PLoS ONEplosplosonePLOS ONE1932-6203Public Library of ScienceSan Francisco, CA USA10.1371/journal.pone.0242939PONE-D-20-27700Research ArticlePeople and placesPopulation groupingsAge groupsAdultsYoung adultsResearch and analysis methodsAnimal studiesExperimental organism systemsModel organismsCaenorhabditis elegansResearch and analysis methodsModel organismsCaenorhabditis elegansResearch and analysis methodsAnimal studiesExperimental organism systemsAnimal modelsCaenorhabditis elegansBiology and life sciencesOrganismsEukaryotaAnimalsInvertebratesNematodaCaenorhabditisCaenorhabditis elegansBiology and life sciencesZoologyAnimalsInvertebratesNematodaCaenorhabditisCaenorhabditis elegansBiology and life sciencesBiochemistryProteinsDNA-binding proteinsTranscription factorsBiology and life sciencesGeneticsGene expressionGene regulationTranscription factorsBiology and life sciencesBiochemistryProteinsRegulatory proteinsTranscription factorsBiology and life sciencesCell biologyCellular typesAnimal cellsNeuronsBiology and life sciencesNeuroscienceCellular neuroscienceNeuronsBiology and life sciencesNeuroscienceDevelopmental neuroscienceBiology and life sciencesAnatomyDigestive systemGastrointestinal tractMedicine and health sciencesAnatomyDigestive systemGastrointestinal tractBiology and life sciencesNeuroscienceCognitive scienceCognitive psychologyPerceptionSensory perceptionBiology and life sciencesPsychologyCognitive psychologyPerceptionSensory perceptionSocial sciencesPsychologyCognitive psychologyPerceptionSensory perceptionBiology and life sciencesNeuroscienceSensory perceptionBiology and life sciencesAnatomyMusculoskeletal systemMusclesPharyngeal musclesMedicine and health sciencesAnatomyMusculoskeletal systemMusclesPharyngeal musclesDamID identifies targets of CEH-60/PBX that are associated with neuron development and muscle structure in Caenorhabditis elegansDamID identifies targets of CEH-60/PBX associated with neurons and muscle in C. eleganshttps://orcid.org/0000-0002-6020-7885Van de WallePieterConceptualizationData curationFormal analysisFunding acquisitionInvestigationMethodologyVisualizationWriting – original draftWriting – review & editing1Muñoz-JiménezCeliaFormal analysisInvestigationMethodologyWriting – original draftWriting – review & editing2https://orcid.org/0000-0003-3192-4428AskjaerPeterConceptualizationData curationFormal analysisFunding acquisitionInvestigationMethodologyResourcesSoftwareSupervisionVisualizationWriting – original draftWriting – review & editing2SchoofsLilianeFunding acquisitionProject administrationSupervisionWriting – review & editing1TemmermanLiesbetConceptualizationFormal analysisFunding acquisitionInvestigationProject administrationResourcesSupervisionWriting – original draftWriting – review & editing1*Animal Physiology and Neurobiology, University of Leuven (KU Leuven), Leuven, BelgiumAndalusian Center for Developmental Biology (CABD), CSIC/JA/Universidad Pablo de Olavide, Seville, SpainDupuyDenisEditorINSERM U869, FRANCE
The authors have declared that no competing interests exist.
* E-mail: Liesbet.Temmerman@kuleuven.be1112202020201512e0242939392020111120202020Van de Walle et alThis is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Transcription factors govern many of the time- and tissue-specific gene expression events in living organisms. CEH-60, a homolog of the TALE transcription factor PBX in vertebrates, was recently characterized as a new regulator of intestinal lipid mobilization in Caenorhabditis elegans. Because CEH-60’s orthologs and paralogs exhibit several other functions, notably in neuron and muscle development, and because ceh-60 expression is not limited to the C. elegans intestine, we sought to identify additional functions of CEH-60 through DNA adenine methyltransferase identification (DamID). DamID identifies protein-genome interaction sites through GATC-specific methylation. We here report 872 putative CEH-60 gene targets in young adult animals, and 587 in L2 larvae, many of which are associated with neuron development or muscle structure. In light of this, we investigate morphology and function of ceh-60 expressing AWC neurons, and contraction of pharyngeal muscles. We find no clear functional consequences of loss of ceh-60 in these assays, suggesting that in AWC neurons and pharyngeal muscle, CEH-60 function is likely more subtle or redundant with other factors.
