Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Early Transcriptional Responses of Bovine Chorioallantoic Membrane Explants to Wild Type, ΔvirB2 or ΔbtpB Brucella abortus Infection

  • Juliana P. S. Mol,

    Affiliation Departamento de Clínica e Cirurgia Veterinárias, Escola de Veterinária, Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brazil

  • Erica A. Costa,

    Affiliation Departamento de Clínica e Cirurgia Veterinárias, Escola de Veterinária, Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brazil

  • Alex F. Carvalho,

    Affiliation Departamento de Medicina Veterinária Preventiva, Escola de Veterinária, Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brazil

  • Yao-Hui Sun,

    Affiliation Department of Medical Microbiology and Immunology, School of Medicine, University of California Davis, Davis, California, United States of America

  • Reneé M. Tsolis,

    Affiliation Department of Medical Microbiology and Immunology, School of Medicine, University of California Davis, Davis, California, United States of America

  • Tatiane A. Paixão,

    Affiliation Departamento de Patologia Geral, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brazil

  • Renato L. Santos

    rsantos@vet.ufmg.br

    Affiliation Departamento de Clínica e Cirurgia Veterinárias, Escola de Veterinária, Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brazil

Early Transcriptional Responses of Bovine Chorioallantoic Membrane Explants to Wild Type, ΔvirB2 or ΔbtpB Brucella abortus Infection

  • Juliana P. S. Mol, 
  • Erica A. Costa, 
  • Alex F. Carvalho, 
  • Yao-Hui Sun, 
  • Reneé M. Tsolis, 
  • Tatiane A. Paixão, 
  • Renato L. Santos
PLOS
x

Abstract

The pathogenesis of the Brucella-induced inflammatory response in the bovine placenta is not completely understood. In this study we evaluated the role of the B. abortus Type IV secretion system and the anti-inflammatory factor BtpB in early interactions with bovine placental tissues. Transcription profiles of chorioallantoic membrane (CAM) explants inoculated with wild type (strain 2308), ΔvirB2 or ΔbtpB Brucella abortus were compared by microarray analysis at 4 hours post infection. Transcripts with significant variation (>2 fold change; P<0.05) were functionally classified, and transcripts related to defense and inflammation were assessed by quantitative real time RT-PCR. Infection with wild type B. abortus resulted in slightly more genes with decreased than increased transcription levels. Conversely, infection of trophoblastic cells with the ΔvirB2 or the ΔbtpB mutant strains, that lack a functional T4SS or that has impaired inhibition of TLR signaling, respectively, induced more upregulated than downregulated genes. Wild type Brucella abortus impaired transcription of host genes related to immune response when compared to ΔvirB and ΔbtpB mutants. Our findings suggest that proinflammatory genes are negatively modulated in bovine trophoblastic cells at early stages of infection. The virB operon and btpB are directly or indirectly related to modulation of these host genes. These results shed light on the early interactions between B. abortus and placental tissue that ultimately culminate in inflammatory pathology and abortion.

Introduction

Brucellosis is an important zoonotic disease with worldwide distribution, caused by bacteria of the genus Brucella. It causes significant economic losses due to abortions and culling of infected cattle, whereas in humans it is associated with a febrile illness with variable symptoms, and it may occasionally be fatal [1][3].

Most cases of bovine brucellosis are due to Brucella abortus infection, which is transmitted by contact with contaminated aborted fetuses, fetal membranes, and uterine secretions after abortion or during the postpartum period [4], [5]. Aborted fetuses resulting from B. abortus infection often exhibit signs of fibrinous pleuritis, which may be associated with suppurative bronchopneumonia and fibrinous pericarditis [6], [7]. During pregnancy, after the initial infection of the erythrophagocytic trophoblasts located at the base of the chorionic villi, the bacteria spread throughout the placenta following a periplacentomal pattern, infecting trophoblastic cells of the intercotyledonary region, mostly at the end of gestation (180 to 240 days) [8][11]. Thus, B. abortus triggers an intense acute inflammatory response in the placenta, which is associated with abortion [7]. While this inflammatory pathology is well-described, very little is known about the initial interactions between B. abortus and placental cells that ultimately result in placentitis and abortion, two processes that are key components of disease transmission. Because of the difficulty of studying these early interactions in pregnant animals, ex vivo infection of cultured chorioallantoic membrane (CAM) explants, which results in localization of B. abortus to trophoblasts, has been used to study the initial phases of placental infection [12], [13].

Virulence factors of B. abortus have been studied in the context of persistent infection of the mononuclear phagocyte system, however few studies have been performed in the context of placental infection in the natural host. The type IV secretion system (T4SS) is considered to be a key virulence factor of Brucella spp., and it is responsible for secretion of effector proteins across the bacterial cell envelope [14][16]. The T4SS has been shown to be involved in abortion in goats [17], raising the question of its contribution to early interactions with the placenta.

A second set of virulence factors, shown to be involved in immune evasion, are the TIR domain proteins, BtpA and BtpB [18][20]. BtpA is present in B. abortus, B. melitensis, and B. suis ATCC 23445 (biovar 2), but it is absent in B. suis 1330 (biovar 1). BtpA binds directly to MyD88, preventing signaling via TLR2 and TLR4, impairing innate immune response and inhibiting maturation of in vitro infected dendritic cells by blocking the TLR2 signaling pathway [18], [20]. BtpB is present in all species of Brucella. It inhibits TLR signaling, preventing activation of dentritic cells, and together with BtpA can modulate the host inflammatory responses during Brucella sp. infection [19]. Interestingly, translocation of BtpB into host macrophages was shown to depend on the VirB T4SS [19].

In this study, the CAM explant model was used as an ex vivo model to study the pathogenesis of Brucella infection during the initial phase of the bacteria-host interaction [12]. Carvalho Neta et al [13], using this model, demonstrated that B. abortus modulates the innate immune response by trophoblastic cells by inhibiting the transcription of proinflammatory mediators at early stages of infection. The aim of this study was to interrogate the role of the VirB T4SS and BtpB in early suppression of inflammatory responses in the placenta.

Materials and Methods

Bacterial strains

The inocula were prepared by growth for 12–15 hours under agitation at 37°C of the three bacterial strains: B abortus 2308 was cultivated in Brucella broth (Difco, Lawrence, KS, USA) and the ΔvirB2 B. abortus and ΔbtpB B. abortus strains were cultivated in Tryptic Soy Broth (Difco) supplemented with kanamycin (100 µg/µL). After incubation, the optical density of bacterial suspensions was determined by spectrophotometry (OD600) and adjusted to 1.0×108 CFU/mL. To confirm the concentration of bacteria, the inocula were serially diluted in PBS (pH 7.4), and 100 µL of each dilution were plated on Tryptic Soy Agar (Difco), in duplicate. After 48 h of incubation at 37°C with 5% CO2, colonies counted and the number of colony forming units (CFU) was obtained by the average of duplicates. The handling of agent and infected material was performed under biosafety level 3 containment.

