551 bp. The length of the alignment of the tefA intron sequences was 732 bp, including 90 invariable sites and 136 variable sites, 77 of which were parsimony informative sites.

We estimated the haplotypes and nucleotide polymorphisms of the Epichloë species in North American and western Chinese Elymus species. In the tubB sequences, the number of haplotypes (6) in the asexual Epichloë endophytes from western Chinese Elymus species was higher than the number of haplotypes (4) in the Epichloë species from North American Elymus species. The number of polymorphic sites (10) in the asexual Epichloë endophytes from western Chinese Elymus species is much lower than the number of polymorphic sites (29) in the Epichloë species from North American Elymus species (Table 1). The nucleotide diversity Tajima's π and Watterson's θ values in the asexual Epichloë endophytes from western Chinese Elymus species were 0.0038 and 0.00881, respectively, while in the Epichloë species from North American Elymus species they were 0.0326 and 0.0332, respectively (Table 1), indicating that the nucleotide diversity in Epichloë species from North American Elymus species is higher than the nucleotide diversity in asexual Epichloë endophytes from western Chinese Elymus species. The Tajima's D and Fu and Li's D values of asexual Epichloë endophytes from western Chinese Elymus species were -2.0146 (p < 0.05) and -2.4555 (p < 0.05), respectively, while for the Epichloë species from North American Elymus species they were -0.2916 (p > 0.1) and -0.1983 (p > 0.1), respectively, indicating that the asexual Epichloë endophytes from western Chinese Elymus species had a significant departure from neutrality.

Table 1. Estimates of nucleotide diversity and selection statistics for tubB and tefA sequences in Epichloë endophytes from western Chinese and North American Elymus species.

In the tefA sequences, the number of haplotypes (10) in the asexual Epichloë endophytes from western Chinese Elymus species was much higher than the number of haplotypes (5) in the Epichloë species from North American Elymus species (Table 1). The number of polymorphic sites (12) in the asexual Epichloë endophytes from western Chinese Elymus species was much lower than the polymorphic sites (48) in the Epichloë species from North American Elymus species. The nucleotide diversity or Tajima's π value of the asexual Epichloë endophytes (0.0052) from western Chinese Elymus species is lower than the Tajima's π value in the Epichloë species (0.0450) from North American Elymus species. The nucleotide diversity or Watterson's θ value of the asexual Epichloë endophytes (0.0075) from western Chinese Elymus species is lower than the Watterson's θ value in the Epichloë species (0.0402) from North American Elymus species (Table 1). The Tajima's D value was -1.1814 (p > 0.1) for the asexual Epichloë endophytes from western Chinese Elymus species and it was 0.4240 (p > 0.1) for the Epichloë species from North American Elymus species. The Fu and Li's D value was -1.8640 (p > 0.1) for the asexual Epichloë endophytes from western Chinese Elymus species, and it was 0.7607 (p > 0.1) for the Epichloë species from North American Elymus species, indicating that different selection pressures affected the asexual Epichloë endophytes from western Chinese Elymus species and Epichloë species from North American Elymus species.

Phylogenetic analyses of tubB and tefA sequences

To reveal the phylogenetic relationships between asexual Epichloë endophytes from western Chinese Elymus species and other Epichloë species, we constructed phylogenetic trees with maximum parsimony (MP) and maximum likelihood (ML) methods using tubB and tefA sequences. Parsimony analysis of the tubB sequences yielded a tree length of 470 (CI = 0.685 and RI = 0.938; S1 Fig) and parsimony analysis of the tefA sequences yielded a tree length of 507 (CI = 0.751 and RI = 0.946; S2 Fig). The MP method produced a tree topology nearly identical to the ML trees. We only showed MP tree in S1 and S2 Figs, respectively.