http://dx.doi.org/10.13039/501100003130Fonds Wetenschappelijk Onderzoek1S00617Nhttps://orcid.org/0000-0002-6020-7885Van de WallePieterhttp://dx.doi.org/10.13039/501100003130Fonds Wetenschappelijk OnderzoekG095915http://dx.doi.org/10.13039/501100004040KU LeuvenC16/19/003http://dx.doi.org/10.13039/501100006003Fundación General CSICPID2019-105069GB-I00https://orcid.org/0000-0003-3192-4428AskjaerPeterhttp://dx.doi.org/10.13039/501100006003Fundación General CSICMDM-2016-0687https://orcid.org/0000-0003-3192-4428AskjaerPeterhttp://dx.doi.org/10.13039/501100006003Fundación General CSIC2019AEP142https://orcid.org/0000-0003-3192-4428AskjaerPeterhttp://dx.doi.org/10.13039/501100000921European Cooperation in Science and TechnologyBM1408https://orcid.org/0000-0002-6020-7885Van de WallePieterPVdW is an n SB PhD fellow of the FWO Flanders (1S00617N, https://www.fwo.be). The authors are grateful to the FWO Flanders (G095915) and KU Leuven (https://www.kuleuven.be, C16/19/003), the Spanish Ministry of Science and Innovation (PID2019-105069GB-I00 and MDM-2016-0687 to PA) and the Spanish Research Council (2019AEP142 to PA) for financial support. We are especially grateful to the Genie COST action (BM1408) for supporting this research.Data AvailabilityRaw and processed DamID data are publicly available at ArrayExpress (accession E-MTAB-9539).1. Introduction
PBC-class transcription factors fulfill a wide range of developmental functions in many organisms (reviewed in [1]). In the nematode Caenorhabditis elegans, they are represented by CEH-20, -40 and -60. While CEH-20 and -40 have been extensively characterized as drivers of neuronal, muscle and general mesodermal development [2–8], CEH-60 remained poorly understood. Recently, it has been shown that CEH-60, like other PBC-class proteins, interacts with a conserved partner UNC-62 and that this interaction occurs in the adult intestine to control lipid mobilization through yolk protein production [9, 10]. It is also argued that the default mode of action of CEH-60 is as a repressor of transcription. This is supported by the fact that in absence of functional CEH-60, ~75% of differential transcripts are upregulated vs ~25% downregulated and that upregulated genes associate more closely with CEH-60 binding sites than downregulated genes [9].
The role of CEH-60 may not be limited to its adult-specific function in lipid mobilization, as CEH-60 activity is also observed in a specific pair of sensory neurons, identified as AWC ("Amphid Wing C"), and in the pharyngeal muscle cells PM6 [10, 11]. AWC neurons are a pair of ciliated neurons in the head region of the animal, their neuron bodies residing near the nerve ring that forms the nexus of the C. elegans nervous system [12]. The best-characterized function of AWC neurons is sensing volatile odors that may signal the presence of food in natural environments to regulate movement towards these odors, termed chemotaxis [13]. To a lesser degree, AWC neurons are involved in sensing temperature [14] and electric fields [15]. Pharyngeal muscles are involved in food intake, and can thus regulate metabolism [16].
Other PBX proteins in C. elegans, CEH-20 and CEH-40, as well as their vertebrate counterparts, have well-characterized roles in neuronal development [17–19] and muscle development [20–24]. Because of ceh-60's functionally orphan neuronal and pharyngeal expression pattern and involvement of its closest relatives in numerous other developmental processes, we decided to look for direct gene targets of CEH-60 using DNA adenine methyltransferase identification (DamID).