Generation of mutant strains

The ΔvirB2 B. abortus strain used in this study was obtained by allelic exchange of the virB2 gene (BAB2_0067), inserting a kanamycin cassette. The plasmid used to construct the mutant strains was the pAV2.2, a kanamycin resistant vector, which has been described previously [21]. The ΔbtpB B. abortus strain was obtained by allelic exchange of the btpB gene (BAB1_0279) for a kanamycin cassette. The plasmid used for btpB mutagenesis was generated in this study. For this purpose a plasmid called pUKD/btpB was made by using a previously described three-step cloning strategy [22]. Briefly, a fragment of the 5′ region of BAB1_0279 with engineered SmaI site was amplified from B. abortus genomic DNA using primers BMEI1674UP-F (TGAATGTGGCAAGCCCTCGAC) and BMEI1674UP-R (ACCCGGGCTTGTTTCTCTTTAGAC). A fragment of the 3′ region of BAB1_0279 with engineered SmaI and PstI sites was amplified using primers BMEI1674DN-F (ACCCGGGCAGATGCAAATATGGCCGTAAG) and BMEI1674DN-R (TCTGCAGCCGGAGGAATGGCATCAC). Both amplicons were TOPO cloned into pCR2.1 to yield plasmids pUP/btpB and pDN/btpB respectively. The orientation of the inserted 5′ fragment of BAB1_0279 was determined by PCR and restriction analysis to make sure the unique SmaI site was next to the T7 promoter in pCR2.1 vector. The 3′ fragment of BAB1_0279 was then excised by SmaI/PstI double digestion and cloned into the same sites of pUP/btpB to generate the pUD/btpB. The resulting plasmid was selected for ampicillin resistance as double digestion of SmaI/PstI truncates the original kanamycin resistance gene in pCR2.1. In the third cloning step, a 1.3-kb SmaI fragment of pUC4-KIXX (Pharmacia) containing the Tn5 kanamycin resistance gene was cloned into the SmaI site of pUD/btpB to give rise topUKD/btpB, which was selected for both kanamycin and ampicillin resistance. These plasmids were transformed into electrocompetent B. abortus cells by electroporation as previously described [23]. Colonies that were kanamycin resistant and ampicillin sensitive were selected as mutant candidates. Deletion of the virB2 and btpB genes was confirmed by PCR using primers flanking the deleted region.

Chorioallantoic membrane explant culture and infection

Snapwell plates (Transwell Cell Culture Permeable Supports – Snapwell Inserts - Corning Incorp., NY, EUA) were used for culturing CAM explants [12], [13]. Seven intact pregnant bovine uteruses at the final third of gestation were obtained at local slaughterhouses. Gestational age was estimated by cephalococcygeal length (CR - Crown-rump length) [24]. All fetuses were serologically negative for Brucella spp. by using the Acidified Antigen Buffered test with fetal amniotic fluid. Prior to obtaining the CAM, the perimetrium was thoroughly decontaminated with iodinated alcohol, the uterus was then opened and CAM removed and placed in RPMI 1640 sterile medium (Invitrogen, São Paulo, Brazil) containing antibiotics (100 U/mL penicillin and 100 µg/mL streptomycin) for 20 minutes. CAM explants were then washed twice in RPMI (Invitrogen) at 37°C for complete removal of the antibiotic. Sterile rings and detachable supports were positioned over the intercotyledonary portion of the CAM explants. Excess tissue was removed from CAM explants, which were placed in 6 well culture plates (Corning, NY, USA) containing sterile culture medium RPMI 1640 supplemented with 4 mM glutamine, 1 mM pyruvate, 1 mM nonessential amino acids, 2.9 mM sodium bicarbonate and 15% fetal bovine serum (Invitrogen), and incubated at 37°C in a humidified atmosphere with 5% CO2. The experimental protocol was approved by the Ethics Committee on Animal Experimentation of UFMG (CETEA – Protocol 183/2010).

The trophoblastic surface of the CAM explants was inoculated with 200 µL of culture medium (RPMI 1640) containing 2.0×107 CFU, which corresponded to a multiplicity of infection of approximately 1000 (MOI 1000∶1) as previously used by Carvalho Neta et al. [13]. CAM explants were inoculated in triplicate with wild type, ΔvirB2 or ΔbtpB strains of B. abortus 2308. Plates were incubated at 37°C with 5% CO2 for 4 h, the medium was then replaced with RPMI 1640 medium supplemented with 50 µg/mL gentamicin (Invitrogen, São Paulo, Brazil) to inactivate extracellular bacteria. Plates were maintained at 37°C with an atmosphere containing 5% CO2 for 1 h followed by washing three times with PBS (phosphate buffered saline - pH 7.4) to eliminate the antibiotic. Uninfected CAM controls were inoculated with sterile RPMI 1640 medium and kept under the same conditions.

Determining the number of internalized bacteria

To determine the number of internalized bacteria, three explants inoculated with wild type, ΔvirB2 or ΔbtpB B. abortus 2308 were incubated for 4 h, followed by 1 h incubation with RPMI 1640 medium supplemented with 50 µg gentamicin/mL (Invitrogen, São Paulo, Brazil) to inactivate extracellular bacteria, washed three times with PBS (pH 7.4), and then lysed with 200 µL of sterile 0.1% Triton X-100 (Roche, Mannheim, Germany). Serial dilutions of the lysates were prepared in PBS (pH 7.4), and 100 µL of each dilution were plated on tryptose agar (Difco) in duplicate. After 48 h of incubation at 37°C with 5% CO2, the number of colony forming units (CFU) was counted in each plate.

RNA extraction and preparation of cDNA

After removal of RPMI culture medium supplemented with gentamicin (n = 4 for microarray analysis; n = 3 for qRT-PCR), TRIzol Reagent (Invitrogen) was added to the trophoblastic surface of the CAM explants of uninfected controls or explants infected with wild type, ΔvirB2 or ΔbtpB B. abortus 2308, for total RNA extraction, according to the manufacturer's instructions. Purity and concentration of RNA samples were assessed by spectrophotometry, and RNA quality evaluated by agarose/formaldehyde gel electrophoresis. RNA samples were stored at −80°C. Synthesis of cDNA was performed using Superscript III First Strand S (Invitrogen), following the manufacturer's specifications using a RNA concentration of 1,500 ng in a reaction with a final volume of 20 µL, and cDNA was stored at −20°C.

