Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

The Co-Existence of the IL-18+183 A/G and MMP-9 -1562 C/T Polymorphisms Is Associated with Clinical Events in Coronary Artery Disease Patients

  • Trine B. Opstad ,

    trineoa@medisin.uio.no

    Affiliations Center for Clinical Heart Research, Department of Cardiology, Oslo University Hospital, Ullevål, Oslo, Norway, Center for Heart Failure Research, Oslo University Hospital, Oslo, Norway

  • Alf Å. Pettersen,

    Affiliations Center for Clinical Heart Research, Department of Cardiology, Oslo University Hospital, Ullevål, Oslo, Norway, Center for Heart Failure Research, Oslo University Hospital, Oslo, Norway

  • Harald Arnesen,

    Affiliations Center for Clinical Heart Research, Department of Cardiology, Oslo University Hospital, Ullevål, Oslo, Norway, Center for Heart Failure Research, Oslo University Hospital, Oslo, Norway, Faculty of Medicine, University of Oslo, Oslo, Norway

  • Ingebjørg Seljeflot

    Affiliations Center for Clinical Heart Research, Department of Cardiology, Oslo University Hospital, Ullevål, Oslo, Norway, Center for Heart Failure Research, Oslo University Hospital, Oslo, Norway, Faculty of Medicine, University of Oslo, Oslo, Norway

The Co-Existence of the IL-18+183 A/G and MMP-9 -1562 C/T Polymorphisms Is Associated with Clinical Events in Coronary Artery Disease Patients

  • Trine B. Opstad, 
  • Alf Å. Pettersen, 
  • Harald Arnesen, 
  • Ingebjørg Seljeflot
PLOS
x

Abstract

Objective

Interleukin (IL)-18 has been associated with severity of atherosclerosis and discussed to predict cardiovascular (CV) events. We have previously shown that the IL-18+183 G-allele significantly reduces IL-18 levels. This study was aimed to investigate the prognostic significance of the IL-18+183 A/G polymorphism (rs5744292), single and in coexistence with the matrix metalloproteinase (MMP)-9 -1562 C/T (rs3918242) polymorphism, in patients with stable coronary artery disease (CAD). Serum levels of IL-18, MMP-9 and tissue inhibitor of matrix metalloproteinase (TIMP)-1 were additionally assessed.

Methods

1001 patients with angiographically verified CAD were genotyped and the biomarkers were measured accordingly. After two years follow-up, 10.6% experienced new clinical events; acute myocardial infarction (AMI), stroke, unstable angina pectoris and death.

Results

The IL-18+183 G-allele associated with 35% risk reduction in composite endpoints after adjusting for potential covariates (p = 0.044). The IL-18+183 AA/MMP-9 -1562 CT/TT combined genotypes associated with a significant increase in risk of composite endpoints (OR = 1.87; 95% CI = 1.13–3.11, p = 0.015, adjusted). Patients with clinical events presented with significantly higher IL-18 levels as compared to patients without (p = 0.011, adjusted). The upper tertile of IL-18 levels associated with an increase in risk of AMI as compared to lower tertiles (OR = 2.36; 95% CI = 1.20–4.64, p = 0.013, adjusted).

Conclusion

The IL-18+183 A/G polymorphism, single and in combination with MMP-9 genotypes, may influence the risk of clinical events in stable CAD patients.

Introduction

The pro-inflammatory cytokine interleukin-18 (IL-18) is among the more recently recognized cytokines assumed to be involved in the development of cardiovascular disease (CVD). Increasing evidence from both experimental and clinical studies indicates that IL-18 is a key player in the inflammatory process leading to atherosclerosis [1][3]. Furthermore, the augmentation of IL-18 has been associated with different clinical states of CVD; acute coronary syndrome (ACS), type 2 diabetes, the metabolic syndrome, hypertension (HT), worse prognosis of CVD and mortality [4][9].

Known stimuli for IL-18 synthesis are hyperglycemia [10], [11], nuclear transcription factor -κB (NFκB) and interferon-gamma (IFNγ) [12], cathecholamines [13], angiotensin II [14] and inflammation in general, whereas IL-18 induces multiple effects downstream by stimulating maturation of T cells and inducing expression of chemokines, adhesion molecules and cytokines, including INFγ and matrix metalloproteinases (MMPs) in different cell types [12], including MMP-9 [15]. Notably, high levels of MMP-9 have been associated with plaque progression, destability and rupture [16]. These various effects exaggerate the inflammatory process, promoting atherosclerosis and increasing the risk of atherothrombosis and cardiovascular (CV) events.