In the tubB tree the asexual Epichloë endophytes from western Chinese Elymus resolved in subclade VI-tub (Fig 1 and S1 Fig). Interestingly, sexual Epichloë species from North American Elymus species were not in subclade VI-tub, but instead, resolved in subclade III-tub and subclade IV-tub. Although a previous study [27] showed that asexual Epichloë species originated from sexual Epichloë species and then lost the ability to sexually reproduce, our phylogenetic results found that isolates of western Chinese (asexual endophytes) and North American (sexual endophytes) Elymus species have different origins, indicating that they are different species. Subclade VI-tub contained 16 tubB sequences, including 15 asexual Epichloë endophytes from 15 western Chinese Elymus species and one asexual Epichloë bromicola from European Hordeum brevisubulatum. This suggests that the isolates from western Chinese Elymus species likely share a common ancestor with the asexual E. bromicola from European H. brevisubulatum. In addition, subclade III-tub contained three sexual E. elymi from North American Elymus canadensis, El. villosus and El. virginicus, one asexual E. canadensis from North American El. canadensis and one asexual E. funkii from North American Achnatherum robustum. Subclade IV-tub contained three sexual E. amarillans from North American Agrostis hyemalis, El. virginicus and Sphenopholis obtusata respectively, one asexual E. canadensis from North American El. canadensis and one asexual E. chisosa from North American Ac. eminens.

Fig 1. Maximum parsimony (MP) phylogenetic relationships of Epichloë species based on intron portions of tubB.

MP trees were constructed in the PAUP 4.0b10 package. MP trees were estimated using a heuristic search with tree bisection-reconnection (TBR) branch swapping and 100 random addition replicates. Alignment gaps were treated as missing information. Nucleotide substitutions were unordered and unweighted. Bootstrap support values were calculated with 1000 replicates. Numbers on the branches are bootstrap values. Branches with bootstrap values >50% are shown. Maximum likelihood (ML) bootstrap values are listed first on each branch, followed by MP bootstrap values. Red, blue and orange colors indicate the Epichloë species from China, Europe and North America, respectively. The partial figure is showed, for the full image please see S1 Fig.

The topology of the tefA tree is consistent with that of the tubB tree. Isolates from western Chinese (asexual endophytes) and North American (sexual endophytes) Elymus species were grouped in different subclades: subclade III-tef, subclade IV-tef and subclade VI-tef, respectively (Fig 2 and S2 Fig). Subclade VI-tef contained 21 tefA sequences, including 15 asexual Epichloë endophytes from western Chinese Elymus species, three asexual E. sinica from Chinese Roegneria spp., two sexual E. liyangensis from Chinese Poa pratensis ssp. pratensis and one asexual E. bromicola from European H. brevisubulatum. E. sinica and E. liyangensis appear to be hybrids. The results of the tefA tree confirmed that the asexual Epichloë endophytes from western Chinese Elymus species are likely derived from the same ancestor with the asexual E. bromicola from European H. brevisubulatum.

Fig 2. Maximum parsimony (MP) phylogenetic relationships of Epichloë species based on intron portions of tefA.

MP trees were constructed in the PAUP 4.0b10 package. MP trees were estimated using a heuristic search with tree bisection-reconnection (TBR) branch swapping and 100 random addition replicates. Alignment gaps were treated as missing information. Nucleotide substitutions were unordered and unweighted. Bootstrap support values were calculated with 1000 replications. Numbers on branches are bootstrap values. Branches with bootstrap values >50% are shown. Maximum likelihood (ML) bootstrap values are listed first on each branch, followed by MP bootstrap values. Red, blue and orange colors indicate the Epichloë species from China, Europe and North America, respectively. The partial figure is showed, for the full image please see S2 Fig.

Subclade III-tef contained three sexual E. elymi from North American El. canadensis, El. villosus and El. virginicus, one asexual E. canadensis from North American El. canadensis and one asexual E. funkii from North American Ac. robustum. Subclade IV-tef contained three sexual E. amarillans from North American S. obtusata, Ag. hyemalis and El. virginicus, one asexual E. canadensis from North American El. canadensis and one asexual E. chisosa from North American Ac. eminens. These results suggest that asexual Epichloë endophytes from western China and sexual Epichloë species from North American Elymus species have different origins.

