Fish husbandry

Wild type (AB) strain and TOP:dGFP transgenic line (kindly provided by Dr. Steve Wilson) were maintained under a light and dark cycle of 14 and 10 hours, respectively. Embryos collected from natural spawnings were cultured at 28.5°C, and staged according to Kimmel et al [33]. Embryos for in situ hybridization were treated with 0.003% 1-phenyl-2-thiourea from 10 hpf (hours post-fertilization) to prevent pigmentation. The sox10^m618 strain was maintained as heterozygous carriers [14].

Cloning of fzd genes

The primer sequences used for cloning are shown in Table 1. cDNAs for cloning were prepared from 24 hpf wild type AB embryos using TRI reagent (Sigma) and superscript III (Invitrogen). To amplify specific fragments by polymerase chain reaction (PCR), we used GoTaq polymerase (Promega); amplified fragments were cloned into pGEM-T easy vector (Promega) by standard TA-cloning. Cloned fragments were identified by restriction digestion and partial sequencing. All cloned fzd genes showed >98% nucleotide identity to the reported sequences, although fzd2 showed a 38 bp deletion in the 3′UTR and is likely to represent a splicing variant. We further validated our clones by comparison of expression patterns with those reported for zebrafish and/or other vertebrates.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. Sequence information of fzd examined.

https://doi.org/10.1371/journal.pone.0054833.t001

Probe synthesis and whole mount in situ hybridization

The enzymes used for making probes are also in Table 1. fzd7b cDNA in pSPORTvector was kindly provided by Dr. Vladimir Korzh [28]. It was linearized and transcribed with Sal I and SP6, respectively. Whole mount in situ hybridization was carried out as described before [34]. All embryos were cleared by transferring through a series of glycerol buffered by PBS (phosphate buffered saline). Images were taken under compound microscope (NIKON Eclipse E800) using a Digital Sight DS-U1 camera (Nikon). Image processing was carried out using Photoshop (Adobe).

Morpholino injection

Sequences of all morpholinos used in these experiments are in Table 2. Morpholinos against fzd9b and fzd10 were designed for this work (GeneTools LLC.). For fzd3a-MO, we used the previously published sequence [35], while for fzd7a and fzd7b we obtained sequence information for effective MOs from Dr. Vladimir Korzh (pers. comm.). As negative controls, we used either standard morpholino (CCTCTTACCTCAGTTACAATTTATA) or random control oligo 25-N provided by GeneTools LLC as noted. Morpholinos were suspended in 1xDanieau's solution (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO₄, 0.6 mM Ca(NO₃), 2.5 mM HEPES, pH 7.6), and injected into yolk at 1–4 cell stages. Embryos were cultured until appropriate stages at 28.5°C, and fixed for in situ analysis. The fzd3a-MO used here was designed to disrupt the splicing out the first intron (16 kb) of the fzd3a transcript, which allowed us to assess the efficacy of this morpholino simply by reverse transcription (RT)-PCR assay as previously reported [35]. Briefly, embryos injected with fzd3a-MO were collected at 24 hpf, and total RNAs were extracted with TRI reagent (Sigma) for reverse transcription using Superscript III (Invitrogen) and following primers designed against the two fzd3a exons flanking the first intron as reported [35]; forward: 5′-ATGCTGACTGTATGCATGGCC-3′, reverse: 5′-GCCATAATCCCGTTGAACTGC-3′. The size of the normal fzd3a transcript amplified with these primers should be 465 bp. Under our PCR conditions, this PCR fragment cannot be detected in the experimental group due to the length of the first intron (16 kb), but is readily seen when splicing occurs normally. As a positive control for RT-PCR reaction, we used primers to amplify β-actin cDNA (Forward: 5′-TACCCCATTGAGCACGGTAT, reverse: 5′-GTTCCCATCTCCTGCTCAAA).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 2. Sequence of morpholinos.

https://doi.org/10.1371/journal.pone.0054833.t002

Ethics statement

This study was performed with the approval of the University of Bath ethics committee and in full accordance with the Animals (Scientific Procedures) Act 1986 under Home Office license PPL30/2415.

Identification of the full complement of zebrafish fzd genes

To allow a comprehensive analysis of expression patterns of fzd genes, we utilized two databases, ZFIN (http://zfin.org/) and Ensembl (http://www.ensembl.org/Danio_rerio/Info/Index). At the start of this project, twelve fzd genes were already registered with their cDNA sequence in ZFIN; these fzd genes were as follows; fzd1, fzd2, fzd3a, fzd3b, fzd4, fzd5, fzd7a, fzd7b, fzd8a, fzd8b, fzd9b, and fzd10 (See Table 1 for accession numbers of sequences used here). Furthermore, using the full coding sequence of reported fzds or cDNA sequences corresponding to their cysteine rich domain (CRD) when full coding sequence was not available, we screened for fzd-related genes in the zebrafish genomic DNA database in Ensembl (Zv8); a repeat of this procedure in the Zv9 release of the zebrafish genome identified the same genes. Most of those we identified were already reported in ZFIN, but fzd9a was newly found (see Table 1 for accession number.). Also, the fzd6 gene was published during the course of this survey [36]. Thus, we identified orthologues for all of fzd1-fzd10, representing the full complement of fzds known from other vertebrates. We cloned sub-regions suitable for making probes for all these genes to examine their expression patterns in embryos, with the one exception of fzd8b which has been clearly shown to have expression in a very tightly localized pattern in the forebrain at 1-somite stage and later in the neurohypophysis [37]). Primers for cloning cDNAs were designed to amplify as long a region as possible of the 3′UTR to ensure gene specificity of probes (See Table 1 for sequences of primers used). When information for the 3′UTR was limited or unavailable, we designed primers to clone a 1–1.5 kb fragment encompassing the 3′ region of the cDNAs (See Figure S1 for location of each probe.). We prepared antisense riboprobes from these cloned partial cDNAs, and performed whole mount in situ hybridization analysis on wild-type embryos at three different stages encompassing the key stages for NCC induction and melanocyte specification. Firstly, we examined 1-somite stage embryos since this is when early NCC markers are first seen mainly in the lateral border of the neural plate [38], [39]. We expected that fzd genes relevant to the induction of NCC would be expressed in part or all of the ectoderm in the neural plate, prospective epidermis or both. Secondly, melanocyte specification is first detected as induction of mitfa expression, and begins around 18 hpf [40]. At this stage, sox10, which plays a key role in specification of melanocytes by direct activation of mitfa [41] is expressed uniformly in NCCs after delamination (premigratory NCCs) and, more posteriorly (i.e. in developmentally younger cells), in dorsal neural tube cells (NCCs prior to delamination) [38]. Consequently, we expected fzd genes driving melanocyte specification would be expressed in dorsal neural tube or premigratory NCCs at 18 hpf. We also examined embryos at 30 hpf when melanoblasts are readily identified among migrating NCCs on both the medial and lateral migration pathways.