Elevated levels of IL-18 were previously shown to be predictive of coronary events in healthy middle-aged men [17] and in high risk patients [7], CV death in patients with stable and unstable angina pectoris (UAP) [9], and of all-cause mortality in ACS [18]. We and others have previously shown that the IL-18+183 A/G polymorphism, located in the 3′ untranslated region (UTR) of the IL-18 gene mapped to chromosome 11q22 in humans, induces lower levels of circulating IL-18 [19], [20]. The polymorphism is postulated to affect mRNA stability, which may be a molecular basis for the observation. The +183 A-allele was further observed to be more frequent in patients with HT as compared to the variant G-allele [19]. By studying five different IL-18 polymorphisms, which defined six haplotypes, the only haplotype showing a protective effect on CV mortality, included the +183 G allele. The same haplotype was also associated with lower IL-18 levels [20].

IL-18 has been shown to induce MMP-9 expression through the nuclear factor κB (NFκB) pathway [21], thus, combined determination of both markers, also genetically, may be of special interest in relation to risk prediction.

The T-allele of the MMP-9 -1562 C/T promoter polymorphism has been shown in several studies to induce higher MMP-9 levels [22], [23] and is also correlated to clinical severity [24], thus being a potential genetic marker for such combined genetic risk assessment. This polymorphism has been associated with higher promoter activity and increased expression of the gene, due to preferential binding of a transcription repressor to the C-allele [24].The human MMP-9 gene maps to chromosome 20q11-13.

Based on the knowledge that these specific polymorphisms in the IL-18 and MMP-9 genes have the ability to modify the circulating levels of their respective protein, it might be suggested that a combination of these polymorphisms may be of special importance.

We aimed therefore in the present study to explore the predictivity of the IL-18+183 A/G polymorphism, single and in co-existence with the MMP-9 -1562 C/T polymorphism, for clinical events in patients with stable CAD in a follow-up period of 2 years. Circulating levels of IL-18, MMP-9 and TIMP-1 were further assessed in relation to outcome.

The study showed an association of the IL-18+183 A/G polymorphism with new CV events, and the risk increased when both IL-18 and MMP-9 polymorphisms were present. The upper tertile of circulating IL-18 levels was predictive for acute myocardial infarction (AMI).

Materials and Methods

Study Population

In the present study 1001 patients with angiographically verified stable CAD were investigated (median age 62 years, 22% women, 97% of Western European descent), all enrolled in the ASCET (ASpirin non-responsiveness and Clopidogrel Endpoint Trial) study [25], [26]. Patients were followed up for a minimum of 2 years and the primary end point included the first event of the composite of nonfatal AMI, unstable angina pectoris (UAP), stroke and all-cause mortality. In patients unable to attend the final visit, the clinical endpoints were recorded on request. No patients were lost to follow-up. Evaluation of end points was performed by an end point committee without access to the laboratory data.

Relatedness in the population was <1%. The ASCET study is registered at; clinicaltrials.gov, identification number: NCT00222261.

Ethics Statement

The study was approved by The Regional Committee of Medical Research Ethics in South-Eastern Norway. All patients gave their written informed consent to participate.

Laboratory Methods

In fasting conditions between 8.00–10.00 a.m., blood samples were collected at entrance into the ASCET study. Serum was prepared by centrifugation within 1 hour at 2.500×g for 10 minutes for determination of IL-18, MMP-9 and TIMP-1, and EDTA blood was collected for DNA extraction, all kept frozen at –80°C until analyzed. Routine analyses (lipids, glucose) were measured by use of convential methods. Concentrations of IL-18, MMP-9 and TIMP-1 were determined using the Human IL-18 ELISA kit (Medical Biological Laboratories, Naka-ku Nagoya, Japan), and the Total MMP-9 and TIMP-1 ELISA kits (R&D Systems, Europe, Abingdon, Oxon, UK). The coefficients of variation for the IL-18, MMP-9 and TIMP-1 analysis were 8.1%, 7.3% and 4.4%, respectively. The concentrations of IL-18 MMP-9 and TIMP-1 were analyzed in all patients.