DamID is a technique to map the interactions between a protein of interest (POI) and the genome. It has been successfully performed in Drosophila melanogaster [25], mammalian cell lines [26] and C. elegans [27]. This technique was originally developed to characterize the interactions of chromatin proteins with DNA [25], but can also be used to find target genes of transcription factors [28–30]. In this paper, DamID is used to map the interactions between the transcription factor CEH-60 and the promoter regions of its gene targets. Compared to immunoprecipitation techniques such as ChIP-seq, DamID has the advantage of providing an accumulated signal of protein binding instead of a “snapshot”.
DamID relies on the fusion of a POI to a Dam domain, which will methylate the adenine of GATC sites in the genome that are spatially close to where the fusion protein interacts with the DNA [25]. Because GATC methylation does not occur naturally in eukaryotes, the methylation sites can be used as markers for sites of POI-DNA interaction.
In this study, we use DamID to find the genomic targets of CEH-60 and classify them. Genes linked to neuronal development, along with muscle structure genes, indeed emerge as some of the strongest target candidates. We subsequently investigate the morphology and sensory function of AWC neurons as well as pharyngeal pumping in ceh-60 mutants. In these assays we find no clear differences between mutants and controls, suggesting that the function of CEH-60 in neurons and muscle cells may be more subtle or redundant with other factors.
2. Materials and methods2.1 Strains and culture methods
C. elegans were grown under standard conditions [31], fed Escherichia coli OP50, and raised at 20°C. For details on strain names and genotypes, see Table 1.
10.1371/journal.pone.0242939.t001
List of C. elegans strains used, including genotype and source.
Strain
genotype
source/reference
BN578
unc-119(+) lmn-1p::mCherry::his-58 II;
[32]
unc-119(+) myo-2p::gfp IV
PY2417
oyIs44 [odr-1p::rfp + lin-15(+)]
Caenorhabditis Genetics Center, University of Minnesota, MN, USA
unc-119(+) hsp16.41p::FRT::mCherry::his-58::FRT::dam::ceh-60 II; unc-119(+) ceh-60p::FLP::SL2::mNG IV
LSC1863
oyIs44 [odr-1p::rfp + lin-15(+); ceh-60(lst466)
LSC1878
eat-2(ad465) II;
Gift of Brecht Driesschaert and Lucas Mergan, KU Leuven, Belgium
lstIs24[unc-122p::DsRed::unc-54 3‘ UTR]
mNG = mNeonGreen.
2.2 DamID: Plasmids and strains
To obtain tissue-specific control over the dam::ceh-60 transgene, we used a FLP-based gene expression toolkit [32]. In the experimental DamID strain LSC1724, an inducible heat-shock promoter is followed by a fusion of an mCherry gene with a fragment encoding the histone HIS-58, flanked by FRT sites, integrated on chromosome II. This FRT-excisable reporter cassette is followed by a fusion gene of ceh-60 and dam. Additionally, integrated on chromosome IV, this strain contains a ceh-60 promoter driving expression of the flippase FLP, followed by an mNeonGreen reporter gene. Another strain, LSC1722, in which the dam::ceh-60 fusion gene is replaced with gfp::dam, serves as the control for aspecific DamID signal (= noise) during analysis.
Only in tissues in which FLP is expressed, the FRT-flanked cassette on chromosome II is excised, inactivating the mCherry and his-58 reporters, and ceding heat-shock control to the dam::ceh-60 or gfp::dam fusion genes. In this way, Dam fusion proteins are only expressed in tissues in which the flippase, driven by a tissue-specific promoter (here, ceh-60p), is active. Heat shock promoters are used in non-heatshocked conditions to maintain a low and steady state of expression.
