Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

TERT Promoter Mutations Are Frequent in Cutaneous Basal Cell Carcinoma and Squamous Cell Carcinoma

  • Klaus G. Griewank ,

    klaus.griewank@uk-essen.de

    Affiliation Department of Dermatology, University Hospital, University Duisburg-Essen, Essen, Germany

  • Rajmohan Murali,

    Affiliations Department of Pathology, Memorial Sloan-Kettering Cancer Center, New York, United States of America, Human Oncology and Pathogenesis Program, Memorial Sloan-Kettering Cancer Center, New York, United States of America

  • Bastian Schilling,

    Affiliation Department of Dermatology, University Hospital, University Duisburg-Essen, Essen, Germany

  • Tobias Schimming,

    Affiliation Department of Dermatology, University Hospital, University Duisburg-Essen, Essen, Germany

  • Inga Möller,

    Affiliation Department of Dermatology, University Hospital, University Duisburg-Essen, Essen, Germany

  • Iris Moll,

    Affiliation Department of Dermatology, University Hospital, University Duisburg-Essen, Essen, Germany

  • Marion Schwamborn,

    Affiliation Department of Dermatology, University Hospital, University Duisburg-Essen, Essen, Germany

  • Antje Sucker,

    Affiliation Department of Dermatology, University Hospital, University Duisburg-Essen, Essen, Germany

  • Lisa Zimmer,

    Affiliation Department of Dermatology, University Hospital, University Duisburg-Essen, Essen, Germany

  • Dirk Schadendorf,

    Affiliation Department of Dermatology, University Hospital, University Duisburg-Essen, Essen, Germany

  • Uwe Hillen

    Affiliation Department of Dermatology, University Hospital, University Duisburg-Essen, Essen, Germany

TERT Promoter Mutations Are Frequent in Cutaneous Basal Cell Carcinoma and Squamous Cell Carcinoma

  • Klaus G. Griewank, 
  • Rajmohan Murali, 
  • Bastian Schilling, 
  • Tobias Schimming, 
  • Inga Möller, 
  • Iris Moll, 
  • Marion Schwamborn, 
  • Antje Sucker, 
  • Lisa Zimmer, 
  • Dirk Schadendorf
PLOS
x

Abstract

Activating mutations in the TERT promoter were recently identified in up to 71% of cutaneous melanoma. Subsequent studies found TERT promoter mutations in a wide array of other major human cancers. TERT promoter mutations lead to increased expression of telomerase, which maintains telomere length and genomic stability, thereby allowing cancer cells to continuously divide, avoiding senescence or apoptosis. TERT promoter mutations in cutaneous melanoma often show UV-signatures. Non-melanoma skin cancer, including basal cell carcinoma and squamous cell carcinoma, are very frequent malignancies in individuals of European descent. We investigated the presence of TERT promoter mutations in 32 basal cell carcinomas and 34 cutaneous squamous cell carcinomas using conventional Sanger sequencing. TERT promoter mutations were identified in 18 (56%) basal cell carcinomas and in 17 (50%) cutaneous squamous cell carcinomas. The recurrent mutations identified in our cohort were identical to those previously described in cutaneous melanoma, and showed a UV-signature (C>T or CC>TT) in line with a causative role for UV exposure in these common cutaneous malignancies. Our study shows that TERT promoter mutations with UV-signatures are frequent in non-melanoma skin cancer, being present in around 50% of basal and squamous cell carcinomas and suggests that increased expression of telomerase plays an important role in the pathogenesis of these tumors.

Introduction

Non-melanoma skin cancers including basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) are the most frequent tumors in individuals of European descent [1], [2]. Their incidences have increased considerably which is attributed to the aging population and high levels of sun exposure [3], [4].

BCC is the most frequent type of skin cancer. Established risk factors for BCC include fair skin, blond or red hair, light eye color [5], UV-exposure, radiation, and immunosuppression [3], [5]. BCCs harbor mutations leading to activation of the hedgehog pathway [3]. Inactivating mutations in the tumor suppressor PTCH1 were first identified in patients with basal cell nevus syndrome, [6], [7] and subsequently reported in up to 90% of sporadic BCC [3], [8], [9]. Activating mutations in other hedgehog pathway genes, such as SMO, SHH, or GLI, are found less frequently (∼10% of tumors) [10]. BCC were also shown to harbor frequent UV-signature mutations in TP53 [11], [12]. Recently novel therapies inhibiting the hedgehog signaling pathway have shown high efficacy in treating patients with inoperable or metastatic BCC [13].