DNA was isolated from whole blood using a MagNA Pure LC DNA Isolation kit (Roche Diagnostics, GmbH, Mannheim, Germany). DNA purity and quantity were tested on the NanoDrop, ND-1000 (Saveen Werner, Sweden). The 3′UTR +183A/G polymorphism (rs5744292) was genotyped with a Custom Design Assay manufactured by Applied Biosystems’ The Custom TaqMan® Assays Service in a 7900 HT Real-Time polymerase chain reaction (PCR) system (Applied Biosystems, Foster City, CA, USA). The MMP-9 -1562 C/T polymorphism (rs3918242) was genotyped by Real-Time PCR and melting curves analysis on the Light Cycler Instrument 1.2 (Roche Diagnostics) using primers 5′GATCACTTGAGTCAGAAGTTCGAAA3′ and 5′TTTGGGGGGTGTAGTATCACTCT3′ and probes synthesized by TIB MOLBIOL (D-12103 Berlin, Germany), and Light Cycler® FastStart DNA Master Hybridization Probes kit (Roche Diagnostics).

The IL-18+183 A/G and MMP-9 -1562 C/T polymorphisms were successfully analyzed in 996 samples. Genotype calling was automatically applied in the assay, with 95% confidence. About 5% of the samples were repeated, with 100% concordance. For the +183 A/G SNP assay, samples with verified AA/AG/GG genotypes were included as positive controls, kindly provided by Dr. Laurence Tirét, Faculté de Médicine, Paris, France.

Statistics

Students’ t- test and Mann-Whitney test, when appropriate, were used for continuous data, and the χ2 test for categorical data. For correlation analysis, Spearman’s Rho was applied. The associations of circulating IL-18 and IL-18/MMP-9 genotypes, respectively, with clinical outcome were analyzed by linear and logistic regression models, with adjustment of potential covariates; age, sex, previous MI and stroke, treatment modality (i.e. aspirin or clopidogrel), and the use of nitrates, as appear from Table 1 (p<0.2). The Hardy-Weinberg equilibrium (HWE) was tested using the χ2 test. All statistical analyses were performed by SPSS 19.0 (SPSS Inc., Chicago, Illinois, USA). A two-tailed probability test of 0.05 or less was considered statistically significant.

thumbnail
Table 1. Baseline characteristics according to occurrence of clinical composite endpoints after 2 years.

https://doi.org/10.1371/journal.pone.0074498.t001

Results

Characteristics of the Study Population

The total number of primary endpoints recorded was 106; AMI (n = 36), stroke (n = 28), UAP (33) and deaths (n = 9). Baseline characteristics of patients according to occurrence of clinical endpoints are shown in Table 1. Previous myocardial infarction (MI), stroke and nitrates medication were more frequent in patients with new clinical events. Due to low number of deaths, and a heterogeneous group of patients with UAP, these subgroups have not been separately analyzed.

We have previously reported on the influence of the IL-18+183 A/G and MMP-9 -1562 C/T polymorphisms on circulating protein levels [19], [22], showing IL-18 levels to be significantly lower in subjects carrying the G-allele and MMP-9 levels to be significantly higher in subjects carrying the T-allele. Other previously investigated polymorphisms (IL-18 -137 and IL-18 -607 in the IL-18 promoter and the MMP-9 R79Q A/G in exon 6) did not affect circulating protein levels [19], [22].

Genetic Influence on New Clinical Events

The associations of the IL-18+183 A/G and MMP-9 -1562 C/T polymorphisms with clinical endpoints are shown in Table 2. The IL-18 G-allele associated with 35% risk reduction in composite endpoints and the association persisted after adjustment for covariates (OR = 0.65; 95% confidence interval (CI) = 0.43–0.99, p = 0.044). As the reference IL-18 AA genotype (wild-type) seems to be unfavorable, we combined the AA genotype with the MMP-9 -1562 T-allele, known to induce elevated MMP-9 levels, and tested their coexistence to evaluate a common genetic score. The combined IL-18 AA/MMP-9 CT/TT genotypes associated with an increase in risk of composite endpoints (OR = 1.87; 95% CI = 1.13–3.11, p = 0.015, adjusted) and ischemic stroke (OR = 2.54; 95% CI = 1.07–6.00, p = 0.034, adjusted). The single presence of the -1562 T-allele only tended to associate with composite endpoints. The IL-18 and MMP-9 genotypes were in Hardy Weinberg Equilibrium (p>0.4, both) and the observed minor allele frequencies are in line with previous reports.