2.3 DamID: Sampling and library preparation
DamID sampling and library preparation were carried out essentially as described in [33]. Strains carrying either the gfp::dam (LSC1722) or dam::ceh-60 (LSC1724) transgene were grown under standard conditions. Standard hypochlorite treatment was used to harvest eggs, which were allowed to hatch overnight in M9 buffer. For growing animals for DamID library preparation, four 100 mm NGM plates seeded with Dam-negative E. coli GM119 were used. Dam-negative bacteria do not show GATC methylation, which occurs naturally in most other E. coli strains and would otherwise contaminate C. elegans DamID libraries with bacterial GATC methylation. Young adult or L2 animals were rinsed off plates and 30 μL aliquots were snap-frozen in liquid nitrogen. Genomic DNA was extracted and purified using the Qiagen DNeasy Blood and Tissue kit according to the manufacturer's instructions. 200 ng of each genomic DNA sample was digested by incubation with 10 units of DpnI in 10 μL for 6 hours at 37°C, followed by inactivation at 80°C for 20 minutes. DpnI-digested DNA was incubated overnight at 16°C with 2 μL ligation buffer, 1 μL Roche T4 DNA ligase and 0.8 μL of double-stranded adaptors (AdRt: CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGA, 50 μM, AdRb: TCCTCGGCCG, 50 μM, mixed separately, heated to 95°C and cooled to room-temperature before addition to ligation mix) in a total volume of 20 μL. Ligase was inactivated by incubation for 10 minutes at 65°C. DpnI-digested adaptor-ligated DNA fragments were purified with AgenCourt AMPure XP® beads and a magnetic particle concentrator, after which the sample was digested with DpnII (NEB) by incubation for 1 hour at 37°C, followed by inactivation at 80°C for 20 minutes and another purification step with AgenCourt AMPure XP® beads. DpnII-digested DNA was then amplified using Taq polymerase and 1.25 μL of 50 μM Adr primer (NNNNGGTCGCGGCCGAGGATC). Amplified adaptor-ligated DNA was analyzed by agarose gel electrophoresis and size-selected for amplicons between 400–1200 bp, the expected size of naturally-occurring GATC-flanked reads, using AgenCourt AMPure XP® beads and a magnetic particle concentrator according to the manufacturer's instructions. Using a 0.3 bead-to-sample ratio and selecting the supernatant, amplicons larger than 1200 bp are discarded. Next, using a 0.8 beads-to-sample ratio and selecting the bead-bound DNA, amplicons smaller than 400 bp are discarded. The DNA pool is separated by size through gel electrophoresis to confirm the presence of DNA only in the expected 400–1200 bp range. Adaptor ligated DNA is enriched by PCR and prepared for sequencing using the NEBNext Singleplex oligos for Illumina® by adding 25 μL of NEBNext Q5 Hot Start HiFi PCR Master Mix to 5 μL Index Primer and 5 μL Universal PCR primer to 15 μL of Adaptor-ligated DNA fragments, followed by 8 cycles of PCR amplification as per the manufacturer's instructions. Finally, the sequencing libraries are purified with AgenCourt AMPure XP® beads and size of the amplicons is confirmed by agarose gel electrophoresis and ExperionTM automated electrophoresis system (Bio-Rad) before sending out the libraries for Illumina sequencing at EMBL GeneCore (Heidelberg, Germany).
2.4 DamID: Data analysis
Next-generation sequencing data generated from DamID DNA samples was processed using a variant of the DamIDSeq R pipeline optimized for mapping DamID reads to gene regions termed GeneDamIDseq [34], freely available as R module. The GeneDamIDSeq module takes as input a text file describing the nature and path of (compressed) fastq files which contain the raw sequencing data for all conditions. Reads that do not contain the adapter sequence followed by the GATC motif are discarded, while the adapter sequence is trimmed from the remaining reads. Trimmed reads are mapped to the C. elegans reference genome BSgenome.Celegans.UCSC.ce11, obtained from WormBase, using Bowtie. Read counts for each binned genomic region are summed per sample and normalized for total read number per sample. In GeneDamIDSeq, the binned regions correspond to genes on the C. elegans genome.