All fzd genes showed specific expression patterns at one or more of the stages examined (Fig. 1 and Fig. 2). fzd3a, fzd7b, fzd9b and fzd10 were all expressed in regions consistent with possible roles in NCC induction or melanocyte specification; three candidates for melanocyte specification (fzd3a, fzd9b, fzd10) will be described in detail in the next section. fzd7b is expressed in a pattern consistent with potential involvement in NCC induction, and will be described later in this section. Based on the expression patterns we observed, the other genes were considered highly unlikely to have roles in the processes of development that form the focus of this paper, nevertheless the expression patterns of fzd1, fzd2, fzd3b, fzd4, fzd5 and fzd8a will be described briefly (Fig. 1A, 1B, 1C, 1D, 1E, 1I, respectively). We found ubiquitous expression of some fzd genes at 1-somite (fzd6, Fig. 1Fa; fzd7a, Fig. 1Ga) and 18 hpf (fzd6, Fig. 1Fb; fzd7a, Fig. 1Gb, fzd9a, Fig. 1Jb) stages, but no sign of specific expression of any of these genes in early melanoblasts in the 30 hpf stage (Fig. 1Fc, 1Gc, 1Jc); again, these were considered unlikely to be important in NCC formation or melanocyte specification (see Discussion).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. Expression patterns of fzd genes examined in this study.

Name of each gene is indicated at top left corner. Panels Aa, Ba, Ca, Da, Ea, Fa, Ga, Ha, Ia, Ja are left side views at 1-somite stage, anterior to the top. Panels Aa', Ba', Ba'', Da', Da'', Ha' are dorsal views with anterior to the top. Panels Ab, Bb, Cb, Db, Eb, Fb, Gb, Hb, Ib, Jb are left side views at 18 hpf stage, dorsal to the top. Panels Ac, Bc, Cc, Dc, Ec, Fc, Gc, Hc, Ic, Jc are left side views at 30 hpf, dorsal to the top. Da''' and Db' are flat mounted view of fzd4 at 1-som. and18 hpf, respectively. Anterior to the top for D''', and to the left for Db'. Da''' shows only right half of the embryo. The left edge of the embryo corresponds to the midline. For descriptions, see main text. All images are taken at the same magnification. Abbreviations: cp, cranial placode; nm, neuromast; prim., posterior lateral line primordia. Scale bar in Da''' is 200 µm, and one in Jc and for all is 100 µm.

https://doi.org/10.1371/journal.pone.0054833.g001

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. Expression pattern of fzd3a, fzd9b and fzd10 at 1-som, 18 hpf and 30 hpf stages.

Name of genes are indicated on top. Panels A, D, G are left side views at 1-som. stage. Dorsal to the right. Panels B, E, I are left side views at 18 hpf stage. Dorsal to the top. Panels C, F, J are left side views at 30 hpf with anterior toward left. Panels a, b, d, e, i are optical sections at the indicated level of panels A, B, D, E, I, respectively. Panel H is dorsal view with anterior set toward top. For descriptions, see text. Arrowheads in panel d indicate expression at the edge of neural plate, but these signals seem to be underneath the ectoderm. Scale bar: 100 µm.

https://doi.org/10.1371/journal.pone.0054833.g002

fzd1 did not show expression at 1-som. stage (Fig. 1Aa, 1Aa') whilst expression in the central nervous system (CNS) started to appear from 18 hpf (Fig. 1Ab, 1Ac). As has been described before [42], fzd2 was expressed in the forming somite at 1-somite stage (white arrowhead in Fig. 1Ba). In addition, we found fzd2 expression in the fin and dorsal neural tube at 30 hpf (Fig. 1Bc), although there was no expression in the trunk consistent with migrating NCCs. fzd3b showed significant expression in a dorsal part of telencephalon and diencephalon at 18 and 30 hpf (arrowheads in Fig. 1Cb, Cc). fzd4 was expressed strongly as bilateral stripes located around the border of neural plate (arrowheads in Fig. 1Da”). Based on the expression pattern at 18 hpf (Fig. 1Db'), we interpreted these as marking future cranial placodes instead of NCCs. To test this idea, we performed two color in situ hybridization using probes for fzd4 and foxd3, an early marker for NCC, at 1-somite stage as shown in Fig. 1Da'''. fzd4 expression (purple) was clearly expressed in a region lateral to the foxd3 expression domain (red), confirming that fzd4 is not expressed in NCC, and is indeed likely to be expressed in the cranial placodes. fzd5 expression is highly restricted to eye (Fig. 1Eb, 1Ec), forebrain (Fig. 1Ea-c) and gut (arrowheads in Fig. 1Eb, 1Ec) during development. fzd8a expression was seen in forebrain (Fig. 1Ia-c) and gut (arrrowheads in Fig. 1Ib, 1Ic), with strong expression becoming more widespread in the ventral CNS by 30 hpf (Fig. 1Ic).

fzd7b showed faint expression around the border of the neural plate in addition to strong expression in the future mid- and hindbrain at 1-somite stage (Fig. 1Ha, Ha'). It is possible that this bilateral expression pattern simply marks the future cranial placode area like fzd4. However, we chose the fzd7b gene as a candidate for further analysis of NCC induction because it is reported that the fzd7 gene is required for NCC induction in Xenopus [27], and our two color in situ hybridization showed that fzd7b expression in the mid-and hindbrain region overlaps the foxd3 expression domain, marking NCC (Figure S2). Taken together, we concluded that fzd7b was a good candidate for a role in NCC induction. Therefore, we explored this hypothesis in more detail (see later).