SCC is less frequent than BCC (ratio circa 1∶4) [4]. UV-exposure is considered to be the most important etiologic factor in SCC [2]. SCC has the potential to metastasize, and may result in death, particularly in organ transplant recipients [14]. The prognosis for metastatic SCC is poor, with ten-year survival rates of less than 10% [4]. Genetic alterations in SCCs include activating mutations or gains of RAS genes [15], as well as mutations in TP53, frequently with a C>T or CC>TT UV-signature [16]. Other genetic events are overexpression or mutations of EGFR, losses of CDKN2A [17], and inactivating mutations of NOTCH [18].

Novel mutations in the promoter region of TERT, coding for the catalytic subunit of the telomerase holoenzyme, were identified in up to 71% of cutaneous melanomas in two recent studies [19], [20]. These mutations lead to increased TERT expression, most likely by creating ETS transcription factor binding sites [19], [20]. TERT promoter mutations were also found in a number of other common cancers, including hepatocellular cancer, bladder cancer, thyroid cancer and gliomas [21][24]. In cutaneous tumors, TERT promoter mutations with high numbers of UV-signature mutations were also identified in atypical fibroxanthomas and pleomorphic dermal sarcomas, rare soft tissue tumors arising in heavily UV-damaged skin [25]. One current study reported a TERT promoter mutation in one of five SCCs [21], and another recent publication found TERT promoter mutations in 78% of BCC and 50% of SCC [26].

In our study we investigate the presence of TERT promoter mutations in BCCs and SCCs, and their associations with clinical and pathologic features.

Materials and Methods

Sample selection

Samples of primary BCCs and SCCs were obtained from 66 patients treated in the Department of Dermatology, University Hospital Essen, Germany. The study was approved by the Institutional Review Board of the University of Duisburg-Essen (Ethikkomission der Universität Duisburg-Essen) under the IRB protocol number 12-4961-BO. All patients provided written informed consent.

DNA isolation

10 µm-thick sections were cut from formalin-fixed, paraffin-embedded tumor tissues. The sections were deparaffinized and tumor tissue was manually macrodissected. Genomic DNA was isolated using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions.

Direct (Sanger) sequencing

PCR amplification of the TERT promoter region was performed using primers: hTERT_F ACGAACGTGGCCAGCGGCAG and hTERT_R CTGGCGTCCCTGCACCCTGG (474 bp product), or primers hTERT_short_F CAGCGCTGCCTGAAACTC and hTERT_short_R GTCCTGCCCCTTCACCTT (163bp product) as previously described [20]. PCR products were used as templates for sequencing after purification with the QIAquick PCR Purification Kit (Qiagen). Sequencing chromatogram files were examined using Chromas (version 2.01, University of Sussex, Brighton, United Kingdom) or Sequencher (demo version 5.1, Gene Codes Corporation, Ann Arbor, MI, USA) software.

Results

Study cohort

The study cohort consisted of 32 BCC and 34 SCC samples, from 43 males and 23 females. The median age was 72.6 years for SCC and 73.0 years for BCC. Histopathologic analysis was performed on all samples to assess histologic subtype, tumor thickness, cystic component, ulceration status, and presence of pigmentation for BCC, as well as tumor thickness, Clark level, acantholysis, lymphovascular involvement (LVI), perineural involvement (PNI), and presence of ulceration in SCC. Clinicopathologic characteristics are listed in Table 1.

TERT promoter mutation analysis

Recurrent TERT promoter mutations were identified in both BCC and SCC. Mutations were located at Chr.5.1295228C>T, Chr.5.1295228_1295229CC>TT, Chr.5.1295242_1295243CC>TT, or Chr.5.1295250C>T. Alternatively mutations may be denoted based on their upstream location to the ATG initiation codon of TERT, as c.-124C>T, c.-124_125CC>TT, c.-138_139CC>TT, and c.-146C>T, respectively. For the rest of the manuscript we will refer to the mutations using this annotation.

In BCC, TERT promoter mutations were identified in 18 (56%) cases (Table 1). Recurrent mutations were located at positions c.-124C>T (n = 4, 13%), c.-124_125CC>TT (n = 1, 3%), c.-138_139CC>TT (n = 2, 6%), or c.-146C>T (n = 11, 34%), as shown in Figure 1. One c.-146C>T mutant tumor also harbored a c.-126_127CC>TT mutation. Seventeen (50%) SCCs harbored TERT promoter mutations (Table 1), which included c.-124C>T (n = 6, 18%), c.-124_125CC>TT (n = 2, 6%), c.-138_139CC>TT (n = 4, 12%), and c.-146C>T (n = 5, 15%). One c.-124C>T case had a concomitant c.-126C>T mutation. All identified mutations showed a UV-signature (C>T and CC>TT) [27].

thumbnail
Figure 1. Recurrent mutations identified in the TERT promoter of BCC and SCC.