The resulting output contains read numbers for each bin (i.e. each C. elegans gene) for each of three replicates for experimental (i.e. dam::ceh-60) and control (gfp::dam) conditions. First, genes were selected where the dam::ceh-60 normalized read number in each single lane was higher than the read number in each single gfp::dam lane and fold-change of average read number of dam::ceh-60 over gfp::dam was higher than 1.7. Correlation analysis on mapped GATC reads was performed by calculating Spearman’s correlation coefficient for all comparisons within young adult or L2 datasets, after removing GATC sites with 0 or 1 read, leaving ~19,000 reads out of ~27,000 per sample.
Corresponding gene names for all targets were obtained using the BioMart Data Mining Tool on WormBase ParaSite. Gene Ontology analysis was carried out using PANTHER 15's statistical overrepresentation test using default settings for biological processes. Gene target lists of L2 and young adult animals were compared for significant overlap using a chi-square test. Single-cell RNA-seq data from [35] was mined for expression profiles of CEH-60 DamID gene targets in order to obtain expression values in each tissue for genes present in both L2 and young adult datasets, L2 only, and young adult only. For each list, the total transcripts per million value was calculated per tissue. DamID and ChIP-seq peaks were tested for overlap using ChIP-seq NarrowPeaks lists for CEH-60 or UNC-62 [9], and 3kb promoter regions upstream of CEH-60 targets identified by GeneDamIDseq. CEH-60 DamID vs CEH-60 ChIP-seq targets, and CEH-60 DamID vs UNC-62 ChIP-seq were compared for significant overlap using a chi-square test. Raw and processed DamID data was deposited to ArrayExpress (accession E-MTAB-9539).
2.5 Microscopy
For characterization of AWC neuron morphology, synchronized young adult animals carrying the odr-1::rfp transgene were anesthetized with 1 mM tetramisole and visualized using a confocal FluoView1000 microscope (Olympus, Japan). Z-stack images of the head region of each animal were converted into maximum intensity projections using Fiji [36].
2.6 Chemotaxis assay
Butanone chemotaxis assays were performed essentially as described in [37] for naive sensing conditions. Synchronized animals were grown at 20°C on E. coli OP50 until the young adult stage, after which they were washed off the plates with M9 buffer and collected in 15 mL conical tubes. Worms were allowed to settle without centrifugation to minimize sampling stress and they were washed twice with M9 buffer to remove residual bacteria. Assay plates were prepared by spotting 1μL of 1M NaN3 on both sides of the plate and additionally adding 1μL of 95% EtOH to one spot and 1μL of 10% butanone in a previously prepared 95% EtOH solution to the other spot. Approximately 100 animals per replicate were spotted at the origin. Chemotaxis assay plates were incubated for 1 hour at room temperature, after which the number or worms at the origin, EtOH-spot, butanone-spot and the total number of worms on the plate were counted. The chemotaxis index (CI) was calculated as
CI=nbutanone-nEtOHntotal-norigin
Conditions were compared using a one-way ANOVA with Dunnett's multiple comparison post-hoc test.
2.7 Pharyngeal pumping assays
Pharyngeal pumping assays were performed essentially as described in [38]. Non-starved day 1 adult animals were filmed on NGM plates with E. coli OP50 for three times 15 seconds using a Leica M165 FC microscope outfitted with an MU035 AmScope microscope eyepiece camera. Recordings were played back at one fourth of normal speed to quantify pumping rate. Six animals were imaged per condition for three periods of 15 seconds each. Pumping rates were averaged per animal. Pumping rates for all conditions were compared using a one-way ANOVA with Dunnett’s multiple comparison post-hoc test.