Expression patterns of fzd3a, fzd9b, fzd10 at NCC induction and pigment cell formation stages

Unexpectedly, we were unable to detect expression of any of the fzd genes in trunk NCCs, including differentiating melanocytes and melanoblasts, at 30 hpf (Fig. 1 and Fig. 2). Nevertheless, three genes, fzd3a, fzd9b and fzd10, showed expression patterns that included some or all of the dorsal neural tube at 18 hpf (Figs. 2B, 2E, 2I, 2b, 2e, 2i), a place where melanocyte specification is likely to occur. These genes showed distinct patterns (Fig. 2).

fzd3a expression in the neural plate is first detected in an anterior domain at 1-somite stage (Fig. 2A). Optical sections at the level of the posterior hindbrain (level labeled with “a” in Fig. 2A) shows that expression extends throughout almost the entire neural plate (Fig. 2a). By 18 hpf, fzd3a expression has expanded to encompass the entire length of the neural tube, although expression remained strongest in the cranial regions (Fig. 2B). Optical sections again revealed that the fzd3a expression domain extends throughout the dorsal part of the neural tube (Fig. 2b). However, we found no evidence of fzd3a expression in migrating NCCs in trunk or tail at 30 hpf, although expression persists strongly throughout the CNS (Fig. 2C).

fzd9b expression is much weaker than that of the other two genes at 1-somite stage (Fig. 2D), although it includes most of the neural plate in anterior half of the embryos. A pair of expression domains outside of the neural plate (arrowheads in Fig. 2d) were considered not to include NC because they lie internal to the ectoderm. By 18 hpf, fzd9b expression is readily detected in a complex pattern within the fore- and midbrain; levels in the hindbrain and spinal cord are also much higher, and posteriorly the expression domain has extended to the tail (Fig. 2E). Interestingly, the dorsal part of the anterior CNS (marked by bracket) lacks fzd9b transcripts whilst the dorsal neural tube in the spinal cord clearly expresses fzd9b (Fig. 2e). As with fzd3a, we saw no evidence of fzd9b expression in migrating NCCs at 30 hpf, although expression is seen in sites including most of the CNS, the tail tip, and at low levels in muscle (Fig. 2F).

fzd10 is expressed strongly in the neural plate at 1-somite stage, but expression is absent from the anteriormost region, likely corresponding to some or all of the forebrain, and is strongest in the anterior part (Fig. 2G) and lateral border (Fig. 2H) of the neural plate expression zone, consistent with possible involvement in NCC induction. In addition there is very strong expression in the tail bud, which also persists at 18 hpf (Fig. 2I). At later stages (18 hpf, 30 hpf), fzd10 is strongly expressed and tightly restricted to the dorsal neural tube along the entire axis of the embryo (Fig. 2I, 2i, 2J). Once again, expression in migrating NCCs was not detected (Fig. 2J).

Knockdown of fzd3a, fzd9b and fzd10

Given their expression patterns in the dorsal neural tube, fzd3a, fzd9b and fzd10 were strong candidates for encoding the Wnt receptor(s) associated with melanocyte specification from the NCC. To test this hypothesis, we performed morpholino-mediated knockdown analysis of each gene; in addition, to allow for likely redundancy of function, we took advantage of the ease with which multiple gene knockdown can be performed using this technique in zebrafish, knocking down all three genes simultaneously. A splice site morpholino targeting fzd3a has already been reported [35], so we used this same morpholino for our studies. Our analysis of the cDNA and genomic data (Ensembl) for fzd9b and fzd10 indicated that there were no intron-exon boundaries within the known coding regions of these two genes; consequently, we designed morpholinos against the predicted translation start (ATG) codon. Sequence information for these morpholinos is listed in Table 2. To examine the efficacy of fzd3a-MO we used reverse transcription-polymerase chain reaction (RT-PCR) to confirm the changed size of transcript due to mis-splicing as reported [35] (See Materials and Methods for detail). As shown in Fig. S3A, 10 ng of the fzd3a-MO was sufficient to substantially suppress normal splicing of fzd3a in our hands. To show that our fzd9b- and fzd10-MO can suppress translation of their target sequences in vivo, we designed fusion constructs containing target sites of these morpholinos and an enhanced green fluorescent protein (egfp) reporter gene (Schematic drawing in Fig. S3B). Co-injection of morpholinos and synthesized RNA encoding fusion constructs containing the target sequence demonstrated that even 1 ng of fzd9b- or fzd10-morpholino was sufficient to suppress EGFP fluorescence derived from 100 pg of fusion construct mRNA (EGFP-positive embryos, 0/31 for fzd9b-MO injected; 0/23 for fzd10-MO injected) (See Fig. S3D, F, S3D', F'). In contrast, EGFP protein was detected in a significant proportion of embryos injected with even 5 ng of random control morpholino in both cases (EGFP-positive embryos, 73/93 for fzd9b-MO experiment; 23/28 for fzd10-MO experiment) (See Fig. S3C, E, 3C', E'). Although these data indicate the efficacy of our morpholinos against their chosen targets, morpholino knockdown of each of fzd3a, fzd9b or fzd10 alone showed no noticeable reduction of melanocytes (Figure S4 and Table S1).