Network analyses of tubB and tefA sequences

Haplotype data can be used to determine ancestral and derived relationships with median-joining (MJ) networks [46], where genetically closely-related taxa are represented as physically closer in the MJ network. The tubB MJ network had a haplotype diversity of 0.9629. Fifteen asexual Epichloë endophytes from western Chinese Elymus species contained two haplotypes: Htub 20 and 65 (Fig 3 and S1 Table). Nine sexual Epichloë endophytes from North American Elymus species contained three haplotypes: Htub 7, 17 and 44. Htub 20 and 65 were closely related, while Htub 7, 17 and 44 were in different clades (Fig 3). The results also confirm that asexual Epichloë endophytes from western Chinese Elymus species and sexual Epichloë species from North American Elymus species have different origins, and the genetic diversity is higher in sexual Epichloë species from North American Elymus species than in asexual Epichloë endophytes from western Chinese Elymus species. Htub 65 contained only one tubB sequence from asexual Epichloë endophytes in western Chinese Elymus species, but Htub 20 contained 18 tubB sequences from Asia and Europe, including one sexual Epichloë species and 17 asexual Epichloë endophytes. Among the 17 asexual Epichloë endophytes, one asexual E. bromicola was isolated from the European species, H. brevisubulatum, and 16 asexual Epichloë endophytes were isolated from Asian Leymus chinensis (2) and western Chinese Elymus species (14). There were 14 asexual Epichloë endophytes from western Chinese Elymus species, and two asexual E. bromicola from Asian L. chinensis. In addition, the asexual E. hordelymi was isolated from European Hordelymus europaeus. Htub 36 contained a sexual E. bromicola tubB sequence from Asian El. repens. Htub 36 and 20 were distributed in one clade, indicating closer relationships between these haplotypes.

Fig 3. Median-joining (MJ) networks of tubB haplotypes from Epichloë species.

Each circle represents a single haplotype and the circle size is proportional to the number of isolates with that haplotype. Median vectors (mv) indicate missing intermediates of unsampled nodes inferred by the MJ network analysis and the number along the branch shows the number of mutations separating nodes.

Htub 7 included three sexual E. elymi and one asexual E. canadensis. The three sexual E. elymi were isolated from North American El. canadensis, El. villosus and El. virginicus. The asexual E. canadensis was isolated from North American El. canadensis. Htub 17 and 44 included sequences from sexual E. amarillas and asexual E. canadensis. Sexual E. amarillas was isolated from North American El. virginicus, and asexual E. canadensis was isolated from North American El. canadensis.

The tefA MJ network had a haplotype diversity of 0.9770. Fifteen asexual Epichloë tefA sequences from western Chinese Elymus species contained seven haplotypes, Htef 35, 40, 60, 61, 62, 63 and 64. Htef 61, 62, 63 and 64 only contained one tefA sequence each, while Htef 35, 40 and 60 contained three, six and five tefA sequences, respectively (Fig 4 and S1 Table). In Htef 35, there were three asexual Epichloë endophytes, including two asexual Epichloë endophytes isolated from western Chinese Elymus species and one asexual E. bromicola isolated from European H. brevisubulatum. Htef 40 contained three asexual Epichloë endophytes from western Chinese Elymus species and three asexual E. sinica from Asian Roegneria spp.. In addition, Htef 60 contained five asexual Epichloë endophytes from western Chinese Elymus species. The sexual E. bromicola from El. repens (Htef 59) is closely related to the asexual Epichloë species from western China (Fig 4).

Fig 4. Median-joining (MJ) networks of tefA haplotypes from Epichloë species.

Each circle represents a single haplotype and the circle size is proportional to the number of isolates with that haplotype. Median vectors (mv) indicate missing intermediates of unsampled nodes inferred by the MJ network analysis and the number along the branch shows the number of mutations separating nodes.

The sexual Epichloë species from North American Elymus species shared four haplotypes: Htef 11, 27, 56 and 57. Htef 27, 56 and 57 only contained one tefA sequence, respectively. Htef 27 was from the North American sexual E. amarillas (El. virginicus), and Htef 56 and 57 were from the North American asexual E. canadensis (El. canadensis). HapF 11 was from the sexual E. elymi, whose host plants include El. canadensis, El. villosus and El. virginicus in North America.