Microarray analysis

Gene expression profiles were evaluated using the Agilent two color microarray-based gene expression platform according to manufacturer's instructions. Briefly, RNA (500 ng) was amplified and labeled using the two-color Quick Amp labeling kit (Agilent Technologies, CA, USA). Complementary RNA (cRNA) was synthesized from triplicates of CAM explants of four independent experiments. cRNA from uninfected control explants labeled with Cy3 and cRNA from explants infected with either wild type, ΔvirB2 or ΔbtpB B abortus 2308, labeled with Cy5 were hybridized on the same slide at 65°C, for 17 hours and 10 RPM in a high-density microarray containing 4×44,000 genes representing fully sequenced bovine genome (#G2519F Agilent Technologies, Palo Alto, CA, USA). After hybridization, slides were washed in Gene Expression wash buffers 1 and 2 as per instructions, scanned with an Agilent DNA microarray scanner (Agilent Technologies) and the hybridization signals were extracted using the Agilent Feature Extraction software version 11.0.

Quantitative real-time PCR (qRT-PCR)

After functional classification using the Funcat (Functional Classification) platform (http://mips.helmholtzmuenchen.de/genre/proj/mfungd/Search/Catalogs/searchCatfirstFun.html) genes of interest, i.e. related to inflammation and immune response that had at least a 2-fold change in transcription levels and that were statistically significant (P<0.05) were selected for confirmation based on qRT-PCR. Levels of transcripts were normalized based on β-actin transcript level. qRT-PCR was performed using the SYBR Green PCR Master Mix (Applied Biosystems, NY, USA) and the StepOnePlus thermal cycler (Applied Biosystems, NY, USA). Primers used in this study are described in Table 1. The data were analyzed using the comparative Cycle threshold (Ct) method [25].

Statistical analysis

Normalization and statistical analysis of the microarray data were performed using the GeneSpring software (Agilent Technologies, CA, USA). Analysis of variance (ANOVA) and the Student's t-test were performed with significance level of P<0.05. Analysis of variance (ANOVA) was performed after logarithmic transformation of CFU values and means were compared by the Tukey's Multiple Comparison Test (P<0.05).

Microarray data accession number

The microarray data set has been submitted to the Gene Expression Omnibus database at NCBI (http://www.ncbi.nlm.nih.gov/geo/) and assigned accession number GSE58216.

Results

Internalization of wild type, ΔvirB2 and ΔbtpB Brucella abortus strains by bovine trophoblastic cells

In order to evaluate whether the Brucella strains used in this study had comparable levels of internalization in trophoblastic cells of bovine CAM explants, CFU numbers at 4 h post inoculation followed by 1 h of incubation with gentamicin. There was no difference between the number of internalized wild type and ΔbtpB B. abortus 2308. It has been demonstrated that in infected CAM, B. abortus is found intracellularly in trophoblasts [13]. In contrast, the number of internalized ΔvirB2 mutant B. abortus was significantly lower than the other two strains (Figure 1).

thumbnail
Figure 1. Internalization of wild type, ΔvirB2 or ΔbtpB Brucella abortus by bovine trophoblastic cells.

Chorioallantoic membrane (CAM) explants were inoculated, incubated for 4 h, followed by 1 h incubation with gentamicin, and then lysed for intracellular CFU counting. Data represents the average log of CFU numbers from CAM explants, from three independent experiments performed in triplicates. Data underwent logarithmic transformation followed by analysis of variance (ANOVA) and the Tukey's multiple comparison test with significance level of P<0.05.

https://doi.org/10.1371/journal.pone.0108606.g001

Transcription profile of bovine trophoblastic cells during infection with wild type, ΔvirB2 or ΔbtpB Brucella abortus 2308 strains

Considering that B. abortus modulates the innate immune response of bovine trophoblastic cells [13], and that TIR domain-containing Brucella proteins, such as BtpB have been shown to impair the host innate immune response [19], whereas the virB-encoded T4SS is required for Brucella survival within host cells [26], a comparison of the transcription profile of bovine trophoblastic cells infected with wild type B. abortus, or the isogenic ΔvirB2 or ΔbtpB strains was performed in this study. A heat map was generated to analyze transcripts with >2 fold change that had statistically significant differences in expression (P<0.05) (Figure 2). Infection of bovine trophoblastic cells with wild type B. abortus 2308 resulted in 80 transcripts with differential levels of expression (i.e. at least a 2-fold change). Among those transcripts, 37 were upregulated and 43 were downregulated. In contrast, infection with ΔvirB2 or ΔbtpB B. abortus mutant strains resulted in a higher number of differentially expressed transcripts (138 and 117, respectively). While the number of downregulated genes was similar between wild type B. abortus and the mutant strains, remarkably, we observed an increased number of upregulated genes in CAM explants infected with both the ΔvirB2 and the ΔbtpB mutants (Figure 2 and 3, Table 2).

thumbnail
Figure 2. Gene transcription profiling of the host response to B. abortus strains at 4 hours after infection of bovine trophoblastic cells.

(A) A heat map of gene transcription changes in bovine trophoblastic cells infected with wild type, ΔvirB2 and ΔbtpB B. abortus– strains, compared to mock-infected controls. (B) Fold changes in gene transcription for genes that were significantly (P<0.05) up or downregulated during wild type, ΔvirB2 and ΔbtpB B. abortus infection compared to mock-infected controls. These data represent results from pools of total RNA obtained from triplicates of CAM explants obtained from four independent experiments. Increase or decrease in mRNA levels are indicated in red or green, respectively.

https://doi.org/10.1371/journal.pone.0108606.g002

thumbnail
Figure 3. Venn diagram indicating the number of genes with significant changes in mRNA levels assessed by microarray analysis in bovine trophoblastic cells from CAM explants obtained from 4 placentas at the last trimester of pregnancy (n = 4) infected with wild type, ΔvirB2 and ΔbtpB B. abortus compared to mock-infected controls.