We tested for functional redundancy of these three genes in this process by co-injecting all three morpholinos simultaneously to achieve multiple gene knockdown. In initial experiments, we experimented with differing amounts of MOs for each gene. Injected embryos were examined at 1 day post-fertilization (dpf) (Fig. 3A–F and Table 3) and 3 dpf (Fig. 3G–3L), noting the presence of and pattern of melanocytes, as well as morphological abnormalities. Since we knew that 10 ng/embryo of fzd3a-MO efficiently inhibited fzd3a splicing, we fixed the amount of fzd3a-MO to 10 ng/embryo, and varied the amounts of the others. The combined injection of 10 ng of fzd3a-MO and 5 ng of fzd10-MO resulted in substantial necrosis, so we used only doses of 1 or 2 ng/embryo of fzd10-MO in this experiment. Although combinatorial injection of these MOs caused a percentage of embryos to show severe necrosis and in some cases a severely truncated or bended body axis, in all cases at least c. 50% of injected embryos showed an elongated body axis and no or only minimal necrosis restricted to the brain. Surprisingly, we saw no reduction in melanocytes in those embryos with normal morphology, even in the embryos injected with the highest amounts of morpholino (i.e. fzd3a, fzd9b, fzd10-MOs at 10, 5, 2 ng/embryo, respectively; compare Fig. 3B, 3H with Fig. 3A, 3G.). We found less pigmented embryos in some cases, but all of these showed very severe morphological defects (Table 3; data not shown). Therefore, we discounted these pigmentation defects as secondary defects of disruption of early development. The embryos injected with lower doses of morpholinos also showed no reduction of pigmentation (Fig. 3C–F, 3I–L). The significant developmental abnormalities seen in the doses used here precluded the further increase in MO doses.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. Combinatorial injections of fzd3a, fzd9b and fzd10–MO do not affect melanisation.

A–F) 1 dpf embryos. Typical melanisation patterns of embryos showing “elongated axis+no/slight necrosis” phenotype in Table 3 are presented here for each injection. G–L) 3 dpf embryos. All are left side views with dorsal oriented to the top. A, G) Control standard-MO, 17 ng/embryo. B, H) fzd3a, fzd9b, fzd10-MO  = 10, 5, 2, ng/embryos, respectively. C, I) fzd3a, fzd9b, fzd10-MO  = 10, 5, 1, ng/embryos, respectively. D, J) fzd3a, fzd9b, fzd10-MO  =  10, 2, 2, ng/embryos, respectively. E, K) fzd3a, fzd9b, fzd10-MO  = 10, 2, 1, ng/embryos, respectively. F, L) fzd3a, fzd9b, fzd10-MO  =  10, 1, 1, ng/embryos, respectively. Scale bars: 200 µm.

https://doi.org/10.1371/journal.pone.0054833.g003

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 3. Melanisation occurs in embryos injected with fzd3a, 9b, 10-MO at 1 dpf.

https://doi.org/10.1371/journal.pone.0054833.t003

One possible explanation for our failure to see the expected melanocyte specification phenotype was that the MOs failed to inhibit Fzd function sufficiently. Our efficacy controls (Fig. S3) argue strongly against this caveat, but we also performed a direct test of the MOs' efficacy in reducing canonical Wnt signaling in vivo at the expected time of Wnt signaling. We injected embryos generated by intercrossing hemizygous TopdGFP transgenic fish with fzd3a, fzd9b, fzd10-MOs, and examined gfp expression by in situ hybridization analysis. This strain contains a transgene combining multiple Lef1-binding sites followed by a destabilized gfp cDNA, and has been shown to be a good in vivo reporter of Wnt activity [43]. In these crosses, we expected embryos to be homozygotes, hemizygotes and non-transgenic; consistent with this, we were able to categorize the signal intensity of GFP expression into three categories, strong, weak and no expression. Figure S5 shows typical examples of embryos showing “strong” (Fig. S5A) and “weak” (Fig. S5B, C) expression, and Table S2 describes the distribution of embryos categorized into these three categories. As shown in this table, the number of embryos classified as “strong” expression is reduced by the co-injection of fzd3a, fzd9b and fzd10 MOs (2 out of 37) compared with the controls (11 out of 37). Statistical testing confirmed that the proportion of the three GFP expression patterns deviated from the expected Mendelian ratio (1∶2∶1), and the one observed in fzd-3, fzd9b, fzd10- morphant was significantly different from the prediction (Chi-squared, p = 0.022), whilst the one for control (standard morpholino-injected) was not (p = 0.868). We conclude that co-injection of the three fzd MOs substantially reduces Wnt signaling in vivo.

Whilst our data clearly indicates that we achieved very substantial knockdown of Wnt signaling, we considered the possibility that nevertheless the remaining residual activity (See Fig. S5C) was sufficient to drive normal melanocyte specification. Current experimental data indicates that melanocyte specification depends upon a combination of Wnt signaling [44] and Sox10 activity [34], [38]. We thus reasoned that co-injection of the fzd MOs into sox10 mutant heterozygotes might provide a sensitized background in which the roles for these fzd genes in melanocyte specification would be revealed. We crossed identified sox10 mutant heterozygotes with wild types, and injected the resultant embryos (expected to be 50% sox10 heterozygotes; 50% wild-types) with fzd3a, fzd9b, fzd10-MOs at various concentrations, alone or in combination. We quantitated the numbers of embryos showing reduced melanisation, expecting at most 50% of the injected embryos show reduced melanisation. Surprisingly, we again saw that almost all of the injected embryos showed normal melanisation at 1 dpf (Fig. 4B–F) and 3 dpf (Fig. 4H–L)(See also Table 4).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Morpholino-mediated knockdown of fzd3a, fzd9b and fzd10 in the sensitized background.