Asexual Epichloë species are thought to have derived from asexual and/or sexual Epichloë species by hybridization [27]. Among the recognized asexual Epichloë species, hybrid endophytes (19 of 26 taxa) outnumber non-hybrid endophytes [12]. Moreover, hybrid endophytes are abundant in wild grass populations in temperate areas across the world [4749]. However, we did not find any gene copies of tubB and tefA through PCR and sequencing. The tubB and tefA phylogenetic estimates do not suggest different origins of asexual Epichloë endophytes from western Chinese Elymus species. Our results reveal that asexual Epichloë endophytes from western Chinese Elymus species do not hybridize, which indicates that these asexual Epichloë species are derived from the same ancestor with E. bromicola (S1 and S2 Figs).

Endophyte diversity in North American and western Chinese Elymus species

Our tubB and tefA phylogenetic trees suggest that asexual Epichloë endophytes from western Chinese Elymus species and sexual Epichloë species from North American Elymus species have different origins (Figs 1, 2, 3 and 4). Several scenarios would lead to this kind of pattern. Transmission of sexual Epichloë species to new hosts occurs through horizontal transmission through the stigmata [14]. In contrast, transmission of asexual Epichloë species to the next generation of grass generally occurs in the seed, when hyphae penetrate the developing embryo [15,16]. However, researchers have found that asexual Epichloë species could be horizontally spread from plant to plant through conidia produced on the leaf surface [19,24,50]. We found that the asexual Epichloë endophytes from western Chinese Elymus were closely related to asexual E. bromicola from European H. brevisubulatum, asexual E. sinica from Asian Roegneria spp. and sexual E. liyangensis from Asian P. pratensis ssp. pratensis. This set of relationships indicates that a horizontal transmission mechanism probably exists. In addition, Moon et al. [27] found that transmission of endophytes occurred within the same tribe, but also between different tribes. Elymus, Hordeum and Roegneria are members of the Triticeae tribe, but P. pratensis ssp. pratensis is a member of the Poeae tribe. Although there is only a little information available about horizontal transmission between Triticeae and Poeae, the data presented here and the results described by Moon et al. [27] are sufficient to support horizontal transmission between Triticeae and Poeae.

Origin and spread of endophytes

The MJ network reflects the ancestral and derived relationships based on haplotype data, but also reveals a clear geographical pattern of distribution to the new or old world [44]. North American (new world) haplotypes of Epichloë are nested within old world samples of Epichloë species, whereas Asian (old world) haplotypes are grouped within the new world haplotypes (Figs 3 and 4). This pattern indicates that Epichloë gene-flow between the new and old world is common. Note that most haplotypes from European and Asian endophytes (old world) are located in MJ network (Figs 3 and 4). These results suggest that European and Asian endophytes have high haplotype diversity. In addition, Europe (19) and Asia (11) had more Epichloë speices (70%, 30/43) than any other continent and E. festucae var. lolii, E. typhina, E. coenophiala and E. occultans were introduced from Europe to other places [12]. This finding is consistent with this location being the center of origin for the genus [51] as this is where the greatest species diversity is to be found. In phylogenetic tree, European and Asian endophytes are placed near the root of the clades (S1 and S2 Figs), indicating they are diverged early in the phylogeny. Because of most of Europe and Asia belong to Eurasia from the perspective of geography. So we speculated that Epichloë species likely originated in Eurasia.

