Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

A Novel SALL4/OCT4 Transcriptional Feedback Network for Pluripotency of Embryonic Stem Cells

A Novel SALL4/OCT4 Transcriptional Feedback Network for Pluripotency of Embryonic Stem Cells

  • Jianchang Yang, 
  • Chong Gao, 
  • Li Chai, 
  • Yupo Ma
PLOS
x

Abstract

Background

SALL4 is a member of the SALL gene family that encodes a group of putative developmental transcription factors. Murine Sall4 plays a critical role in maintaining embryonic stem cell (ES cell) pluripotency and self-renewal. We have shown that Sall4 activates Oct4 and is a master regulator in murine ES cells. Other SALL gene members, especially Sall1 and Sall3 are expressed in both murine and human ES cells, and deletions of these two genes in mice lead to perinatal death due to developmental defects. To date, little is known about the molecular mechanisms controlling the regulation of expressions of SALL4 or other SALL gene family members.

Methodology/Principal Findings

This report describes a novel SALL4/OCT4 regulator feedback loop in ES cells in balancing the proper expression dosage of SALL4 and OCT4 for the maintenance of ESC stem cell properties. While we have observed that a positive feedback relationship is present between SALL4 and OCT4, the strong self-repression of SALL4 seems to be the “break” for this loop. In addition, we have shown that SALL4 can repress the promoters of other SALL family members, such as SALL1 and SALL3, which competes with the activation of these two genes by OCT4.

Conclusions/Significance

Our findings, when taken together, indicate that SALL4 is a master regulator that controls its own expression and the expression of OCT4. SALL4 and OCT4 work antagonistically to balance the expressions of other SALL gene family members. This novel SALL4/OCT4 transcription regulation feedback loop should provide more insight into the mechanism of governing the “stemness” of ES cells.

Introduction

The SALL gene family (also called Hsal), comprised of SALL1, SALL2, SALL3, and SALL4, was originally cloned based on a DNA sequence homology to the Drosophila gene sal. In humans, SALL1 is mutated in patients with Townes-Brockes Syndrome (TBS), with features that include renal, limb, anal, and ear malformations [1], [2]. Sall1 null mutant mice die perinatally because of severe kidney dysgenesis or agenesis [3]. No human congenital malformation has been associated with SALL2 so far. SALL3 is mapped to chromosome 18q23, and it has been suggested that this isoform is involved in the phenotype of patients with 18q deletion syndrome, which is characterized by developmental delay, hypotonia, growth retardation, midface hypoplasia, hearing loss, and tapered fingers [4]. SALL3 null mice exhibit plate deficiency, abnormalities in cranial nerves, and perinatal lethality [5]. In human, SALL4 is mutated in patients with Duane Radial Ray Syndrome (DRRS, OMIM#126800) (also known as Duane Anomaly with Radial Ray abnormalities and Deafness syndrome or Okihiro syndrome) and Acro-renal-ocular syndrome [6], [7]. DRRS is an autosomal dominant disorder with the combination of Duane anomaly, radial ray abnormalities, and deafness. The clinical presentation of DR syndrome is highly variable. In addition to strabismus and limb malformation, these patients can have hearing defects, renal malformation, facial asymmetry and cardiac defects [8]. SALL4 mutations also result in a range of overlapping phenotypes, including Holt-Oram and Acro-renal-ocular syndrome, and IVIC syndrome [9], [10].

Parallel to its important role in development, the SALL gene family has been found to be expressed in human and murine ES cells and during early developments. SALL4 is expressed in the 2-cell stage of the embryo, similar to OCT4, while expression of SOX2 and NANOG begins in the blastocystic stage of embryonic development[11][13]. Our group and others have shown that murine Sall4 plays a vital role in maintaining ES cell pluripotency and in governing decisions affecting the fate of ES cells through transcriptional modulation of Oct4 and Nanog [11], [14][16], [13]. We and others have also shown that SALL4 can activate OCT4 and interact with Nanog [15][17], and the SALL4/OCT4/Nanog transcriptional core network is essential for the maintenance of “stemness” of ES cells [18][20].

Given its important function in ESC, we sought to investigate the transcriptional regulation of SALL4 in ES cells. We have identified that there are two human SALL4 isoforms (SALL4A and SALL4B) [21]. Here we show that both isoforms can activate the expression of OCT4 but suppress those of SALL1 and SALL3. In addition, we have observed that OCT4 can activate the transcription of SALL4, SALL1 and SALL3, suggesting that there is a positive transcription feedback loop between SALL gene family members and OCT4. While SALL1 had no effect on SALL4 promoter, surprisingly, SALL4 showed strong self-repression. Both SALL4 isoforms can repress its own promoter in a dose- dependent manner, and the activation of SALL4 by OCT4 is affected by the level of SALL4 expression. Our findings, when taken together, indicate that SALL4 expression is tightly regulated by self-repression and a positive feedback from OCT4. This novel SALL4/OCT4 transcription regulation feedback loop should provide more insight into the mechanism of governing the “stemness” of ES cells.

Materials and Methods

cDNA Cloning

We performed a tBLASTn search of the GenBank database (http://www.ncbi.nlm.nih.gov//) to identify mouse expressed sequence taqs (ESTs) with significant homology to human SALL4. ESTs highly homologous to the 5′ or 3′ noncoding regions of SALL4 were selected to design primers to amplify SALL4 cDNAs. The primers used were: 5′ primer, 5′-ATG TCG AGG CGC AAG CAG GCG AAG C-3′, and 3′ primer, 5′-TTA GCT GAC GGC AAT CTT ATT TTC C-3′. The entire coding regions of SALL4A and SALL4B were amplified from a mouse brain marathon- ready cDNA library (BD Biosciences Clontech, Palo Alto, CA), The amplified PCR products were cloned into a pcDNA3 vector (Invitrogen Corp., Carlsbad, CA), and the nucleotide sequences were determined by DNA sequencing.