A–F) 1 dpf embryos. Melanisation patterns of typical embryos showing “elongated axis + no/slight necrosis” are presented here (see Table 4 for quantitation). G–L) 3 dpf embryos. All are left side views with dorsal oriented to the top. A, G) standard Control-MO, 20 ng/embryo. B, H) fzd3a-MO injected. 10 ng/embryo. C, I) fzd9b-MO injected. 15 ng/embryo. D, J) fzd10-MO injected. 5 ng/embryo. E, K) fzd3a, fzd9b, fzd10-MO  = 10, 5, 2, ng/embryo, respectively. F, L) fzd3a, fzd9b, fzd10-MO  = 10, 2, 2, ng/embryo, respectively. Scale bars: (A–F) 100 µm, (G–L) 500 µm.

https://doi.org/10.1371/journal.pone.0054833.g004

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 4. Melanisation occurs in sox10 mutant heterozygous embryos injected with fzd3a, 9b, 10-MO at 1 dpf.

https://doi.org/10.1371/journal.pone.0054833.t004

Taken together, we conclude that our data argue against a major role for fzd3a, fzd9b or fzd10 in melanocyte specification (or subsequent differentiation). It seems likely that ubiquitously expressed fzd genes (e.g. fdz6, fzd7a, fzd9a) and/or low level expression of other fzd genes, or other types of receptors, transduce sufficient Wnt signaling for melanocyte development (see Discussion).

Examining the role of fzd genes in NCC induction

In our analysis of the expression patterns of fzd genes, only fzd7b and fzd10 gene showed expression in the lateral border of neural keel at 1-somite stage (Fig. 1Ga' and Fig. 2H). We thus hypothesized that these genes might mediate Wnt signaling during NC induction, and tested this idea by using morpholino-mediated knockdown. In addition, given the possibility of functional redundancy between fzd7a and fzd7b, we knocked down both fzd7a and fzd7b genes simultaneously. Morpholinos against the two fzd7 genes have already been reported [28], and some other morpholinos against these were also examined by the same group. So we chose morpholino sequences based on their observations [28] (V. Korzh, pers. comm.) (for sequences, see Table 1). As marker genes for early NCCs, we used foxd3, pax3 and sox10. These three genes encode transcription factors of the winged helix, paired box containing and HMG group transcription factor families respectively, and all have been shown to be expressed in premigratory NCC and to be critical factors for development of neural crest derivatives [34], [38], [45], [46], [47]. Importantly, previous reports suggested that their expression was dependent upon Wnt signaling [26], [48]. Fig. 5 shows the expression pattern of these three genes in control MO-treated embryos at 1-somite stage (Fig. 5A–C). Simultaneous inactivation of fzd7a, fzd7b and fzd10 has no noticeable effect on the intensity of marker gene expression. However, these experiments clearly showed that the lateral spacing between the bilateral marker domains was increased in fzd MO-treated embryos, suggesting that CE movements during gastrulation might be disrupted [49], [50].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. fzd gene knockdown has no effect on NCC induction, but causes CE defects.

Embryos were injected with standard control-MO alone (A, B, C), or a mixture of fzd7a, fzd7b, and fzd10-M (D, E, F) or fzd3a, fzd7a, fzd7b, fzd9b and fzd10-MO (G, H, I), respectively. The amounts of each morpholino were as indicated. Embryos were examined by in situ hybridization analysis at 1-somite stage with three early NCC markers, foxd3 (A, D, G), pax3a (B, E, H) and sox10 (C, F, I). All are dorsal views with anterior oriented to the top. Scale bar: 100 µm.

https://doi.org/10.1371/journal.pone.0054833.g005

We then considered the possibility that the lack of a NCC induction phenotype might be due to other fzd genes. In particular we noted that fzd3a and fzd9b are also expressed in the neural plate, though these two are not restricted to the border between neural plate and epidermis (Fig. 2A, 2a, 2D, 2d). Consequently, we examined the effect of co-injection of fzd3a, fzd7a, fzd7b, fzd9b and fzd10-MO on NCC marker expression at 1-somite stage (Fig. 5G–I), but again saw no defect in NCC marker expression pattern or intensity, although the wider spacing of the lateral marker domains was seen. Interestingly, subsequent careful examination of the expression pattern of fzd10 in comparison with the early NCC marker foxd3 by double in situ hybridization, showed that the fzd10 expression domain does not in fact overlap foxd3 at this stage (See Figure S2). From these observations, we conclude that knockdown of fzd7a, fzd7b and fzd10 is insufficient to affect NCC induction (See Discussion), but might be important for CE movements.

Co-operative involvement of fzd7a and fzd7b on CE movement and requirement for fzd7a, fzd7b and fzd10 in mesoderm formation

To investigate the requirement of these three fzd genes in CE, we first examined their expression at early gastrula stages when CE movements occur [51], [52]. All three fzd genes were expressed in gastrula stages, but each had a unique pattern (Fig. 6). At 6 hpf, fzd7a and fzd10 are expressed in the blastoderm margin (arrowheads in Fig. 6A for fzd7a and in Fig. 6G for fzd10), whilst fzd7b expression was throughout the blastoderm but excluded from the marginal area (Fig. 6C). Like fzd7b (Fig. 6C), fzd10 expression is reduced or lacking from the embryonic shield (Fig. 6E, G). At the 80% epiboly stage, the expression domains of fzd7a and fzd7b expand to become widespread throughout the entire embryo, except for the marginal region of the dorsal blastoderm (arrows in Fig. 6B, D). In contrast, fzd10 expression remains restricted to the ventro-lateral marginal zone of blastoderm (arrowheads in Fig. 6H). These in situ analyses clearly demonstrate expression patterns of these three fzd genes that are fully consistent with their possible involvement in CE movement.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 6. Expression of fzd7a, fzd7b and fzd10 at gastrula stage.