Isthmus peristalsis rate coinciding with movement of food from the corpus of the pharynx to the terminal bulb was measured using dsRed-expressing OP50 bacteria as a food source, as described in Van Sinay et al. [39] with some adaptations. Well-fed young-adult animals were transferred to a 2% agarose pad containing a 2 μL drop of OP50-dsRed E. coli bacteria, allowed to air dry and covered with a coverslip. Animals were imaged on a Zeiss Axio Observer Z1 equipped with a hEGFP/HcRed filter using only the 555 mm light source. MetaMorph® software was used for image acquisition. Image analysis was performed in Fiji [36]. Isthmus peristalsis rates were quantified during 100 seconds for at least six animals per condition. Frames during which the animal was out of frame or out of focus were censored. Rates were compared using a one-way ANOVA with Dunnett’s multiple comparison post-hoc test.
3. Results and discussion3.1 DamID reveals putative gene targets of CEH-60
To identify the gene targets of CEH-60, we performed DamID on L2 larvae and young adult animals carrying the dam::ceh-60 transgene, using non-specific gfp::dam animals as controls. Highly reproducible results were obtained from three biological replicas as shown by Spearman’s correlation analysis (S1 Fig). High correlation values are observed within dam::ceh-60 samples (≥0.67 in YA, ≥0.65 in L2). Correlation between gfp::dam and dam::ceh-60 is also high (≥0.52 in YA, ≥0.51 in L2). This is not surprising, as open chromatin is more accessible than dense chromatin to both proteins: transcription factor fusions, such as Dam::CEH-60, and diffusible GFP::Dam [40, 41]. We assigned loci as putative CEH-60 targets when the normalized dam::ceh-60 read number in each single replica was higher than the normalized read number in each single gfp::dam lane, and the fold-change of average read number of dam::ceh-60 over gfp::dam was higher than 1.7, resulting in 872 candidate gene targets in young adult samples (S1 Table).
Gene Ontology (GO) analysis of these 872 candidates reveals several statistically overrepresented biological processes, most prominent among which are categories related to muscle, embryo and neuron development (Fig 1 and S3 Table). Among the GO terms, most contain 20–40 gene targets, representing only a small set of the 872 hits, indicating that CEH-60 likely does not target a single pathway or process, but instead regulates many processes or pathways, possibly in subtle ways.
10.1371/journal.pone.0242939.g001
Gene ontology analysis of 872 DamID gene targets in young adult animals.
Non-exhaustive list of biological processes overrepresented in CEH-60 DamID targets. False discovery rate corrected p values are shown for the specified biological process. GO terms were grouped thematically (neuron/embryo/muscle development) by color. Gene ontology analysis was carried out with PANTHER 15 using statistical overrepresentation test for biological processes (complete). A complete list of overrepresented GO terms can be found in S3 Table.
Looking at GO terms in more detail, CEH-60 target loci identified by DamID contain multiple genes regulating neuron projection development specifically, or neuronal development more generally. These include the FEZ1 ortholog unc-76, important for axon fasciculation and extension [42], zag-1, a Zn-finger homeobox transcription factor gene regulating axon development and neuronal differentiation [43], unc-130, coding for a Forkhead transcription factor involved in axon extension and guidance [44], the kinase gene sad-1, which regulates presynaptic vesicle clustering and axon termination [45], the cell-adhesion molecule gene sax-7, involved in neuronal development [46], the serine/threonine kinase gene sax-1, involved in the development of axons of sensory neurons [47], the contactin gene rig-6, which mediates neuronal cell migration [48], the synaptic guidepost protein coding gene syg-2, important for synaptic specificity [49], the heterochronic regulator of cell fate decision during larval development lin-14 [50], the homeobox transcription factor gene ceh-14, which is important for development of thermosensory neurons [51] and the kinesin motor protein encoding gene vab-8, which functions in posteriorly directed neuron migration [52]. The presence of this large group of drivers of neuronal development, most of them involved in axon extension, suggests a role for CEH-60 in the development of ceh-60 expressing AWC neurons and their related sensory function.