The tubB and tefA networks suggest that gene-flow among continents is common. We found that Eurasian endophytes are widely distributed across the globe and that this indicates that Eurasian endophytes “bridge” new and old world endophyte diversity (Figs 3 and 4). The spread of endophytes could be caused by, but is not limited to, the following processes. European endophytes are closely related to American endophytes (Figs 3 and 4) and it is possible that European animals carried endophyte-infected grass plants or seeds while they crossed the Bering land bridge to North America [52]. Another hypothesis is that the spread of endophytes from North America to South America may have been caused by the transport of endophyte-infected grass plants or seeds by rafting or carriage by migratory birds [15]. Endophytes could have spread more easily throughout Eurasia and Africa by human or bird-mediated dispersal. More interestingly, the Epichloë endophytes from Oceania are closely related to Epichloë from America and Europe (Figs 3 and 4). The most likely distribution scenario to the Oceania is European or American migration to the islands, accompanied by endophyte-infected seeds or plants. This is perhaps not surprising given that asexual E. festucae var. lolii was first introduced to New Zealand in the 1800s, in seeds brought to New Zealand by British immigrants [53]. Furthermore, haplotype Htub 22 and Htef 21 are from African and Oceania endophytes, indicating gene-flow exchange between these two areas. The most likely reason for this pattern is European migration to Oceania, with stop-overs in Africa where there were food and water supplies, and then a selection of endophyte-infected seeds or plants left Africa and were transferred to Oceania.

Supporting Information

S1 Fig. Maximum parsimony (MP) phylogenetic relationships of Epichloë species based on intron portions of tubB.


S2 Fig. Maximum parsimony (MP) phylogenetic relationships of Epichloë species based on intron portions of tefA.


S1 Table. Taxa used in this study.

Note: The ND indicate no sequence detected.



Thanks to associate editor and three anonymous reviewers for taking extensive time and care for providing thoughtful comments on the manuscript. We are grateful to Xiuzhang Li, Gensheng Bao, Qiuyan Song, Xiang Yao, and Yong Liu for assistance in sampling.

Author Contributions

Conceived and designed the experiments: HS ZN. Performed the experiments: HS. Analyzed the data: HS. Contributed reagents/materials/analysis tools: HS. Wrote the paper: HS.