A, B) fzd7a expression. C, D) fzd7b expression. E–H) fzd10 expression. Left column shows expression at 6 hpf and right column shows expression at 80% epiboly stage as indicated. All are left side views with anterior to the top. Embryos in panel E and G, and embryos in panel F and H are the same ones. We focused on medial plane along the animal-vegetal axis for embryos in panel A–F. Embryos in panel G and H alone were focused on lateral surface to show signal in marginal area. Arrowheads in panels A, G, H indicate the marginal expression, and arrows in B and D show the lack of expression (see text). Scale bar: 100 µm.

https://doi.org/10.1371/journal.pone.0054833.g006

The expression patterns described in Fig. 6 suggest that, in addition to the CE defects we have observed in the ectoderm (Fig. 5), we might expect CE defects in the mesoderm too. To test this, we examined the standard markers used to assess mesodermal CE movements, no tail (ntl) [53] and paraxial protocadherin (papc) [54]. ntl is expressed in the blastoderm margin and the presumptive notochord from early gastrula to 1-somite stage, whilst papc is strongly expressed in paraxial mesoderm and excluded from the dorsal midline. Previous studies have shown that the ntl notochord expression domain becomes shortened along the antero-posterior axis and widened mediolaterally when CE is inhibited [55], [56]. Conversely, the spacing between the two papc expression domains becomes wider and the expression domains shorter where CE is disrupted [49]. At first, we knocked down fzd7a, fzd7b and fzd10 separately by injecting with 5 ng of morpholino for each. Figs. 7A–7D and 7E–7H show the expression pattern of ntl (7A–7D) and papc (7E–7H) in each case at 1-somite stage. As shown here, fzd7a and fzd7b-MO have no significant effect on the length and width of these expression patterns (compare panel 7A or 7E with 7B, 7C or 7F, 7G), though papc expression seems slightly shortened in fzd10-morphants (Fig. 7H).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 7. Combinatorial injection of fzd7a and fzd7b-MO causes dramatic defects in mesodermal CE.

Embryos were processed to show expression of notochord marker ntl (A–D, I–L), and somatic and pre-somitic mesoderm marker, papc (E–H). All embryos are 1-somite stage, and oriented with their animal pole toward top. Embryo in panel L was fixed at the time when control embryos reached 1-somite stage. All are dorsal views. Amount of each morpholinos injected are indicated in bottom left corner of each panel. Scale bar: 100 µm. M) Quantitation of length of dorsal midline ntl expression domain. The amount of morpholino in each case were as follows. Control-MO, 9 ng; fzd7a, fzd7b-MOs, 2 ng each; fzd7a, fzd7b, fzd10-MOs, 2, 2, 1 ng, respectively; fzd7a, fzd7b, fzd10-MOs, 2, 2, 2 ng, respectively; fzd7a, fzd7b, fzd10-MOs, 2, 2, 5 ng, respectively. P values estimated by Tukey's multiple comparison test are indicated for each pair. Error bars are s.e.m. for each group.

https://doi.org/10.1371/journal.pone.0054833.g007

Since we expected functional redundancy between fzd7a and fzd7b, we next tested experimentally the effects of double knockdown of fzd7 function, and also co-injection with a series of doses of fzd10-MO with the fzd7a, fzd7b MOs in order to assess the co-operative action of these three genes. We injected embryos with standard-MO as control (Fig. 7I), or fzd7a-MO and fzd7b-MO together (Fig. 7J), or fzd7a-MO, fzd7b-MO and fzd10-MO together (Fig. 7K, 7L) and examined the expression of ntl in embryos fixed at 1-somite stage. The combined injection of only 2 ng each of fzd7 morpholinos resulted in dramatic shortening of the ntl domain (compare Fig. 7I and 7J), consistent with a CE defect. To quantify this phenotype, we measured the length of the notochord domain of ntl in these embryos (Fig. 7M). Statistical analysis by one-way ANOVA and further Tukey's multiple comparison analysis confirms the statistically significant reduction of notochord length in the fzd7a, fzd7b double morphants compared with control (p<0.001). These data strongly suggests that fzd7a and fzd7b act in a functionally redundant manner to mediate Wnt signals important for CE movement. Next, we assessed whether fzd10 might act in addition to the two fzd7 genes to contribute towards this role in CE movement. When compared with the control embryo (Fig. 7I), combined injection of fzd7a, fzd7b and fzd10-MOs resulted in a severely truncated and broadened ntl expression domain, although this was only seen with 5 ng of fzd10-MO (Fig. 7L, 7M) and not with 1 or 2 ng doses (compare Fig. 7J and 7K; quantitation in Fig. 7M). Further, we also observed an effect on epiboly, with 5 ng of fzd10-MO causing a delay in progression of epiboly, and reduction in ntl expression in the marginal zone (compare Fig. 7I and 7L). From these observations, we conclude that fzd7a and fzd7b are the primary Wnt receptors driving proper CE movement during gastrulation, and that fzd10 does not have a major role. However, reduction of ntl expression in embryos injected with higher amounts of fzd10-MO as well as both fzd7a and fzd7b-MOs suggests that all act together to regulate epiboly movements and early mesoderm differentiation.

Are fzd genes required for NCC induction and melanocyte specification?