Cell culture and transfection

All cell cultures were maintained at 37°C with 5% CO2. The murine fibroblast cell lines NIH-3T3, monkey kidney cell lines COS-7 and the human embryonal kidney cell line HEK-293 (all from ATCC, Manassas, VA, USA)) were cultured in Dulbecco modified Eagle medium (DMEM) supplemented with 10% heat-inactivated FBS (fetal bovine serum) and penicillin/streptomycin (P/S). Transfection of plasmids into cultured cells was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to manufacturer's recommendations. Human ES cells H9 (Wicell, WI) and mouse W4 ES cells (kindly provided by the Gene Targeting Core Facility, University of Iowa) were cultured, either with feeders or in feeder-free conditions, as described previously [22], [13].

Antibody generation

SALL4 antibody is generated as previously described [21].

ChIP assay

HEK-293 cells (l×106 cells/well in 6-well plates, with or without transient transfection, were processed using a ChIP Assay Kit (Upstate, Charlottesville, VA) following the manufacture's protocol. Briefly, cells were cross-linked by adding formaldehyde (27 µ1 of 37% formaldehyde/ml) and incubated for 10 min. Then, chromatin was sonicated to an average size of approximately 500 bp and immuno-precipitated with SALL4 antibodies, preimmune serum, or anti-HA (hemagglutination) antibody. Histone-DNA crosslinks were reversed by heating at 65°C followed by digestion with proteinase K (Invitrogen, Carlsbad, CA). DNA was recovered by using a PCR purification kit (Qiagen, Valcncia, CA) and then used for PCR or QRT- PCR (quantitative real time polymerase chain reaction).

ChIP-chip Assay and Quantitative Real-time PCR (Q-PCR)

A complete protocol was provided by NimbleGen Systems Inc (Madison, WI). In brief, cells were grown, cross-linked with formaldehyde and sheared by sonication. The anti-SALL4 antibody and rabbit serum were used for chromatin immunoprecipitation (ChIP). ChIP-purified DNA was blunt-ended, ligated to linkers and subjected to low- cycle PCR amplification. Promoter tiling arrays (RefSeq array) were produced by NimbleGen. The RefSeq mouse promoter array design is a single array containing 2.7 kb of each promoter region (from build MM5). The promoter region is covered by 50–75 mer probes at roughly 100 bp spacing, depending on the sequence composition of the region. The arrays were hybridized, and the data were extracted according to NimbleGen standard procedures. Confirmation of the predicted binding sites was performed using Quantitative real-time PCR (Q-PCR). Detailed procedures are described previously [20].

Quantitative reverse transcription-PCR (QRT-PCR)

QRT-PCR was performed as previously described [21]. Briefly, total RNA was isolated using a phenol-free and filter-based RNA isolation system (Qiagen) digested with DNase I to remove DNA contamination. Primer sequences for qRT-PCR were designed using Primer Express® software (Applied Biosystems, Foster City, CA) and are listed in Table 1.

SALL4 promoter constructs and Promoter assays

The 5′-flanking region of SALL 4 was amplified with primers (5′ primer: GGTAC- GCGTAATAGGGCCAACCTCCATGGGAAG; 3′ primer: GCAAAGCTTCGACATGG- TGCGAGCATCGG) to generate a fragment from nucleolide (Nt) -1 to Nt-2102 upstream of the start codon ATG with MluI and HindIII sites at each end respectively. Genomic DNA isolated from human HEK293 cells was used as a template. The amplified PCR (polymerase chain reaction) fragment was cloned into the promoter-less pGL3-basic luciferase reporter plasmid (Promega, Madison, WI) to generate a SALL4 plasmid (P2102). The human OCT4 promoter reporter plasmid (Nt-1 to −1500), mouse Sall4 promoter fusion reporter plasmids containing fragments from Nt-1 to −2200, −645, −250, −190 and −l50 were created in the same manner as P2102.

Promoter luciferase assays were performed with the Dual-Luciferase Reporter Assay System (Promega, Madison WI), Twenty-four hours after transfection, cells were extracted with the use of a passive lysis buffer; a 20-µl aliquot was used for luminescence measurements with a luminometer. The data are represented as the ratio of firefly to Renilla luciferase activity (Fluc/Rluc). These experiments were performed in duplicate.

SALL4 knockdown and human ES cell differentiation

Knock down of endogenous Sall4 expression was conducted using the same method as we reported previously [23]. Briefly, four short-hairpin RNA-expressing plasmids, 2 control (pRS, pRS-gfp) and 2 SALL4 specific (#7410, #. 7412; all four plasmid were obtained from Origen, Rockville, MD), were transfected into Phoenix packaging cells (Orbigen, San Diego, CA) using Lipofectamine 2000 (Invitrogen, Frederick, MD). Shed virus was harvested 48 hours after transfection, and control or stable SALL4 knockdown H9 clones were obtained under puromycin (1.2 µg/mL) selection after 7 days. ES cell differentiation was monitored by morphology inspection under microscope as well as alkaline phosphatase staining as previously described[13].

Gel electrophoresis and Western blot analysis

Sodium dodecyl sulfate–