thumbnail
Table 2. Frequencies of the IL-18+183 A/G and MMP-9 -1562 C/T polymorphisms, as related to clinical endpoints.

https://doi.org/10.1371/journal.pone.0074498.t002

Serum Concentrations and Future Clinical Events

As shown in Figure 1, serum levels of IL-18 were significantly higher in patients with clinical endpoints during follow-up as compared to patients without (270 versus 246 pg/mL, p = 0.011, adjusted) and especially higher in patients suffering AMI (294 versus 247 pg/mL, p = 0.017, adjusted). Levels of IL-18 were not significantly elevated in patients with ischemic stroke. When dividing IL-18 levels into tertiles, a significant trend for increasing number of AMI through tertiles was observed (p for trend = 0.038) (Figure 2). The upper tertile of IL-18 was strongly associated with incidence of AMI as compared to the two lowest tertiles, OR = 2.36, 95% CI = 1.20–4.64, p = 0.013, adjusted. When additionally adjusting for the IL-18+183 polymorphism, the association persisted (OR = 2.30; 95% CI = 1.16–4.54, p = 0.017). The upper tertile associated similarly with the incidence of composite endpoints, OR = 1.50, 95% CI = 0.99–2.27, however only borderline significant (p = 0.058), and was not associated with stroke.

thumbnail
Figure 1. Median levels of IL-18 (25, 75 percentiles) as related to clinical endpoints.

p-values are adjusted for age, gender, previous myocardial infarction (MI), stroke, treatment modality, and use of nitrates.

https://doi.org/10.1371/journal.pone.0074498.g001

thumbnail
Figure 2. Tertiles of IL-18 as related to clinical endpoints.

33 percentiles = 212.5 pg/mL, 66 percentiles = 293.1 pg/mL. p-values refer to the comparison of 2 groups dichotomized between second and third tertile. p-values are adjusted for age, gender, previous myocardial infarction (MI) and stroke, treatment modality and use of nitrates.

https://doi.org/10.1371/journal.pone.0074498.g002

Serum levels of MMP-9 and TIMP-1 were not related to future clinical events in either of the endpoint groups (data not shown). Notably, IL-18 levels above median associated with significantly higher MMP-9 levels as compared to patients with IL-18 levels below median (MMP-9∶243 versus 230 pg/mL, p = 0.027, adjusted). The two biomarkers were only weakly correlated (r = 0.077, p = 0.019).

The additive effect of having the combined IL-18 AA and MMP-9 CT/TT genotypes on circulating protein levels was not statistically significant, although numerically higher levels were observed of both markers (IL-18∶258 versus 246 pg/mL, adjusted p-value = 0.105, and for MMP-9∶257 versus 234 pg/mL, adjusted p-value = 0.057), when compared to the combined IL-18 AG/GG/MMP-9 CC genotypes.

Discussion

In this prospective study of patients with known stable CAD, we have observed an association between the IL-18+183 A/G polymorphism and an increased risk of future clinical events in a time-frame of minimum two years. The importance of circulating IL-18 levels in predicting new events is additionally verified, especially with regard to future AMI. We further observed an additional risk of composite endpoints when combining IL-18/MMP-9 genotypes. The observed associations were unaffected by adjustment for clinical and therapeutic covariates.

In a population comparable to ours, the IL-18+183 A/G polymorphism, in haplotypes with other linked IL-18 polymorphisms, has previously been shown associated with CV mortality during 4 years of follow-up [20]. Out of 6, the only haplotype that was related to reduced mortality risk included the +183 G-allele [20]. In the present study the +183 G-allele associated with 35% risk reduction of composite endpoints, and 6 out of 9 deaths were homozygous of the +183 A-allele (data not shown). We have previously reported on the lack of an association between two promoter IL-18 polymorphisms and IL-18 serum concentrations [19]. The two variants, −137 G/C (rs187238) and −607 C/A (rs1946518) were also not associated with clinical endpoints in the present study. The −137 G/C polymorphism was previously shown to associate with the occurrence of sudden cardiac death among Western European descent males [27].