Our experiments using morpholino combinations to knockdown up to five (fzd3a, fzd7a, fzd7b, fzd9b, and fzd10) or up to three (fzd3a, fzd9b and fzd10) Fzd proteins failed to result in detectable reduction of either NCC or melanocyte formation, respectively. Nevertheless, we have evidence that our morpholinos were generating substantial knockdown of the targets. Firstly, the absence of normal length transcripts for fzd3a after injection of fzd3a-MO suggests this morpholino was successfully suppressing normal splicing. Secondly we observed a CE defect and reduction of mesodermal markers when fzd7a, fzd7b, fzd10-MO were injected into embryos. Thirdly, we showed that our fzd9b-MO could bind to the target sequence and suppressed the translation of an egfp reporter gene at doses of only 1 ng per embryo, which is much less than the amount injected for analysis. Fourthly, reduction of GFP reporter expression in TopdGFP transgenic analysis injected with fzd3a, fzd9b, fzd10-MO indicated that we were achieving substantial suppression of the canonical Wnt pathway. Finally, in fzd3a, fzd9b, fzd10-morphants, we found frequent tail fin defects (see Fig. 3, 4), resembling those seen after disruption of Wnt signaling by double knockdown of lef1 and tcf7 [57]. Taken together, these observations strongly suggest that our morpholinos were effective, and thus that the lack melanocyte and NCC induction phenotypes provides strong evidence indicating that these fzd genes are unlikely to play a major role in these processes.

Given the robust evidence for Wnt signaling involvement in NC induction and melanocyte specification, this forces the question of whether other fzd genes are involved in these developmental aspects. Mammals have 10 fzd genes and since an extra whole-genome duplication event occurred in the teleost lineage compared with that of mammals, it is conceivable that zebrafish may have 20 (or more) fzd genes in total. Our comprehensive BLAST search used the previous (Zv8) version of the zebrafish genome database; repeating our search using the latest version (Zv9) did not find any new fzd genes. However, we cannot rule out there being fzd genes still to be identified. In particular, other paralogues may be identified as the genome sequence becomes refined. It is known that duplicated genes may have (partially) divergent expression patterns in zebrafish, so that only one of the duplicated genes retains specific ancestral functions [58]. Any novel fzd genes should be directly assessed for candidacy as receptors mediating NCC induction and melanocyte specification, by expression and functional analysis.

Our assessment criteria relied on specific expression at specific locations at specific times; it is conceivable that we did not detect the crucial fzd genes, for example, due to lower levels of expression in these locations. We did not perform comprehensive assessment of Fzd1, Fzd2, Fzd4, Fzd5, Fzd6 and Fzd8 for roles in melanocyte development or NCC induction. Where the expression patterns of other vertebrate fzd genes correspond to the time and place of NC induction or melanocyte specification, this might indicate which other fzd genes should be assessed more carefully. In mice, for example, Sox10 is reported to be expressed in dorsal neural tube from E8.5 to E10.5 [59] so that fzd genes expressed during these stages will be potential receptors required for melanocyte specification. The data from mouse does not currently provide evidence that any of Fzd1, Fzd2, Fzd4, Fzd5, Fzd6 or Fzd8 show appropriate expression patterns [60], although studies to date have not focused on NC development. In the case of NC induction, fzds expressed in the neuro-ectodermal border around E8 stage might be strong candidates, since this is when expression of Msx and Zic, two early markers of the NC, are seen [61], [62], [63], [64], [65]. However, again the mice data do not currently implicate any of the fzd genes which were not knocked down here in NC induction, since the described patterns encompass mesodermal lineages (Fzd1, Fzd6, Fzd8) [60], future ventral neural tube (Fzd1) [60] or telencephalon (Fzd5) [9], [60]. Fzd2 alone has been reported to be expressed in the entire neural plate (including NCC contributing to the cardiac outflow tract [66]). We found no sign of fzd2 expression in the zebrafish neural tube at 1-somite nor 18 hpf stage; thus, a duplicated fzd2 gene might be a strong candidate gene for zebrafish melanocyte specification. Our assumption that the key receptors would be specifically expressed in the lateral neural plate or in the early NCCs may also be mistaken; we dismissed fzd genes showing ubiquitous expression from further study. Thus, fzd6, fzd7a and fzd9a might be worthy of further assessment in this context, although it seems likely that if they are crucial they are likely to be at least partially redundant amongst themselves.

Our data at least hint at the possibility that Wnt signals mediating NCC induction and melanocyte specification might depend primarily on receptors belonging to families other than the Frizzled family. As mentioned before, LRP5, 6 also function as Wnt receptors, although they appear to function as co-receptors for Fzd receptors, rather than functioning as an independent receptor [2], [67]. Other studies have recently revealed two other Wnt receptors, Derailed/Ryk and Ror, which can transduce Wnt signal in a Fzd-independent manner [2], [68]. The Derailed/Ryk family transmembrane proteins are atypical receptor type tyrosine kinases, and have been studied so far in D. melanogaster (Derailed), C. elegans (Lin-18) and vertebrates (Ryk). Phenotypic analysis in Drosophila and C. elegans [69], [70] and biochemical analyses [70], [71] provided evidence of genetic and physical interaction between Wnt and Ryk protein in a Fzd-independent manner. Functional analyses have revealed that Derailed/Ryk were involved in axon guidance in Drosophila [70] and mouse [71], in vulval formation in C. elegans [69], and in CE movement in Xenopus and zebrafish embryo [72], [73]. However, the evidence published to date suggests no compelling argument for the requirement of Ryk protein in the development of NCCs and their derivatives. Embryonic expression patterns of ryk genes in Xenopus and zebrafish show their strong enrichment in somite and central nervous system; expression is not enriched in dorsal neural tube at the times examined in this study, although ryk seems to be weakly and ubiquitously expressed in zebrafish at 19 hpf [73], [74]. Another Wnt receptor, Ror, is also a transmembrane tyrosine kinase, which contains Fzd-like cysteine-rich domain in the extracellular domain. Two structurally related proteins, Ror1 and Ror2, have been identified so far, and recent analyses have demonstrated evidence of involvement of Ror family kinases in Wnt signaling pathways, such as the physical interaction of Ror2 protein with Wnt5a [75], consistent with the similar phenotypes of Ror2 and Wnt5a deficient mice [76], and genetic interaction between cam-1 (C.elegans homolog of Ror ) and Wnt family gene egl-20 [77]. Functional analysis further revealed that Ror mediated the changes in cell polarity and cell migration in CE movement that result from Wnt5a- and Wnt11- triggered non-canonical Wnt signaling [76], [78]. However, again, these studies provide no evidence for the involvement of Ror in NCC development. Rather, studies using cultured cells demonstrate Wnt5a-Ror2 signaling actually inhibits the canonical Wnt pathway, whilst Wnt5a can also activate the canonical pathway when the appropriate receptor (Fzd4) is available [75]. Taken together, we conclude that it is unlikely that zebrafish homologs of Ror genes mediate Wnt signaling in NC induction or melanocyte specification, although their expression patterns have not been reported yet. In zebrafish, MuSK (muscle-specific receptor kinase), a related protein to Ror [79], is mutated in unplugged mutants [80]; whilst it plays a role in controlling segmental migration of trunk NCCs, there is no report of defective NC induction or melanocyte specification in these mutants [81], [82].