Changes in transcription higher than 2-fold and values of P<0.05 were considered significant. (A) Downregulated genes and (B) upregulated genes. Abbreviations: 4105740 BARC 9BOV cDNA clone 9BOV30_O11 5′ (CK974693), HNF1 homeobox B (HNF1B), Hypothetical protein LOC616908 (LOC616908), LB01613.CR_H15 GC_BGC-16 cDNA clone IMAGE:8082593 (DT810899), Homeobox A4 (HOXA4), N-myc downstream regulated 1 (NDRG1), Ovo-like 1 (Drosophila) (OVOL1), PREDICTED: wingless-type MMTV integration site family, member 8B (WNT8B), Hypothetical LOC516011 (MEI), Q9V5V8_DROME CG13214-PA, isoform A (Q9V5V8), BDP1 protein Fragment (BDP1), Chromosome 15 open reading frame 26 ortholog (C21H15ORF26), Calmodulin binding transcription activator 1 (CAMTA1), GRM1 protein Fragment (GRM1), hCG1653800-like (LOC526866), Na+/K+ transporting ATPase interacting 2 (NKAIN2), Ankyrin repeat domain 52 (ANKRD52), 001128BAMA005012HT BAMA cDNA (BAMA), Ectonucleotide pyrophosphatase/phosphodiesterase 2 (ENPP2), Heat shock 70 kDa protein 1-like (HSPA1L), Hypothetical LOC505551 (MYCBPAP), NDRG family member 4 (NDRG4), PG12B_HUMAN (Q9BX93) Group XIIB secretory phospholipase A2-like protein precursor [TC318659] (PG12B), WSC domain containing 1 (WSCD1), BP250013A20E1 Soares normalized bovine placenta cDNA (BF042192), Contactin 4, isoform c precursor (CNTN4), LysM, putative peptidoglycan-binding, domain containing 3 (LYSMD3), Transient receptor potential channel 2 (TRPC2).

https://doi.org/10.1371/journal.pone.0108606.g003

thumbnail
Table 2. Genes with significant decrease in transcription level in bovine trophoblastic cells (chorioallantoic membrane explants) infected with wild type (strain 2308), ΔvirB2, or ΔbtpB in comparison to uninfected controls at 4 hours post infection.

https://doi.org/10.1371/journal.pone.0108606.t002

These results indicated that downregulation of host trophoblastic cell transcripts at early stages of infection is directly or indirectly associated with the virB Type IV secretion system and BtpB.

Wild type B. abortus impairs host transcription of genes related to immune response when compared to ΔvirB and ΔbtpB mutants

Differentially expressed transcripts of trophoblastic cells in response to infection with wild type B. abortus or the ΔvirB2 and ΔbtpB mutant strains were functionally classified (Tables 2 and 3). Explants infected with wild type B. abortus had the highest number of downregulated genes that are related to signal transduction (7/43; 16.2%), transcription (6/43; 13.9%), and defense and inflammation (5/43; 11.6%). Upregulated transcripts were related to metabolism (6/37; 16.2%), transport (5/37; 16.2%), and signal transduction (4/37; 10.8%). Explants infected with the ΔvirB2 mutant strain had downregulated transcripts mostly in the following categories: cell cycle/DNA processing (7/44; 15.9%), metabolism (4/44; 9.1%), and signal transduction (4/44; 9.1%), and upregulated genes related to defense and inflammation (17/94; 18.0%), metabolism (14/94; 14.8%), and signal transduction (8/94; 8.5%). Explants infected with the ΔbtpB strain had larger numbers of downregulated transcripts associated with cell cycle/DNA processing (4/38; 10.5%), transcription (4/38; 10.5%), and systemic development (4/38; 10.5%). Genes upregulated were classified as transport-related (10/79; 12.6%), signal transduction (9/79; 11.3%), and cell cycle/DNA processing (7/79; 8.8%) (Figure 4, Table 3). Interestingly, while in wild type B. abortus-infected explants most of the differentially expressed transcripts that were classified as associated with defense and inflammation were downregulated (5/7; 71.4%), explants infected with either the ΔvirB2 or ΔbtpB strains had mostly upregulated transcripts in that category (17/19; 89.4%), supporting the idea that infection by B. abortus 2308 causes a downregulation of the immune response at early stages of infection in order to prevent a robust inflammatory response. Therefore, deletion of the virulence genes virB2 and btpB results in strains that trigger increased transcription of several genes related to the immune response.

thumbnail
Figure 4. Functional classification of genes with significant changes in transcription levels in bovine trophoblastic cells at 4 hours after infection with wild type, ΔvirB2, and ΔbtpB B. abortus.

(A) Downregulated genes, and (B) upregulated genes in comparison to mock-infected controls.

https://doi.org/10.1371/journal.pone.0108606.g004

thumbnail
Table 3. Genes with significant increase in transcription level in bovine trophoblastic cells (chorioallantoic membrane explants) infected with wild type (strain 2308), ΔvirB2, or ΔbtpB in comparison to uninfected controls at 4 hours post infection.

https://doi.org/10.1371/journal.pone.0108606.t003

Transcription of genes related to immune response during the early stages of infection of bovine trophoblasts with wild type, ΔvirB2 or ΔbtpB B. abortus strains

Considering that acute inflammation in the placenta is a hallmark of B. abortus infection in cattle [7] and that B. abortus influences expression of proinflammatory transcripts by bovine trophoblastic cells [13], here we focused the analysis of differentially expressed transcripts associated with defense and inflammation. The microarray data presented above demonstrated downregulation of transcripts in wild type B. abortus-infected explants that included chemokines, genes involved in signaling pathways by TLR, in regulation of proliferation and cellular differentiation, cellular response to stress and anti-inflammatory responses. Only two genes in these categories had significantly increased transcription, namely: Toll-like receptor 6 (TLR6) and heat shock 70 kDa protein 1-like (HSPA1L) (Figure 5B). In contrast, trophoblastic cells infected with either the ΔvirB2 mutant strain or the ΔbtpB strain had a significant increase of transcripts of cytokines and chemokines as well as genes associated with the complement cascade (Figure 5C). Transcription of only two genes related to defense and inflammation were significantly decreased, namely platelet/endothelial cell adhesion molecule (PECAM1) and CD200 molecule (C200) (Figure 5D).

thumbnail
Figure 5. Changes in transcript abundance of defense and inflammation genes during infection of bovine trophoblastic cells with wild type, ΔvirB2 and ΔbtpB B. abortus, compared to mock-infected controls.

