ࡱ > g n@ bjbjVV ; r< r< A8 , P P P P P d d d 8 ` d 1N z ^ t t t d 4 M M M M M M M $ KP R J M P $ $ $ M P P t t 4 M # # # $ F P t P t lF D # $ M # # : ( , @) t 02R( j F (
XF N 0 1N ( R GS $ GS @) @) X GS P ) $ $ # $ $ $ $ $ M M ! $ $ $ 1N $ $ $ $ GS $ $ $ $ $ $ $ $ $ : Table S1. Oligonucleotide primers used for quantitative PCR.
Target groupPrimer and sequence (5-3)Target gene and standardReferenceTotal bacteria Eub338F, ACTCCTACGGGAGGCAGCAG
Eub518R, ATTACCGCGGCTGCTGG16S rRNA, Plasmid pLME21 containing Bifidobacterium lactis DSM10140T 16S rRNA gene ADDIN EN.CITE Lane19915559[1]555955595Lane, D. J. Stackebrandt, E.Goodfellow, M.16S/23S rRNA sequencingNucleic acid techniques in bacterial systematics115-1751991Chichester, EnglandJohn Wiley & Sons0471929069
9780471929062[ HYPERLINK \l "_ENREF_1" \o "Lane, 1991 #5559" 1]
ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_2" \o "Muyzer, 1993 #4680" 2]Bifidobacterium spp.xfp-fw, ATCTTCGGACCBGAYGAGAC
xfp-rv, CGATVACGTGVACGAAGGACxfp1, Bifidobacterium longum DSM20219T xfp amplicon ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_3" \o "Cleusix, #2433" 3]Bacteroides spp.Bac303F, GAAGGTCCCCCACATTG
Bfr-Fermrev, CGCKACTTGGCTGGTTCAG16S rRNA, Bacteroides thetaiotaomicron DSM2079T 16S rRNA gene ADDIN EN.CITE Manz19964682[4]4682468217Manz, W.Amann, R.Ludwig, W.Vancanneyt, M.Schleifer, K. H.Lehrstuhl fur Mikrobiologie, Technische Universitat Munchen, Germany. manz0654@mailszrz.zrz.tu-berlin.deApplication of a suite of 16S rRNA-specific oligonucleotide probes designed to investigate bacteria of the phylum cytophaga-flavobacter-bacteroides in the natural environmentMicrobiologyMicrobiology1097-106142 ( Pt 5)1996/05/01Bacteroides/genetics/*isolation & purificationBase SequenceCytophaga/genetics/*isolation & purification*Environmental MicrobiologyFeces/microbiologyFlavobacterium/genetics/*isolation & purificationGram-Negative Bacteria/*classificationHumansMolecular Sequence Data*Oligonucleotide ProbesPhylogenyRNA, Bacterial/*geneticsRNA, Ribosomal, 16S/*genetics1996May1350-0872 (Print)
1350-0872 (Linking)8704951http://www.ncbi.nlm.nih.gov/pubmed/8704951eng[ HYPERLINK \l "_ENREF_4" \o "Manz, 1996 #4682" 4]
ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_5" \o "Ramirez-Farias, 2009 #3402" 5]Firmicutes Firm934F, GGAGYATGTGGTTTAATTCGAAGCA
Firm1060R, AGCTGACGACAACCATGCAC16S rRNA, Roseburia intestinalis DSM14610T 16S rRNA gene ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_6" \o "Guo, 2008 #2438" 6]Lactobacillus/ Leuconostoc/ Pediococccus spp.F_Lacto 05, AGCAGTAGGGAATCTTCCA
R_Lacto 04, CGCCACTGGTGTTCYTCCATATA16S rRNA, Lactobacillus delbrueckii DSM20081T 16S rRNA gene ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_7" \o "Furet, 2009 #2466" 7]Roseburia spp./ Eubacterium rectaleRrecF, GCGGTRCGGCAAGTCTGA
Rrec630mR, CCTCCGACACTCTAGTMCGAC16S rRNA, Roseburia intestinalis DSM14610T 16S rRNA gene ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_8" \o "Walker, 2005 #4683" 8]
ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_5" \o "Ramirez-Farias, 2009 #3402" 5]Faecalibacterium prausnitziiFprau223F, GATGGCCTCGCGTCCGATTAG
Fprau420R, CCGAAGACCTTCTTCCTCC16S rRNA, Faecalibacterium prausnitzii DSM17677 16S rRNA gene ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_9" \o "Bartosch, 2004 #3447" 9]