In summary, knockdown of the subset of fzd genes on which we focused here is apparently insufficient to effect the reduction of melanocytes and NCCs, although the morpholinos themselves seem to be effective. We propose that further exploration, focused on ubiquitously expressed fzds or fzd gene expression at low levels, is now required to identify the crucial fzd receptor(s) mediating melanocyte development and NCC induction. Completion of the zebrafish genome sequencing project will clarify whether further fzd genes remain still to be considered in this context.

Other roles of fzd genes

In addition to illuminating the role of fzd genes in CE movements, NC induction and melanocyte specification, our comprehensive analysis of fzd gene expression during somitogenesis and prim stages suggests further roles for specific genes. Here, we highlight specific aspects of the expression patterns of some fzds. fzd4 shows very localised expression in the region of the otic and lateral line placodes (Fig. 1Da, Da', Da''). Cranial sensory placodes are, like NCCs, formed at the boundary of the neural plate and prospective epidermis. Development of the placodes is thought to start with induction of the preplacodal region, a ground state for all cranial sensory placodes. Subsequently, the preplacodal domain becomes subdivided into individual placodes, such as olfactory, lens, otic and lateral line placodes, by specific inducing signals [83]. Several lines of evidence suggested the involvement of Wnt signaling in this subdivision process to specify otic placode [84].

In contrast to otic development, the role of Wnts in the initial development of the posterior lateral line placode has been little studied in zebrafish, whilst neuromast formation in later stages has been intensively studied [85]. The fzd4 expression pattern demonstrated here suggests the involvement of Wnt signaling in the initial formation of the lateral line placode. Intriguingly, fzd4 seems to be expressed in progenitors for both the future otic and lateral line placodes. It is not clear whether otic and lateral line placodes are each induced from a shared set of progenitor cells in the preplacodal region, but this is one possible interpretation of the fzd4 expression patterns we have observed at 1-somite stage, well before the emergence of morphologically-distinct otic and lateral line placodes. Knockdown studies of fzd4 will be of interest for a test of this hypothesis.

Other interesting expression domains revealed here are those of fzd5 and fzd8a in the ventral ( = subpalial) telencephalon. The nascent telencephalon is known first to be divided into dorsal and ventral parts, which then form the palium and subpalium, respectively [86]. This dorso-ventral patterning is followed by further development of different types of neurons along that axis [87]. Wnt/BMP (bone morphogenetic protein) and Hedgehog/FGF (fibroblast growth factor) signals are thought to play major roles in patterning of the dorsal and ventral regions respectively [86]. Our data showing expression of fzd3b and fzd4 is consistent with this notion. On the other hand, fzd5 (Fig. 1Ec) and fzd8a (Fig. 1Ic) are both expressed in the ventral part of the telencephalon. These observations clearly imply a role for Wnt signaling in the development of ventral telencephalon, too. Indeed, conditional knockout ofß-Catenin causes severe impairment of growth of the medial ganglionic eminence in the subpalium [88], so that this is at least one candidate role for fzd5 and fzd8a in this region.

Identification of new fzds required for CE movement

Here, we have demonstrated the co-operative requirement of fzd7a and fzd7b in CE movement. Since the important role of fzd7 in CE movement has already been reported in Xenopus and mice [89], [90] and it is reasonable that duplicated genes share the function in a certain developmental event, this result reveals strong conservation of fzd7 function in CE movements. In addition, we here identify fzd10 as another Wnt receptor contributing to epiboly movement and mesodermal differentiation, working together with fzd7a and fzd7b. Although a recent publication reported the redundant function of fzd2 and fzd7 in CE movement in mice [90], co-operation of fzd10 with fzd7s during gastrulation has not been reported so far. Furthermore, previous reports on zebrafish fzd10 suggest this receptor activates the canonical Wnt pathway during early development [91], rather than the non-canonical Wnt pathway usually associated with cell movement. Therefore, co-operation of fzd7a and fzd7b with fzd10 in regulating epiboly movements was unexpected. Nevertheless, analysis in human cancer cells demonstrates the promotion of cell motility through activation of the non-canonical pathway by FZD10 [92]. These observations support the idea that fzd10 can transduce Wnt signaling through both canonical and non-canonical pathway dependent on the developmental context. As noted previously, switching between canonical and non-canonical Wnt signaling is, at least in certain cases, dependent upon the type of (co)receptor available [75]. Characterizing the co-receptors involved in these two examples may help with understanding the molecular nature of dual properties of fzd10 in signal transduction.

In summary, our data define the roles of specific fzd genes in CE movements during gastrulation, and limit the candidates for Wnt receptors mediating NC induction and melanocyte specification. Furthermore, our expression data provides the basis for a targeted dissection of the role of Fzds in the embryonic development of numerous structures, some of which we have highlighted here.