(A) Heat map of transcription changes during infections with wild type, ΔvirB2 and ΔbtpB B. abortus. (B–D) Fold changes in gene transcription of genes classified as defense and inflammation that were significantly (P<0.05) up or downregulated during wild type (B), ΔvirB2 (C), and ΔbtpB (D) B. abortus, compared to mock-infected controls. Fold changes >2 with P<0.05 were considered significant. Abbreviations: apolipoprotein L, 3 (APOL3), butyrophilin-like 9 (BTNL9), cathelicidin 4 (CATHL4), CCAAT/enhancer binding protein (C/EBP), epsilon (CEBPE), CD200 molecule (CD200), chemokine (C-C motif) ligand 5 (CCL5), chemokine (C-C motif) receptor-like 2 (CCRL2), chemokine (C-X-C motif) ligand 12 (CXCL12), chemokine (C-X-C motif) receptor 5 (CXCR5), chemokine binding protein 2 (CCBP2), complement component 3a receptor 1 (C3AR1), complement factor H (CFH), complement factor I (CFI), family with sequence similarity 19 (chemokine (C-C motif)-like), member A4 (FAM19A4), Fc fragment of IgG binding protein (FCGBP), fms-related tyrosine kinase 3-like (FLT3), heat shock 70 kDa protein 1-like (HSPA1L), HLX H2.0-like homeobox (HLX), IFN-alpha C (IFNAC), integrin, alpha M (complement component 3 receptor 3 subunit) (ITGAM), interferon alpha G (IFNAG), interferon-alphaomega-like (LOC787343), interleukin 1 family, member 6 (epsilon)-like (IL1F6), interleukin (IL15), interleukin 2 receptor, alpha (IL2RA), mitogen-activated protein kinase 14 (MAPK14),MPV17 mitochondrial membrane protein-like, nuclear gene encoding mitochondrial protein (MPV17L), N-myc downstream regulated 1 (NDRG1), pellino homolog 2 (PELI2), peptidoglycan recognition protein 1 (PGLYRP1), PIGR polymeric immunoglobulin receptor (PIGR), platelet/endothelial cell adhesion molecule (PECAM1), radical S-adenosyl methionine domain containing 2 (RSAD2), rCG28728-like (GBP4), serine peptidase inhibitor, Kazal type 5 (SPINK5), toll-like receptor 6 (TLR6), TRAF2 and NCK interacting kinase (TNIK), transient receptor potential cation channel subfamily V member 1-like, transcript, variant 2 (TRPV1), transmembrane 4 L six family member 19 (TM4SF19), tumor necrosis factor (ligand) superfamily, member 10-like (TNFSF10), tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C), tumor necrosis factor receptor superfamily, member 9 (TNFRSF9).

https://doi.org/10.1371/journal.pone.0108606.g005

Validation of the microarray data with qRT-PCR

In order to validate the results obtained with the microarrays analysis, selected differentially expressed transcripts were evaluated by qRT-PCR. Genes encoding IL15, HSPA1L, TNFRSF9, APOL3, PECAM1, PELI2, IL1F6, and TM4SF19 were amplified. Six of the eight selected genes had results that were parallel to those observed by microarray analysis (Figure 6).

thumbnail
Figure 6. Validation of the microarray results by real-time qRT-PCR.

Bars represent the average of fold change values from three independent experiments. Chorioallantoic membranes were infected with wild type B. abortus for evaluation of HSPA1L and PELI2 expression; with the ΔvirB2 Brucella abortus strain for evaluation of IL15, TNFRSF9, IL1F6, and TM4SF19; and with ΔbtpB Brucella abortus strain for evaluation of PECAM1. Abbreviations: interleukin 15 (IL15), heat shock 70 kDa protein 1-like (HSPA1L), tumor necrosis factor receptor superfamily, member 9 (TNFRSF9), apolipoprotein L, 3 (APOL3), pellino homolog 2 (PELI2), platelet/endothelial cell adhesion molecule (PECAM1), interleukin 1 family, member 6 (epsilon)-like (IL1F6), transmembrane 4 L six family member 19 (TM4SF19).

https://doi.org/10.1371/journal.pone.0108606.g006

Discussion

This study provided further evidence that B. abortus is capable of actively modulating the host innate immune response during the early stages of infection in target cells that are highly relevant for disease transmission, i.e. bovine trophoblasts. A previous study from our group demonstrated that B. abortus is able to modulate the innate immune response of bovine trophoblastic cells by suppressing the expression of proinflammatory cytokines and chemokines at early stages of infection [13]. In this study we expanded this notion by demonstrating that the absence of a functional T4SS due to deletion of virB2 as well as deletion of the btpB gene impairs the ability of B. abortus to suppress transcription of proinflammatory genes at early stages of infection in bovine trophoblasts. Although suppression of a proinflammatory response by trophoblastic cells may conflict with the fact that B. abortus causes acute placentitis in pregnant cows [7], our previous study [13] also demonstrated expression of proinflammatory chemokines at later stages of infection (i.e., 12 h after inoculation) in B. abortus-infected CAM explants, with a pattern that is similar to that observed in vivo in the placentomes of experimentally infected pregnant cows [13].

BtpB is known to interfere with innate immunity, since it inhibits TLR signaling in dendritic cells [19]. Our results suggest that BtpB could play a similar role in trophoblastic cells, suppressing an innate immune response. The virB operon- encoded T4SS is required for Brucella spp. to interfere with intracellular trafficking, which mediates exclusion of lysosomal markers from the Brucella-containing vacuole, and ultimately allows the pathogen to reach its intracellular replication niche [26][28]. Therefore, we hypothesize that the marked differences in host transcriptional profile when trophoblastic cells are infected with a Brucella strain lacking a functional T4SS is likely to be a result of differences in intracellular trafficking. Since virB mutants are killed and degraded, liberation of TLR ligands from degraded virB mutant bacteria couldcontribute to the increased proinflammatory transcriptional profile observed in our study [29]. Alternatively, since the VirB T4SS was recently shown to promote translocation of BtpB into host cells, the increased inflammatory signature in cells infected with the virB2 mutant could result from reduced translocation of BtpB to the cytosol of infected trophoblasts within the CAM explants, and consequently, reduced suppression of TLR signaling.