ADDIN EN.CITE Wang19964249[10]4249424917Wang, R. F.Cao, W. W.Cerniglia, C. E.National Center for Toxicological Research, Food and Drug Administration, Jefferson, Arkansas 72079, USA.PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samplesAppl Environ MicrobiolAppl Environ Microbiol1242-76241996/04/01AdultAnimalsBacteria, Anaerobic/*genetics/*isolation & purificationBase SequenceCatsDNA Primers/geneticsDNA, Bacterial/geneticsDogsEvaluation Studies as TopicFeces/*microbiologyHumansInfantMiceMolecular Sequence DataPolymerase Chain Reaction/*methods/statistics & numerical dataRNA, Bacterial/geneticsRNA, Ribosomal, 16S/geneticsRabbitsRatsSensitivity and Specificity1996Apr0099-2240 (Print)
0099-2240 (Linking)8919784http://www.ncbi.nlm.nih.gov/pubmed/8919784167889eng[ HYPERLINK \l "_ENREF_10" \o "Wang, 1996 #4249" 10]Streptococcus spp.Tuf-Strep-1, GAAGAATTGCTTGAATTGGTTGAA
Tuf-Strep-R, GGACGGTAGTTGTTGAAGAATGGtuf2, Streptococcus mitis DSM12643T tuf amplicon ADDIN EN.CITE Collado20091251[11]1251125117Collado, M. C.Delgado, S.Maldonado, A.Rodriguez, J. M.Departamento de Nutricion, Bromatologia y Tecnologia de los Alimentos (NBTA), Universidad Complutense de Madrid (UCM), Madrid, Spain.Assessment of the bacterial diversity of breast milk of healthy women by quantitative real-time PCRLett Appl MicrobiolLett Appl Microbiol523-84852009/02/21Bacteria/classification/genetics/*isolation & purification*BiodiversityDNA, Bacterial/genetics/*isolation & purificationFemaleHumansMilk, Human/*microbiologyPolymerase Chain Reaction/*methodsProbiotics/classification/isolation & purification2009May1472-765X (Electronic)19228290http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=19228290LAM2567 [pii]
10.1111/j.1472-765X.2009.02567.xeng[ HYPERLINK \l "_ENREF_11" \o "Collado, 2009 #1251" 11]Staphylococcus spp.TStaG422, GGCCGTGTTGAACGTGGTCAAATCA
TStag765, TYACCATTTCAGTACCTCTGGTAAtuf, Staphylococcus epidermidis DSM20044T tuf amplicon ADDIN EN.CITE Martineau20011082[12]1082108217Martineau, F.Picard, F. J.Ke, D.Paradis, S.Roy, P. H.Ouellette, M.Bergeron, M. G.Bergeron, MG
Ctr Hosp Univ Quebec, Ctr Rech Infectiol, Pavillon CHUL,2705 Boul Laurier, Quebec City, PQ G1V 4G2, Canada
Univ Laval, Ctr Rech Infectiol, Quebec City, PQ G1V 4G2, Canada
Univ Laval, Fac Med, Div Microbiol, St Foy, PQ G1K 7P4, Canada
Univ Laval, Fac Sci & Genie, Dept Biochim, St Foy, PQ G1K 7P4, CanadaDevelopment of a PCR assay for identification of staphylococci at genus and species levelsJournal of Clinical MicrobiologyJournal of Clinical Microbiology2541-2547397polymerase chain-reactioncoagulase-negative staphylococcistaph-ident systemribosomal-rna geneDNA-based assaysrapid identificationphylogenetic-relationshipsantimicrobial resistanceaureussaprophyticus2001Jul0095-1137ISI:000169586400025<Go to ISI>://000169586400025English[ HYPERLINK \l "_ENREF_12" \o "Martineau, 2001 #1082" 12]EnterobacteriaceaeEco1457F, CATTGACGTTACCCGCAGAAGAAGC
Eco1652R, CTCTACGAGACTCAAGCTTGC16S rRNA, Escherichia coli DSM5698 16S rRNA gene ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_9" \o "Bartosch, 2004 #3447" 9]1xylose-5-phosphate/ fructose-6-phosphate phosphoketolase gene
2elongation factor Tu gene
ADDIN EN.REFLIST 1. Lane DJ (1991) 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M, editors. Nucleic acid techniques in bacterial systematics. Chichester, England: John Wiley & Sons. pp. 115-175.