Representative sequencing chromatograms showing the wild type sequence (on top) and representative examples of the mutations identified in both basal and squamous cell carcinoma samples – c.-124C>T, c.-124_125CC>TT, c.-138_139CC>TT or c.-146C>T (alternatively annotated according to the chromosome location as Chr.5. 1295228C>T, Chr.5. 1295228_1295229CC>TT, Chr.5. 1295242_1295243CC>TT or Chr.5.1295250C>T, respectively). All presented mutations were found in both tumor cohorts however the presented chromatograms are from a BCC, SCC, BCC, and BCC, respectively.

https://doi.org/10.1371/journal.pone.0080354.g001

Associations of clinical and pathologic parameters with TERT promoter mutation status

Apart from a small, statistically significant (p = 0.046) difference in age between patients with TERT promoter-mutant BCCs (median 75.5 years) and those with TERT promoter-wild type BCCs (median 71.0 years), there were no statistically significant associations of TERT mutation status with clinicopathologic parameters (Table 2 and 3).

thumbnail
Table 2. Associations of clinical and pathologic parameters in BCC with TERT promoter mutation status.

https://doi.org/10.1371/journal.pone.0080354.t002

thumbnail
Table 3. Associations of clinical and pathologic parameters in SCC with TERT mutation status.

https://doi.org/10.1371/journal.pone.0080354.t003

Discussion

BCC and SCC harbor distinct patterns of genetic alterations. BCC have genetic alterations activating the hedgehog signaling pathway. In contrast, SCC show alterations leading to activation of the MAPK and AKT signaling pathway, such as overexpression or mutations of genes such as RAS, EGFR, or PIK3CA [17], [18]. Losses of CDKN2A [17] and inactivation of NOTCH [18] are also frequent in SCC, but not in BCC. The only previously recognized common genetic event in both tumors is TP53 mutations. We found TERT promoter mutations in a substantial proportion of both BCC and SCC. The frequency of these mutations in BCC, SCC, melanoma [19], [20] and other cancers [21] suggests that increased expression of the holoenzyme telomerase is an important event in a wide range of human malignancies.

The role of UV-mediated tumorigenesis in BCC and SCC is supported by epidemiologic data and by the presence of UV-signature mutations in TP53 (BCC and SCC), PTCH1 (BCC) or RAS (SCC) [2], [3], [5], [11], [16]. The mutations we identified in the TERT promoter have a UV-signature with C>T or CC>TT changes, consistent with an etiologic role for UV exposure. However, c.-124C>T and c.-146C>T mutations have also been identified in cancer types such as hepatocellular cancer, bladder cancer, thyroid cancer and gliomas, in which UV-induced mutations are unlikely [21][23]. CC>TT alterations are considered virtually pathognomonic of UV-induction [16], [27] and were rare or not described in the aforementioned tumors, however were frequent in cutaneous melanoma and other cutaneous tumors occurring on sun-damaged skin [20], [25]. There is a rare C>T SNP (rs35550267) at position c.-139. To our knowledge no known SNP has been reported at c.-125 (dbSNP). Thus, although we cannot exclude that of the ten CC>TT alterations detected (six c.-138_139CC>TT, three c.-124_125CC>TT and one c.-126_127CC>TT) some, or potentially even all, represent a preexisting C>T variation with an additional C>T mutation, we do believe these alterations, found in 13% of BCC and 18% of SCC, most likely primarily represent UV-exposure tandem mutations, arguing for UV-exposure inducing TERT promoter mutations in these tumors. Future larger studies with paired tumor and constitutional DNA should be able to definitively address the role of dipyrimidine mutations in the TERT promoter of BCC and SCC.

Matched blood samples of the tumors analyzed in our study were not available, precluding us from directly excluding the presence of germ-line mutations at the mutation hotspots c.-124 or c.-146. However, germ-line mutations at these hotspots have not been observed in various TERT promoter mutation studies which compared paired tumor and normal (blood) tissue isolated DNA [19][21], [24], [26], nor were they present in the 1000 Genomes database [28]. This makes it almost certain that the mutations detected at these loci in our tumor cohort were somatically acquired.