Little is known about the combined genetic influence of IL-18 and MMP-9, which may provide additional information on CV risk and prediction, as previously indicated [23]. IL-18 has been shown to release MMP-9 from peripheral blood mononuclear cells [28] and the T helper cell 1 polarization driven by IL-18 may also affect MMP-9 expression [29]. Both IL-18 and MMP-9 are considered as important mediators during the development of CVD, and the combined determination of IL-18 and MMP-9, also genetically, may identify patients at very high risk. We have demonstrated for the first time that patients genetically predisposed for elevated circulating levels of both biomarkers, possessed additionally higher risk of composite clinical endpoints.

The risk prediction of circulating IL-18 levels has previously been demonstrated regarding CV mortality [9], heart failure, MI and deaths in patients diagnosed with ACS [18], and in healthy men suffering coronary events [17]. We have in the present study verified the prognostic value of IL-18 levels for clinical events in stable CAD patients. Elevated IL-18 levels seemed to especially predict AMI, independent of the IL-18+183 A/G polymorphism. Levels of IL-18 were not associated with stroke, probably due to the lower number.

Elevated circulating levels and expression of MMP-9 have been associated with the development and progression of atherosclerosis, and the importance of the MMP-9 gene, especially the functional promoter −1562 C/T polymorphism, is documented in both experimental and clinical studies [24], [30], [31]. Limited and conflicting data exist on the prognostic value of the polymorphism as related to CV outcome [23], [32]. In the present study the −1562 T allele was only weakly associated with new clinical events. The previous investigated MMP-9 exon 6 R279Q A/G (rs17576) polymorphism [22] was not associated with clinical endpoints. We observed no association of MMP-9 circulating levels with clinical outcome, which is in contrast to observations made by Blankenberg et al, observing higher MMP-9 levels in relation to CV death [23]. This discrepancy may be due to differences in study cohorts. Serum concentrations of IL-18 and MMP-9 were only weakly correlated, although statistically significant, suggesting independent functional roles of the two biomarkers with regard to CVD and clinical outcome. The higher MMP-9 levels in patients with IL-18 levels above median and not below, may indicate the need for a certain threshold of IL-18 levels to affect MMP-9 expression.

Our study is limited by the relative short follow-up time and the low number of clinical events. This investigation is a sub-study of the ASCET trial and power calculation was performed on the hypothesis in the main study [25]. A post-hoc power calculation for our purpose could be implemented, however, as the present investigation is restricted to exact number of patients enrolled in the main study, an adequate sample size is unrealizable. The low number of clinical events also contributes to an eventual underestimation. As the present study was performed in Western European descents, the generalization to other ethnical groups should be avoided.

In conclusion, the IL-18+183 A/G polymorphism may be a novel prognostic marker for future clinical events in CAD patients. The additional risk observed for the combined genetic influence of both IL-18/MMP-9 loci suggests the superiority of screening more than one marker to identify patients at high risk. This may provide extra information for CV risk stratification and prediction, although results are considered hypothesis generating and should be replicated in further studies. Finally, the prognostic value of serum IL-18 concentration has previously been documented, and is hereby confirmed in a large cohort of stable CAD patients.

Acknowledgments

We want to especially thank Vibeke Bratseth and Sissel Åkra for expert technical assistance.

Author Contributions

Conceived and designed the experiments: TBO AÅP HA IS. Performed the experiments: TBO. Analyzed the data: TBO. Contributed reagents/materials/analysis tools: AÅP IS. Wrote the paper: TBO IS.