Confirming previous results from our group that demonstrated that B. abortus inhibits a proinflammatory responses in infected bovine CAM at early stages of infection [13], microarray analysis revealed decreased transcription of genes related to immune response and cellular stress such as chemokine (CXC motif) ligand 12 (CXCL12), Pellino homolog 2 (PELI2), TRAF2 and NCK interacting kinase (TNIK), N-myc downstream regulated 1 (NDRG1) and serine peptidase inhibitor, Kazal type 5 (SPINK5). CXCL12, or stromal-derived factor 1 (SDF-1), is the only ligand for CXCR4 and its decrease may affect various biological processes, including hematopoiesis, cardiogenesis, vascular and neuronal development (processes that may be relevant for fetal development), and traffic of immune cells [30]. In trophoblastic cells infected with B. abortus, the reduction of CXCL12 can also cause decreased interaction with CXCR4, which can be deleterious for the developing fetus and affect immune responses. PELI2 is involved in signaling pathways by TLR1, TLR2, TLR4 and IL-1 by interaction with the complex containing IRAK kinases and TRAF6. It mediates polyubiquination of IRAK1 and can activate MAP (mitogen activated protein) kinase pathways. TNIK, in turn, is regulated by TRAF2, and it is induced by stress, external stimuli and by signal transducers like JNK and NF-κB after stimulation by TNF-α. It also acts protecting cells from apoptosis [31]. NDRG1 is involved in regulation of cellular proliferation and differentiation, as well as cellular response to stress. In human trophoblastic cells, this gene promotes cell viability and protection against injury due to hypoxia, a condition that is commonly associated with placental injury and impaired fetal development [32]. SPINK5 is a serine protease inhibitor, probably related to an anti-inflammatory response. In humans, it is important for protection against pathogens, and it plays a role in formation and physiological renewal of the epidermal barrier [33][35]. Decreased transcription of these genes confirms the notion of a negative modulation of the immune response at early stages of infection of bovine trophoblastic cells with B. abortus. Conversely, two genes within this category had increased transcription in bovine trophoblastic cells infected with B. abortus: TLR6 and HSPA1L. Recently, a study showed the importance of TLR6 in triggering the innate immune response against B. abortus in vivo and activation of dendritic cells and production of proinflammatory cytokine [36]. HSPA1L (70 kDa heat shock protein 1-like - Hsp70) is a chaperone that may play a role in the internalization of Brucella sp. Tropism of B. abortus for placental tissues has important implications for the occurrence of B. abortus-induced abortion, although the molecular mechanism for this tropism is unknown. Watanabe et al. [37] demonstrated that heat shock cognate protein (Hsc70) plays a role in Brucella sp. internalization in trophoblastic cells. The administration of anti-Hsc 70 to pregnant mice prevents abortion [37]. In this study there was increased transcription of this gene in trophoblastic cells infected with the ΔvirB strain, supporting the notion that Hsp70 may be involved at early stages of Brucella infection (4 hpi).

The virB operon encodes structural components of the T4SS, and therefore it is required for secretion of effector molecules. The T4SS is required for persistence of Brucella spp. in vivo, and for intracellular survival in macrophages, which are considered one of the primary target cells for Brucella infection. Induction of the T4SS expression occurs after the initial acidification of the Brucella-containing vacuole (BCV). Moreover, the absence of markers of phagolysosomes in BCVs as well as the maturation of compartments derived from the endoplasmic reticulum are mediated by the T4SS of Brucella [15], [26][28]. Thus, the virB operon is related to survival and multiplication of Brucella in host cells, since virB mutant strains fail to multiply and localize to a lysosomal compartment [38], [39]. This study demonstrated that bovine trophoblastic cells infected with the ΔvirB mutant strain had significant increases in transcription of several proinflammatory genes at early stages of infection, when compared to trophoblastic cells infected with the wild type strain, although the elucidation of the mechanism of this phenotype is beyond the scope of this study, our data support the notion that suppression of proinflammatory responses by trophoblastic cells that is induced by B. abortus apparently requires a functional T4SS.

Transcripts of several proinflammatory cytokines and chemokines were significantly increased in trophoblastic cells infected with B. abortus ΔvirB compared to uninfected cells. These transcripts included interleukin 15 (IL15), interleukin 1 family, member 6 (epsilon)-like (IL1F6), interleukin 2 receptor alpha (IL2RA), tumor necrosis factor receptor superfamily, member 9 (TNFRSF9) and chemokines such as chemokine (CC motif) receptor-like 2 (CCRL2), chemokine (CC motif) ligand 5 (CCL5), chemokine binding protein 2 epsilon (CCBP2), chemokine (CXC motif) receptor 5 (CXCR5). CXC chemokines act primarily on neutrophil chemotaxis, whereas CC chemokines are chemoattractants for monocytes, lymphocytes, and eosinophils [40]. There was also an increased transcription of the gene encoding Complement component 3a receptor 1 (C3AR1), which is the 3a peptide receptor, one of the proteins of the complement cascade that opsonizes pathogens, and induces a series of inflammatory responses that help fight infection [41]. Opsonization of B. abortus influences the internalization of this pathogen by phagocytic cells [42], [43]. Opsonized bacteria are internalized via receptors for complement and Fc and are more susceptible to the bactericidal action of the macrophages than non-opsonized bacteria which, in turn, are internalized via fibronectin receptor [42], [43]. In the first case, most of the internalized bacteria are destroyed within phagolysosomes before reaching the sites of intracellular multiplication [42], [43]. Therefore, the route of internalization interferes with the intracellular traffic in professional phagocytic cells [43], although opsonized B. abortus is capable of surviving intracellularly in human macrophages [44]. Apolipoprotein L, 3 (APOL3) transcripts were also increased in ΔvirB B. abortus -infected trophoblasts. APOL3 is part of the apolipoproteins family. Increase in APOL proteins is related to signaling by different pro-inflammatory molecules including IFN-α [45], IFN-β [46], IFN-γ [47], and TNF-α [48], which suggests that APOL proteins are involved in immune response.

To a lesser extent when compared to ΔvirB B. abortus infection, bovine trophoblastic cells infected with ΔbtpB B. abortus also had increased mRNA levels of genes related to inflammation. When compared to non-infected controls, there was increased transcription of genes related to complement and also of the TNF family. Interestingly, these results contrast with the transcription profile of the spleen from mice infected with B. abortus or B. melitensis at 3 days post infection, in which there is a T4SS-dependent proinflammatory response [49]. The btpB gene is present in Brucella and encodes a protein with a TIR-domain, and it inhibits innate immune response probably by binding to MyD88, restricting the TLR signaling and therefore, it contributes to the control of inflammation and establishment of infection [19]. Salcedo et al. [19] reported that a virB mutant translocated less of BtpA and BtpB into mouse macrophages. Therefore, the increased expression of inflammation-related transcripts could be related to reduced translocation of the Btp proteins into infected trophoblasts. Furthermore, since virB mutants are killed more efficiently after uptake by cells, this could release more microbe associated molecular patterns (MAMPs) into the phagolysosome where they can be detected by TLRs. Two genes belonging to the TNF family had significant increases in transcription: tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C), which is associated with increased survival of B cells in vitro and regulating the population of peripheral B cells, and tumor necrosis factor (ligand) superfamily, member 10-like (TNFSF10), is a member of TNF family of cytokines and primarily related to apoptosis. TNFSF10 playing important roles in regulating cell death, immune response, and inflammation. TNFSF10 binding to its receptors promotes activation of MAPK8/JNK, caspase 8, and caspase 3 [50][52]. There was also an increased transcription of the complement factor H (CFH), which is a member of the Regulator of Complement Activation (RCA) cluster. It plays an essential role in the regulation of complement activation, restricting the activation of the complement cascade innate immune response against pathogens and CCAAT/enhancer binding protein (C/EBP) epsilon (CEBPE). It is also a critical mediator of myelopoiesis and it is related to the functional maturation of neutrophils and monocytes/macrophages [53][55].