Functional studies showed that the identified TERT promoter mutations cause a 2-4 fold increase in gene expression [19], [20], most likely by introducing ETS transcription binding sites [19][21]. Although multiple adjacent nucleotides could acquire UV-induced C>T or CC>TT mutations (Figure 1), the mutations identified in BCC and SCC in our study almost exclusively affected the TERT promoter at the described functionally relevant hotspots. This clearly implies a high selection pressure for these mutations, resulting in overexpression of the telomerase holoenzyme. Telomerase expression in tumors is critical for maintaining telomere length and chromosomal stability, which allows cells to continuously proliferate without becoming genetically unstable, and avoiding apoptosis or senescence [29], [30].

The only significant correlation with clinical parameters observed in our cohort, was a slight difference in age between TERT promoter mutant and non-mutant BCC. Our cohort is small and larger more detailed follow up studies will be required to verify this finding and to determine if additional clinicopathologic correlations with TERT promoter mutation status can be identified.

In summary, our study identifies TERT promoter mutations with a UV-signature as frequent events in BCC and SCC non-melanoma skin cancer. Similar results independently validating these findings were recently reported by Scott et al., who found recurrent TERT promoter mutations in 78% of BCC and 50% of SCC [26]. Future studies will be required to determine whether TERT promoter mutations have prognostic implications or may be targeted therapeutically. This would be especially valuable in patients with metastatic SCC for whom prognosis is poor and effective therapies are lacking.

Acknowledgments

We would like to thank Mingxia Song and Nicola Bielefeld for their excellent technical support.

Author Contributions

Conceived and designed the experiments: KGG RM UH TS. Performed the experiments: I. Möller I. Moll MS AS KGG. Analyzed the data: KGG BS TS LZ DS UH. Contributed reagents/materials/analysis tools: KGG UH TS. Wrote the paper: KGG RM BS TS I. Möller I. Moll MS AS LZ DS UH.