References

  1. 1. Whitman SC, Ravisankar P, Daugherty A (2002) Interleukin-18 enhances atherosclerosis in apolipoprotein E(−/−) mice through release of interferon-gamma. Circ Res 90: E34–E38.
  2. 2. Mallat Z, Corbaz A, Scoazec A, Besnard S, Leseche G, et al. (2001) Expression of interleukin-18 in human atherosclerotic plaques and relation to plaque instability. Circulation 104: 1598–1603.
  3. 3. Mallat Z, Corbaz A, Scoazec A, Graber P, Alouani S, et al. (2001) Interleukin-18/interleukin-18 binding protein signaling modulates atherosclerotic lesion development and stability. Circ Res 89: E41–E45.
  4. 4. Chalikias GK, Tziakas DN, Kaski JC, Hatzinikolaou EI, Stakos DA, et al. (2005) Interleukin-18: interleukin-10 ratio and in-hospital adverse events in patients with acute coronary syndrome. Atherosclerosis 182: 135–143
  5. 5. Hivert MF, Sun Q, Shrader P, Mantzoros CS, Meigs JB, et al. (2009) Circulating IL-18 and the risk of type 2 diabetes in women. Diabetologia 52: 2101–2108.
  6. 6. Espinola-Klein C, Rupprecht HJ, Bickel C, Lackner K, Genth-Zotz S, et al. (2008) Impact of inflammatory markers on cardiovascular mortality in patients with metabolic syndrome. Eur J Cardiovasc Prev Rehabil 15: 278–284.
  7. 7. Troseid M, Seljeflot I, Hjerkinn EM, Arnesen H (2009) Interleukin-18 is a strong predictor of cardiovascular events in elderly men with the metabolic syndrome: synergistic effect of inflammation and hyperglycemia. Diabetes Care 32: 486–492.
  8. 8. Rabkin SW (2009) The role of interleukin 18 in the pathogenesis of hypertension-induced vascular disease. Nat Clin Pract Cardiovasc Med 6: 192–199.
  9. 9. Blankenberg S, Tiret L, Bickel C, Peetz D, Cambien F, et al. (2002) Interleukin-18 is a strong predictor of cardiovascular death in stable and unstable angina. Circulation 106: 24–30.
  10. 10. Weiss TW, Arnesen H, Troseid M, Kaun C, Hjerkinn EM, et al. (2011) Adipose tissue expression of interleukin-18 mRNA is elevated in subjects with metabolic syndrome and independently associated with fasting glucose. Wien Klin Wochenschr 123: 650–654
  11. 11. Esposito K, Nappo F, Marfella R, Giugliano G, Giugliano F, et al. (2002) Inflammatory cytokine concentrations are acutely increased by hyperglycemia in humans: role of oxidative stress. Circulation 106: 2067–2072.
  12. 12. Gracie JA, Robertson SE, McInnes IB (2003) Interleukin-18. J Leukoc Biol 73(2): 213–224.
  13. 13. Chandrasekar B, Marelli-Berg FM, Tone M, Bysani S, Prabhu SD, et al. (2004) Beta-adrenergic stimulation induces interleukin-18 expression via beta2-AR, PI3K, Akt, IKK, and NF-kappaB. Biochem Biophys Res Commun 319(2): 304–311.
  14. 14. Sahar S, Dwarakanath RS, Reddy MA, Lanting L, Todorov I, et al. (2005) Angiotensin II enhances interleukin-18 mediated inflammatory gene expression in vascular smooth muscle cells: a novel cross-talk in the pathogenesis of atherosclerosis. Circ Res 96: 1064–1071
  15. 15. Gerdes N, Sukhova GK, Libby P, Reynolds RS, Young JL, et al. (2002) Expression of interleukin (IL)-18 and functional IL-18 receptor on human vascular endothelial cells, smooth muscle cells, and macrophages: implications for atherogenesis. J Exp Med 195(2): 245–257.
  16. 16. Koenig W, Khuseyinova N (2007) Biomarkers of atherosclerotic plaque instability and rupture. Arterioscler Thromb Vasc Biol 27: 15–26.
  17. 17. Blankenberg S, Luc G, Ducimetiere P, Arveiler D, Ferrieres J, et al. (2003) Interleukin-18 and the risk of coronary heart disease in European men: the Prospective Epidemiological Study of Myocardial Infarction (PRIME). Circulation 108: 2453–2459.
  18. 18. Hartford M, Wiklund O, Hulten LM, Persson A, Karlsson T, et al. (2010) Interleukin-18 as a predictor of future events in patients with acute coronary syndromes. Arterioscler Thromb Vasc Biol 30: 2039–2046