  1. 1. Glenn AE, Bacon CW, Price R, Hanlin RT (1996) Molecular phylogeny of Acremonium and its taxonomic implications. Mycologia 88: 369–383.
  2. 2. Saikkonen K, Faeth SH, Helander M, Sullivan TJ (1998) Fungal endophytes: a continuum of interactions with host plants. Annu Rev Ecol Syst 29: 319–343.
  3. 3. Arachevaleta M, Bacon CW, Hoveland CS, Radcliffe DE (1989) Effect of the tall fescue endophyte on plant response to environmental stress. Agron J 81: 83–90.
  4. 4. Elmi AA, West CP (1995) Endophyte infection effects on stomatal conductance, osmotic adjustment and drought recovery of tall fescue. New Phytol 131: 61–67.
  5. 5. Kannadan S, Rudgers JA (2008) Endophyte symbiosis benefits a rare grass under low water availability. Funct Ecol 22: 706–713.
  6. 6. Gwinn KD, Gavin AM (1992) Relationship between endophyte infestation level of tall fescue seed lots and Rhizoctonia zeae seedling disease. Plant Dis 76: 911–914.
  7. 7. Bush LP, Wilkinson HH, Schardl CL (1997) Bioprotective alkaloids of grass fungal-endophyte symbioses. Plant Physiol 114: 1–7. pmid:12223685
  8. 8. Schardl CL, Grossman RB, Nagabhyru P, Faulkner JR, Mallik UP (2007) Loline alkaloids: currencies of mutualism. Phytochemistry 68: 980–996. pmid:17346759
  9. 9. Marks S, Clay K, Cheplick GP (1991) Effects of fungal endophytes on interspecific and intraspecific competition in the grasses Festuca arundinacea and Lolium perenne. J Appl Ecol 28: 194–204.
  10. 10. Bush LP, Fannin FF, Siegel MR, Dahlman DL, Burton HR (1993) Chemistry, occurrence and biological effects of saturated pyrrolizidine alkaloids associated with endophyte-grass interactions. Agric Ecosyst Environ 44: 81–102.
  11. 11. Johnson MC, Dahlman DL, Siegel MR, Bush LP, Latch GCM, Potter DA, et al. (1985) Insect feeding deterrents in endophyte-infected tall fescue. Appl Environ Microbiol 49: 568–571. pmid:16346751
  12. 12. Leuchtmann A, Bacon CW, Schardl CL, White JF Jr., Tadych M (2014) Nomenclatural realignment of Neotyphodium species with genus Epichloë. Mycologia 106: 202–215. pmid:24459125
  13. 13. White JF Jr., Morgan-Jones G, Morrow AC (1993) Taxonomy, life cycle, reproduction and detection of Acremonium endophytes. Agric Ecosyst Environ 44: 13–37.
  14. 14. Chung KR, Schardl CL (1997) Sexual cycle and horizontal transmission of the grass symbiont, Epichloë typhina. Mycol Res 101: 295–301.
  15. 15. Moon CD, Miles CO, Järlfors U, Schardl CL (2002) The evolutionary origins of three new Neotyphodium endophyte species from grasses indigenous to the Southern Hemisphere. Mycologia 94: 694–711. pmid:21156542
  16. 16. Tintjer T, Leuchtmann A, Clay K (2008) Variation in horizontal and vertical transmission of the endophyte Epichloë elymi infecting the grass Elymus hystrix. New Phytol 179: 236–246. pmid:18422901
  17. 17. Schardl CL (2010) The Epichloae, symbionts of the grass subfamily Poöideae. Ann Mo Bot Gard 97: 646–665.
  18. 18. Latch GCM, Christensen MJ (1985) Artificial infection of grasses with endophytes. Ann Appl Biol 107: 17–24.
  19. 19. Tadych M, Ambrose KV, Bergen MS, Belanger FC, White JF Jr. (2012) Taxonomic placement of Epichloë poae sp. nov. and horizontal dissemination to seedling via conidia. Fungal Divers 54: 117–131.
  20. 20. Agnew P, Koella JC (1999) Life history interactions with environmental conditions in a host-parasite relationship and the parasite's mode of transmission. Evol Ecol 13: 67–89.
  21. 21. Restif O, Kaltz O (2006) Condition-dependent virulence in a horizontally and vertically transmitted bacterial parasite. Oikos 114: 148–158.
  22. 22. Beyer M, Röding S, Ludewig A, Verreet JA (2004) Germination and survival of Fusarium graminearum macroconidia as affected by environmental factors. J Phytopathol 152: 92–97.
  23. 23. Abbott LB, Roundy BA (2003) Available water influences field germination and recruitment of seeded grasses. J Range Manage 56: 56–64.
  24. 24. Oberhofer M, Leuchtmann A (2012) Genetic diversity in epichloid endophytes of Hordelymus europaeus suggests repeated host jumps and interspecific hybridizations. Mol Ecol 21: 2713–2726. pmid:22269059
  25. 25. Iannone LJ, White JF Jr, Giussani LM, Cabral D, Novas MV (2011) Diversity and distribution of Neotyphodium-infected grasses in Argentina. Mycol Prog 10: 9–19.
  26. 26. Spatafora JW, Sung GH, Sung JM, Hywel-Jones NL, White JF Jr. (2007) Phylogenetic evidence for an animal pathogen origin of ergot and the grass endophytes Mol Ecol 16: 1701–1711. pmid:17402984