References

  1. 1. Miller DL, Weinstock MA (1994) Nonmelanoma skin cancer in the United States: incidence. J Am Acad Dermatol 30: 774–778.
  2. 2. Leiter U, Garbe C (2008) Epidemiology of melanoma and nonmelanoma skin cancer--the role of sunlight. Adv Exp Med Biol 624: 89–103.
  3. 3. Epstein EH (2008) Basal cell carcinomas: attack of the hedgehog. Nat Rev Cancer 8: 743–754.
  4. 4. Alam M, Ratner D (2001) Cutaneous squamous-cell carcinoma. N Engl J Med 344: 975–983.
  5. 5. Rubin AI, Chen EH, Ratner D (2005) Basal-cell carcinoma. N Engl J Med 353: 2262–2269.
  6. 6. Hahn H, Wicking C, Zaphiropoulous PG, Gailani MR, Shanley S, et al. (1996) Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell 85: 841–851.
  7. 7. Johnson RL, Rothman AL, Xie J, Goodrich LV, Bare JW, et al. (1996) Human homolog of patched, a candidate gene for the basal cell nevus syndrome. Science 272: 1668–1671.
  8. 8. Gailani MR, Stahle-Backdahl M, Leffell DJ, Glynn M, Zaphiropoulos PG, et al. (1996) The role of the human homologue of Drosophila patched in sporadic basal cell carcinomas. Nat Genet 14: 78–81.
  9. 9. Aszterbaum M, Rothman A, Johnson RL, Fisher M, Xie J, et al. (1998) Identification of mutations in the human PATCHED gene in sporadic basal cell carcinomas and in patients with the basal cell nevus syndrome. J Invest Dermatol 110: 885–888.
  10. 10. Xie J, Murone M, Luoh SM, Ryan A, Gu Q, et al. (1998) Activating Smoothened mutations in sporadic basal-cell carcinoma. Nature 391: 90–92.
  11. 11. Ling G, Ahmadian A, Persson A, Unden AB, Afink G, et al. (2001) PATCHED and p53 gene alterations in sporadic and hereditary basal cell cancer. Oncogene 20: 7770–7778.
  12. 12. Ziegler A, Leffell DJ, Kunala S, Sharma HW, Gailani M, et al. (1993) Mutation hotspots due to sunlight in the p53 gene of nonmelanoma skin cancers. Proc Natl Acad Sci U S A 90: 4216–4220.
  13. 13. Sekulic A, Migden MR, Oro AE, Dirix L, Lewis KD, et al. (2012) Efficacy and safety of vismodegib in advanced basal-cell carcinoma. N Engl J Med 366: 2171–2179.
  14. 14. Ulrich C, Schmook T, Sachse MM, Sterry W, Stockfleth E (2004) Comparative epidemiology and pathogenic factors for nonmelanoma skin cancer in organ transplant patients. Dermatol Surg 30: 622–627.
  15. 15. Pierceall WE, Goldberg LH, Tainsky MA, Mukhopadhyay T, Ananthaswamy HN (1991) Ras gene mutation and amplification in human nonmelanoma skin cancers. Mol Carcinog 4: 196–202.
  16. 16. Brash DE, Rudolph JA, Simon JA, Lin A, McKenna GJ, et al. (1991) A role for sunlight in skin cancer: UV-induced p53 mutations in squamous cell carcinoma. Proc Natl Acad Sci U S A 88: 10124–10128.
  17. 17. Ratushny V, Gober MD, Hick R, Ridky TW, Seykora JT (2012) From keratinocyte to cancer: the pathogenesis and modeling of cutaneous squamous cell carcinoma. J Clin Invest 122: 464–472.
  18. 18. Wang NJ, Sanborn Z, Arnett KL, Bayston LJ, Liao W, et al. (2011) Loss-of-function mutations in Notch receptors in cutaneous and lung squamous cell carcinoma. Proc Natl Acad Sci U S A 108: 17761–17766.
  19. 19. Huang FW, Hodis E, Xu MJ, Kryukov GV, Chin L, et al. (2013) Highly recurrent TERT promoter mutations in human melanoma. Science 339: 957–959.
  20. 20. Horn S, Figl A, Rachakonda PS, Fischer C, Sucker A, et al. (2013) TERT promoter mutations in familial and sporadic melanoma. Science 339: 959–961.
  21. 21. Killela PJ, Reitman ZJ, Jiao Y, Bettegowda C, Agrawal N, et al.. (2013) TERT promoter mutations occur frequently in gliomas and a subset of tumors derived from cells with low rates of self-renewal. Proc Natl Acad Sci U S A.
  22. 22. Landa I, Ganly I, Chan TA, Mitsutake N, Matsuse M, et al.. (2013) Frequent Somatic TERT Promoter Mutations in Thyroid Cancer: Higher Prevalence in Advanced Forms of the Disease. J Clin Endocrinol Metab.
  23. 23. Vinagre J, Almeida A, Populo H, Batista R, Lyra J, et al. (2013) Frequency of TERT promoter mutations in human cancers. Nat Commun 4: 2185.
  24. 24. Griewank KG, Murali R, Schilling B, Scholz S, Sucker A, et al. (2013) TERT promoter mutations in ocular melanoma distinguish between conjunctival and uveal tumours. Br J Cancer 109: 497–501.
  25. 25. Griewank K, Schilling B, Murali R, Bielefeld N, Schwamborn M, et al.. (2013) TERT promoter mutations are frequent in atypical fibroxanthomas and pleomorphic dermal sarcomas. Mod Pathol.
  26. 26. Scott GA, Laughlin TS, Rothberg PG (2013) Mutations of the TERT promoter are common in basal cell carcinoma and squamous cell carcinoma. Mod Pathol.
  27. 27. Pleasance ED, Cheetham RK, Stephens PJ, McBride DJ, Humphray SJ, et al. (2010) A comprehensive catalogue of somatic mutations from a human cancer genome. Nature 463: 191–196.
  28. 28. Genomes Project C, Abecasis GR, Auton A, Brooks LD, DePristo MA, et al (2012) An integrated map of genetic variation from 1,092 human genomes. Nature 491: 56–65.
  29. 29. Blackburn EH (2005) Telomeres and telomerase: their mechanisms of action and the effects of altering their functions. FEBS Lett 579: 859–862.
  30. 30. Gunes C, Rudolph KL (2013) The role of telomeres in stem cells and cancer. Cell 152: 390–393.
  31. 31. Kossard S EJ, EH, Cerio R, Yu LL, Weedon D (2006) Basal Cell Carcinoma. In: LeBoit PE BG, Weedon D, Sarasin A, editors. World Health Organization Classification of Tumours: Pathology and Genetics of Skin Tumours Lyon: IARC Press. pp. 13–19
  32. 32. de Vries E BF, Coebergh JW, Cerroni L, Ruiter DJ, Elder DE, et al.. (2006) Malignant melanoma: Introduction. In: LeBoit PE BG, Weedon D, Sarasin A, editors. World Health Organization Classification of Tumours: Pathology and Genetics of Skin Tumours Lyon: IARC Press. pp. 52–65
  33. 33. Weedon D MM, Gross C, Nagore E, Yu LL (2006) Squamous Cell Carcinoma. In: LeBoit PE BG, Weedon D, Sarasin A, editors. World Health Organization Classification of Tumours: Pathology and Genetics of Skin Tumours Lyon: IARC Press. pp. 20–25