  19. 19. Opstad TB, Pettersen AA, Arnesen H, Seljeflot I (2011) Circulating levels of IL-18 are significantly influenced by the IL-18+183 A/G polymorphism in coronary artery disease patients with diabetes type 2 and the metabolic syndrome: an observational study. Cardiovasc Diabetol 10: 110
  20. 20. Tiret L, Godefroy T, Lubos E, Nicaud V, Tregouet DA, et al. (2005) Genetic analysis of the interleukin-18 system highlights the role of the interleukin-18 gene in cardiovascular disease. Circulation 112: 643–650.
  21. 21. Chandrasekar B, Mummidi S, Mahimainathan L, Patel DN, Bailey SR, et al. (2006) Interleukin-18-induced human coronary artery smooth muscle cell migration is dependent on NF-kappaB- and AP-1-mediated matrix metalloproteinase-9 expression and is inhibited by atorvastatin. J Biol Chem 281: 15099–15109
  22. 22. Opstad TB, Pettersen AA, Weiss TW, Akra S, Ovstebo R, et al. (2012) Genetic variation, gene-expression and circulating levels of matrix metalloproteinase-9 in patients with stable coronary artery disease. Clin Chim Acta 413: 113–120
  23. 23. Blankenberg S, Rupprecht HJ, Poirier O, Bickel C, Smieja M, et al. (2003) Plasma concentrations and genetic variation of matrix metalloproteinase 9 and prognosis of patients with cardiovascular disease. Circulation 107: 1579–1585.
  24. 24. Zhang B, Ye S, Herrmann SM, Eriksson P, de Maat M, et al. (1999) Functional polymorphism in the regulatory region of gelatinase B gene in relation to severity of coronary atherosclerosis. Circulation 99: 1788–1794.
  25. 25. Pettersen AA, Seljeflot I, Abdelnoor M, Arnesen H (2004) Unstable angina, stroke, myocardial infarction and death in aspirin non-responders. A prospective, randomized trial. The ASCET (ASpirin non-responsiveness and Clopidogrel Endpoint Trial) design. Scand Cardiovasc J 38: 353–356.
  26. 26. Pettersen AA, Seljeflot I, Abdelnoor M, Arnesen H (2012) High On-Aspirin Platelet Reactivity and Clinical Outcome in Patients With Stable Coronary Artery Disease: Results From ASCET (Aspirin Nonresponsiveness and Clopidogrel Endpoint Trial). J Am Heart Assoc 1: e000703
  27. 27. Hernesniemi JA, Karhunen PJ, Rontu R, Ilveskoski E, Kajander O, et al. (2008) Interleukin-18 promoter polymorphism associates with the occurrence of sudden cardiac death among Caucasian males: the Helsinki Sudden Death Study. Atherosclerosis 196: 643–649.
  28. 28. Nold M, Goede A, Eberhardt W, Pfeilschifter J, Muhl H (2003) IL-18 initiates release of matrix metalloproteinase-9 from peripheral blood mononuclear cells without affecting tissue inhibitor of matrix metalloproteinases-1: suppression by TNF alpha blockage and modulation by IL-10. Naunyn Schmiedebergs Arch Pharmacol 367: 68–75
  29. 29. Oviedo-Orta E, Bermudez-Fajardo A, Karanam S, Benbow U, Newby AC (2008) Comparison of MMP-2 and MMP-9 secretion from T helper 0, 1 and 2 lymphocytes alone and in coculture with macrophages. Immunology 124: 42–50
  30. 30. Koh YS, Chang K, Kim PJ, Seung KB, Baek SH, et al. (2008) A close relationship between functional polymorphism in the promoter region of matrix metalloproteinase-9 and acute myocardial infarction. Int J Cardiol 127: 430–432.
  31. 31. Medley TL, Cole TJ, Dart AM, Gatzka CD, Kingwell BA (2004) Matrix metalloproteinase-9 genotype influences large artery stiffness through effects on aortic gene and protein expression. Arterioscler Thromb Vasc Biol 24: 1479–1484.
  32. 32. Mizon-Gerard F, de Groote P, Lamblin N, Hermant X, Dallongeville J, et al. (2004) Prognostic impact of matrix metalloproteinase gene polymorphisms in patients with heart failure according to the aetiology of left ventricular systolic dysfunction. Eur Heart J 25: 688–693