  27. 27. Moon CD, Scott B, Schardl CL, Christensen MJ (2000) The evolutionary origins of Epichloë endophytes from annual ryegrasses. Mycologia 92: 1103–1118.
  28. 28. Schardl CL, Tsai HF, Collett MA, Watt DM, Scott DB (1994) Origin of a fungal symbiont of perennial ryegrass by interspecific hybridization of a mutualist with the ryegrass choke pathogen, Epichloë typhina. Genetics 136: 1307–1317. pmid:8013907
  29. 29. Tsai HF, Liu JS, Staben C, Christensen MJ, Latch GCM, Siegel MR, et al. (1994) Evolutionary diversification of fungal endophytes of tall fescue grass by hybridization with Epichloë species. Proc Natl Acad Sci USA 91: 2542–2546. pmid:8172623
  30. 30. Selosse MA, Schardl CL (2007) Fungal endophytes of grasses: hybrids rescued by vertical transmission? An evolutionary perspective. New Phytol 173: 452–458. pmid:17244040
  31. 31. Dewey DR (1984) The genomic system of classification. Aguide to intergeneric hybridization with the perennial Triticeae: Springer US.
  32. 32. Helfgott DM, Mason-Gamer RJ (2004) The evolution of North American Elymus (Triticeae, Poaceae) allotetraploids: evidence from phosphoenolpyruvate carboxylase gene sequences. Syst Bot 29: 850–861.
  33. 33. Neill JC (1940) The endophyte of rye-grass (Lolium perenne). New Zealand Journal of Science and Technology 21: 280–291.
  34. 34. Zhang X, Ren AZ, Wei YK, Lin F, LI C, Liu ZJ, et al. (2009) Taxonomy, diversity and origins of symbiotic endophytes of Achnatherum sibiricum in the Inner Mongolia Steppe of China. FEMS Microbiol Lett 301: 12–20. pmid:19863662
  35. 35. Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Bio Evol 30: 772–780.
  36. 36. Swofford DL (2002) PAUP*: Phylogenetic analysis using parsimony (*and Other Methods), version 4. Sinauer, Sunderland, Massachusetts, USA.
  37. 37. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Bio Evol 30: 2725–2729.
  38. 38. Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol Biol 7: 214. pmid:17996036
  39. 39. Tajima F (1989) Statistical method for testing the neutral mutation of hypothesis by DNA polymorphism. Genetics 123: 589–595.
  40. 40. Watterson GA (1975) On the number of segregation sites in genetical models without recombination. Theor Popul Biol 7: 256–276. pmid:1145509
  41. 41. Fu YX, Li WH (1993) Statistical tests of neutrality of mutations. Genetics 133: 693–709. pmid:8454210
  42. 42. Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 1451–1452. pmid:19346325
  43. 43. Fu YB, Allaby RG (2010) Phylogenetic network of Linum species as revealed by non-coding chloroplast DNA sequences. Genet Resour Crop Evol 57: 667–677.
  44. 44. Jakob SS, Blattner FR (2006) A chloroplast genealogy of Hordeum (Poaceae): long-term persisting haplotypes, incomplete lineage sorting, regional extinction, and the consequences for phylogenetic inference. Mol Bio Evol 23: 1602–1612.
  45. 45. Iannone LJ, Cabral D, Schardl CL, Rossi MS (2009) Phylogenetic divergenece, morphological and physiological differences distinguish a new Neotyphodium endophyte species in the grass Bromus auleticus from South America. Mycologia 101: 340–351. pmid:19537207
  46. 46. Posada D, Crandall KA (2001) Intraspecific gene genealogies: trees grafting into networks. Trends Ecol Evol 16: 37–45. pmid:11146143
  47. 47. Kang Y, Ji Y, Sun X, Zhan L, Li W, Yu H, et al. (2009) Taxonomy of Neotyphodium endophytes of Chinese native Roegneria plants. Mycologia 101: 211–219. pmid:19397194
  48. 48. Sullivan TJ, Faeth SH (2008) Local adaptation in Festuca arizonica infected by hybrid and nonhybrid Neotyphodium endophytes. Microbial Ecol 55: 697–704. pmid:17943341
  49. 49. Zhang X, Ren AZ, Ci H, Gao Y (2010) Genetic diversity and structure of Neotyphodium species and their host Achnatherum sibiricum in a natural grass-endophyte system. Microbial Ecol 59: 744–756. pmid:20352205
  50. 50. Gentile A, Rossi MS, Cabral D, Craven KD, Schardl CL (2005) Origin, divergence, and phylogeny of epichloë endophytes of native Argentine grasses. Mol Phylogenet Evol 35: 196–208. pmid:15737591
  51. 51. Nishikawa K, Furuta Y, Wada T (1980) Genetic studies on alpha-amylase isozymes in wheat. III. Intraspecific variation in Aegilops squarrosa and birthplace of hexaploid wheat. Japan J Genetic 55: 325–336.
  52. 52. Hopkins DM (1967) The Bering Land Bridge. Stanford, CA, USA: Stanford University Press.
  53. 53. Stewart AV (2006) Genetic origins of perennial ryegrass (Lolium perenne) for New Zealand pastures. Grassland Research and Practice Series 12: 55–62.