In conclusion, our study demonstrated that infection with B. abortus induces a downregulation of the bovine trophoblastic innate immune response during the first hours of infection. The virB-encoded T4SS, and to a lesser extent the btpB gene, play a direct or indirect role in this mechanism.

Author Contributions

Conceived and designed the experiments: AFC RMT TAP RLS. Performed the experiments: JPSM EAC AFC YHS. Analyzed the data: JPSM EAC AFC RLS. Contributed reagents/materials/analysis tools: YHS RMT AFC. Wrote the paper: JPSM EAC YHS RMT TAP RLS.

References

  1. 1. Boschiroli ML, Foulongne V, O'Callaghan D (2001) Brucellosis: a worldwide zoonosis. Curr Opin Microbiol 4: 58–64.
  2. 2. Cutler SJ, Whatmore AM, Commander NJ (2005) Brucellosis - new aspects of an old disease. J Appl Microbiol 98: 1270–1281.
  3. 3. Santos RL, Martins TM, Borges ÁM, Paixão TA (2013) Economic losses due to bovine brucellosis in Brazil. Pesq Vet Bras 33: 759–764.
  4. 4. Samartino LE, Enright FM (1993) Pathogenesis of abortion of bovine brucellosis. Comp Immunol Microbiol Infect Dis 16: 95–101.
  5. 5. Acha PN, Szyfres B (2003) Zoonoses and communicable diseases common to man and animals. 3rd ed. Washington: Pan American Health Organization, 3v. (Scientific and Technical Publication, 580).
  6. 6. Nicoletti P (1990) Bovine abortion caused by Brucella sp. In: Kirkbride CA (Ed.) Laboratory Diagnosis of Livestock Abortion 3rd Ed. Ames: Iowa State University Press. p. 22–26.
  7. 7. Xavier MN, Paixão TA, Poester FP, Lage AP, Santos RL (2009) Pathology, immunohistochemistry and bacteriology of tissues and milk of cows and fetuses experimentally infected with Brucella abortus. J Comp Pathol 140: 149–157.
  8. 8. Anderson T, Cheville NF (1986) Ultrastructural morphometric analysis of Brucella abortus-infected trophoblasts in experimental placentitis. Bacterial replication occurs in rough endoplasmic reticulum. Am J Pathol 124: 226–237.
  9. 9. Meador VP, Deyoe BL, Cheville NF (1989) Pathogenesis of Brucella abortus infection of the mammary gland and supramammary lymph node of the goat. Vet Pathol 26: 357–368.
  10. 10. Samartino LE, Enright FM (1996) Brucella abortus differs in the multiplication within bovine chorioallantoic membrane explants from early and late gestation. Comp Immunol Microbiol Infect Dis 19: 55–63.
  11. 11. Carvalho Neta AV, Mol JPS, Xavier MN, Paixão TA, Lage AP, et al. (2010) Pathogenesis of bovine brucellosis. Vet J 184: 146–155.
  12. 12. Samartino LE, Enright FM (1992) Interaction of bovine chorioallantoic membrane explants with three strains of Brucella abortus. Am J Vet Res 53: 359–363.
  13. 13. Carvalho Neta AV, Steynen APR, Paixão TA, Miranda KL, Silva FL, et al. (2008) Modulation of bovine trophoblastic innate immune response by Brucella abortus. Infect Immun 76: 1897–1907.
  14. 14. Boschiroli ML, Ouahrani-Bettache S, Foulongne V, Michaux-Charachon S, Bourg G (2002) The Brucella suis virB operon is induced intracellularly in macrophages. Proc Natl Acad Sci U S A 99: 1544–1549.
  15. 15. Boschiroli ML, Ouahrani-Bettache S, Foulongne V, Michaux-Charachon S, Bourg G, et al. (2002) Type IV secretion and Brucella virulence. Vet Microbiol 90: 341–348.
  16. 16. De Jong MF, Tsolis RM (2012) Brucellosis and type IV secretion. Future Microbiol 7: 47–58.
  17. 17. Kahl-McDonagh MM, Elzer PH, Hagius SD, Walker JV, Perry QL, et al. (2006) Evaluation of novel Brucella melitensis unmarked deletion mutants for safety and efficacy in the goat model of brucellosis. Vaccine 24: 5169–5177.
  18. 18. Cirl C, Wieser A, Yadav M, Duerr S, Schubert SR, et al. (2008) Subversion of Toll-like receptor signaling by a unique family of bacterial Toll/interleukin-1 receptor domain–containing proteins. Nature 14: 399–406.
  19. 19. Salcedo SP, Marchesini MI, Degos C, Terwagne M, Von Bargen K, et al. (2013) BtpB a novel Brucella TIR-containing effector protein with immune modulatory functions. Front Cell Infect Microbiol 8: 3–28.
  20. 20. Salcedo SP, Marchesini M, Lelouard H, Fugier E, Jolly G, et al. (2008) Brucella control of dendritic cell maturation is dependent on the TIR-Containing Protein Btp1. PLoS Pathog 4: e21.
  21. 21. Den Hartigh AB, Sun YH, Sondervan D, Heuvelmans N, Reinders MO, et al. (2004) Differential requirements for virB1 and virB2 during Brucella abortus infection. Infect Immun 72: 5143–5149.
  22. 22. Sun YH, Rolan HG, den Hartigh AB, Sondervan D, Tsolis RM (2005) Brucella abortus virB12 is expressed during infection but is not an essential component of the type IV secretion system. Infect Immun 73: 6048–6054.
  23. 23. Silva TM, Paixão TA, Costa EA, Xavier MN, Sá JC, et al. (2011) Putative ATP-binding cassette transporter is essential for Brucella ovis pathogenesis in mice. Infect Immun 79: 1706–1717.
  24. 24. Evans HE, Sack WO (1973) Prenatal development of domestic and laboratory mammals: growth curves, external features and selected references. Zentralbl Veterinarmed 2: 11–45.
  25. 25. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 25: 402–408.
  26. 26. Celli J, De Chastellier C, Franchini DM, Pizarro-Cerda J, Moreno E, et al. (2003) Brucella evades macrophage killing via VirB-dependent sustained interactions with the endoplasmic reticulum. J Exp Med 198: 545–556.
  27. 27. Celli J, Salcedo SP, Gorvel JP (2005) Brucella coopts the small GTPase Sar1 for intracellular replication. Proc Natl Acad Sci U S A 102: 1673–1678.