2. Muyzer G, de Waal EC, Uitterlinden AG (1993) Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 59: 695-700.
3. Cleusix V, Lacroix C, Dasen G, Leo M, Le Blay G Comparative study of a new quantitative real-time PCR targeting the xylulose-5-phosphate/fructose-6-phosphate phosphoketolase bifidobacterial gene (xfp) in faecal samples with two fluorescence in situ hybridization methods. J Appl Microbiol 108: 181-193.
4. Manz W, Amann R, Ludwig W, Vancanneyt M, Schleifer KH (1996) Application of a suite of 16S rRNA-specific oligonucleotide probes designed to investigate bacteria of the phylum cytophaga-flavobacter-bacteroides in the natural environment. Microbiology 142 ( Pt 5): 1097-1106.
5. Ramirez-Farias C, Slezak K, Fuller Z, Duncan A, Holtrop G, et al. (2009) Effect of inulin on the human gut microbiota: stimulation of Bifidobacterium adolescentis and Faecalibacterium prausnitzii. Br J Nutr 101: 541-550.
6. Guo X, Xia X, Tang R, Zhou J, Zhao H, et al. (2008) Development of a real-time PCR method for Firmicutes and Bacteroidetes in faeces and its application to quantify intestinal population of obese and lean pigs. Lett Appl Microbiol 47: 367-373.
7. Furet JP, Firmesse O, Gourmelon M, Bridonneau C, Tap J, et al. (2009) Comparative assessment of human and farm animal faecal microbiota using real-time quantitative PCR. FEMS Microbiol Ecol 68: 351-362.
8. Walker AW, Duncan SH, McWilliam Leitch EC, Child MW, Flint HJ (2005) pH and peptide supply can radically alter bacterial populations and short-chain fatty acid ratios within microbial communities from the human colon. Appl Environ Microbiol 71: 3692-3700.
9. Bartosch S, Fite A, Macfarlane GT, McMurdo ME (2004) Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Appl Environ Microbiol 70: 3575-3581.
10. Wang RF, Cao WW, Cerniglia CE (1996) PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples. Appl Environ Microbiol 62: 1242-1247.
11. Collado MC, Delgado S, Maldonado A, Rodriguez JM (2009) Assessment of the bacterial diversity of breast milk of healthy women by quantitative real-time PCR. Lett Appl Microbiol 48: 523-528.
12. Martineau F, Picard FJ, Ke D, Paradis S, Roy PH, et al. (2001) Development of a PCR assay for identification of staphylococci at genus and species levels. Journal of Clinical Microbiology 39: 2541-2547.
PAGE \* MERGEFORMAT 2/2
; = > J ' ( p q r {jUDU. +h h"2 CJ OJ QJ ^J aJ mH nH u h h"2 CJ OJ QJ ^J aJ )j h h# CJ OJ QJ U^J aJ h h CJ OJ QJ ^J aJ #h h# 6CJ OJ QJ ^J aJ (h h# CJ OJ QJ ^J aJ mHsH h h# CJ OJ QJ ^J aJ h(c CJ OJ QJ ^J aJ hOq" h# OJ QJ \^J hOq" h# CJ \aJ h:w8 h# CJ \aJ h# 5CJ \aJ hW7 h# 5CJ \aJ > K g dh <