  28. 28. Starr T, Ng TW, Wehrly TD, Knodler LA, Celli J (2008) Brucella intracellular replication requires trafficking through the late endosomal/lysosomal compartment. Traffic 9: 678–694.
  29. 29. Wolf AJ, Arruda A, Reyes CN, Kaplan AT, Shimada T, et al. (2011) Phagosomal degradation increases TLR access to bacterial ligands and enhances macrophage sensitivity to bacteria. J Immunol 187: 6002–6010.
  30. 30. Hansen TR, Smirnova NP, Van Campen H, Shoemaker ML, Ptitsyn AA, et al. (2010) Maternal and fetal response to fetal persistent infection with bovine viral diarrhea virus. Am J Reprod Immunol 64: 295–306.
  31. 31. Gui J, Li Z, Zhou X (2013) Dynamic change of TNIK in response to tumor necrosis factor alpha in a TRAF2-dependent manner. Hum Cell 26: 67–72.
  32. 32. Shi XH, Larkin JC, Chen B, Sadovsky Y (2013) The expression and localization of N-myc downstream regulated gene 1 in human trophoblasts. PLoS One 8: e75473.
  33. 33. Chavanas S, Bodemer C, Rochat A, Hamel-Teillac D, Ali M (2000) Mutations in SPINK5, encoding a serine protease inhibitor, cause Netherton syndrome. Nat Genet 25: 141–142.
  34. 34. Bitoun E, Micheloni A, Lamant L, Bonnart C, Tartaglia-Polcini A, et al. (2003) LEKTI proteolytic processing in human primary keratinocytes, tissue distribution and defective expression in Netherton syndrome. Hum Mol Genet 12: 2417–2430.
  35. 35. Descargues P, Deraison C, Prost C, Fraitag S, Mazereeuw-Hautier J, et al. (2006) Corneodesmosomal cadherins are preferential targets of stratum corneum trypsin-like and chymotrypsin-like hyperactivity in Netherton syndrome. J Invest Dermatol 126: 1622–1632.
  36. 36. Almeida LA, Macedo GC, Marinho FA, Gomes MT, Corsetti PP, et al. (2013) Toll-like receptor 6 plays an important role in host innate resistance to Brucella abortus infection in mice. Infect Immun 81: 1654–1662.
  37. 37. Watanabe K, Tachibana M, Tanaka S, Furuoka H, Horiuchi M, et al. (2008) Heat shock cognate protein 70 contributes to Brucella invasion into trophoblast giant cells that cause infectious abortion. BMC Microbiol 8: 1–12.
  38. 38. Seleem MN, Stephen BM, Sriranganathan N (2007) Brucella: A pathogen without classic virulence genes. Vet Microbiol 129: 1–14.
  39. 39. Celli J, Gorvel JP (2004) Organelle robbery: Brucella interactions with the endoplasmic reticulum. Curr Opin Microbiol 7: 93–97.
  40. 40. Mcgee DW (1999) Inflammation and mucosal cytokine production. In: OGRA PL. Mucosal immunology 2nd ed. San Diego: Academic Press, p. 559–573.
  41. 41. Wende E, Laudeley R, Bleich A, Bleich E, Wetsel RA, et al. (2013) The complement anaphylatoxin C3a receptor (C3aR) contributes to the inflammatory response in Dextran Sulfate Sodium (DSS)-induced colitis in mice. PLoS One 8: e62257.
  42. 42. Campbell GA, Adams LG, Sowa BA (1994) Mechanism of binding of Brucella abortus to mononuclear phagocytes from cows naturally resistant or susceptible to brucellosis. Vet Immunol Immunopathol 41: 295–306.
  43. 43. Gorvel JP, Moreno E (2002) Brucella intracellular life: from invasion to intracellular replication. Vet Microbiol 90: 281–297.
  44. 44. Bellaire BH, Roop RM 2nd, Cardelli JA (2005) Opsonized virulent Brucella abortus replicates within nonacidic, endoplasmic reticulum-negative, LAMP-1-positive phagosomes in human monocytes. Infect Immun 73: 3702–3713.
  45. 45. Hayashi J, Stoyanova R, Seeger C (2005) The transcriptome of HCV replicon expressing cell lines in the presence of alpha interferon. Virology 335: 264–275.
  46. 46. Stojdl DF, Lichty BD, Tenoever BR, Paterson JM, Power AT, et al. (2003) Vsv strains with defects in their ability to shutdown innate immunity are potent systemic anti-cancer agents. Cancer Cell 4: 263–275.
  47. 47. Sana TR, Janatpour MJ, Sathe M, Mcevoy LM, McClanahan TK (2005) Microarray analysis of primary endothelial cells challenged with different inflammatory and immune cytokines. Cytokine 29: 256–269.
  48. 48. Monajemi H, Fontijn RD, Pannekoek H, Horrevoets AJ (2002) The apolipoprotein L gene cluster has emerged recently in evolution and is expressed in human vascular tissue. Genomics 79: 539–546.
  49. 49. Roux CM, Rolán HG, Santos RL, Beremand PD, Thomas TL, et al. (2007) Brucella requires a functional Type IV secretion system to elicit innate immune responses in mice. Cell Microbiol 9: 1851–1869.
  50. 50. Baker SJ, Reddy EP (1996) Transducers of life and death: TNF receptor superfamily and associated proteins. Oncogene 12: 1–9.
  51. 51. Bossen C, Schneider P (2006) BAFF, APRIL and their receptors: structure, function and signaling. Semin Immunol 18: 263–275.
  52. 52. Nomura S, Ishii K, Inami N, Uoshima N, Ishida H, et al. (2007) Role of soluble tumor necrosis factor-related apoptosis-inducing ligand concentrations after stem cell transplantation. Transpl Immunol 18: 115–121.
  53. 53. Diaz-Guillen MA, De Cordoba SR, Heine-Suner D (1999) A radiation hybrid map of complement factor H and factor H-related genes. Immunogenetics 49: 549–552.
  54. 54. Male DA, Ormsby RJ, Ranganathan S, Giannakis E, Gordon DL (2000) Complement factor H: sequence analysis of 221 kb of human genomic DNA containing the entire fH, fHR-1 and fHR-3 genes. Mol Immunol 37: 41–52.
  55. 55. Kyme P, Thoennissen NH, Tseng CW, Thoennissen GB, Wolf AJ, et al. (2012) C/EBPε mediates nicotinamide enhanced clearance of Staphylococcus aureus in mice. J Clin Invest 122: 3316–3329.