The other large group of candidate genes identified by gene ontology analysis is involved in muscle development and contraction. These include the troponin T1 orthologs mup-2, tnt-2 and T22E5.6. These three genes form part of the troponin complex which enables Ca2+-dependent muscle contraction and in C. elegans is also important for muscle development and axon fasciculation [47, 53], the myosin light chain-encoding genes mlc-1, mlc-2, mlc-3 and mlc-4 [54], the myosin heavy chain genes myo-3 [55] and unc-54 [56], the myosin light-chain kinase-like unc-22 gene [57], the Obscurin-coding gene unc-89, a kinase important for muscle cell architecture [58, 59], the tropomyosin ortholog lev-11, and the paramyosin-coding gene unc-15, a major structural component of invertebrate muscles [60]. Many of the targets in this category code for large structural proteins or kinases in muscles, which suggests a possible role for CEH-60 in muscle structure. In support of this, the ceh-60 paralogs ceh-20 and ceh-40, and CEH-60’s in vivo interaction partner UNC-62 have all been implicated in muscle patterning, vulval muscle development and post-embryonic muscle cell differentiation in C. elegans [2, 4–6]. Vertebrate Pbx genes, orthologs of ceh-20, -40 and -60, are also known to be involved in muscle development [20–24].
While ceh-60 is not expressed in the body wall muscle of C. elegans, which comprises the largest muscle system in the animal, ceh-60 is distinctly expressed in the smaller pharyngeal muscle system [10], indicating a possible role for ceh-60 in this tissue. As “regulation of muscle contraction” is one of the most overrepresented biological processes among CEH-60 DamID targets, we speculate that CEH-60 could be involved in contraction of the pharynx, which is indispensable for feeding [61]. Indeed, for 9 out of the 23 genes classified under “muscle structure development”, the largest muscle-related biological process in the GO analysis (Fig 1), there is evidence for expression in pharyngeal muscle: unc-89, unc-22, unc-15, emb-9, dyb-1, alp-1, unc-96, mlc-1 and unc-27 [54, 62–69]. These observations indicate that ceh-60’s function in the muscle system could be related to the pharynx. Alternatively, CEH-60’s action could involve the body wall muscles, but expression in these tissues may be low or time-specific.
Apart from muscle structure and neuronal development, embryonic development is also overrepresented among gene targets. While we did not study the function of CEH-60 in embryonic development in detail, a recent system-level screen of early embryonic development showed that ceh-60 knockdown causes disorganized cell division during two early cleavage points of embryonic development (P3 and AB8) and sporadic misarrangement prior to division [70]. Curiously, ceh-20 and unc-62 knockdown were also tested in the high-throughput study by Guan et al. [70], but without apparent defects. This could indicate that the role of ceh-60 in embryonic development may be mechanistically distinct from its postembryonic function, although no concrete evidence is present for this hypothesis.
Curiously, unc-62 itself is also found among the candidate gene targets of CEH-60. UNC-62 is an intestinal interaction partner of CEH-60 important for lipid transportation [9, 10]. The possibility of genetic cross-regulation by direct binding of CEH-60/PBX to the UNC-62/MEIS-encoding DNA is interesting, and suggestive of a feedback mechanism for this conserved regulatory complex. One group of genes that is notably absent among the DamID gene targets however, encompasses those coding for vitellogenins, precursors to yolk proteins, discussed below.
3.2 Developmental expression shift of CEH-60 targets
We performed DamID on both young adult animals and L2 larvae in order to get a more dynamic view of how CEH-60 gene targets may change when its expression pattern shifts with respect to development, i.e. from limited to the neurons and PM6 during early larval stages to also including intestinal cells in L4 and adult stages [10]. Applying the same approach as for young adult animals, we found 587 candidate CEH-60 targets in L2 DNA (S2 Table). Of these, 43% (252/587 targets, p < 2.2E-16) overlap with those found in young adults. The overlapping genes include muscle proteins mlc-3, myo-3, tnt-2, unc-15, unc-54 and T22E5.10 and the neuronal development regulators lin-14, unc-130 and syg-2, in addition to the vitellogenesis regulators unc-62 and lrp-2. The observation that many genes are also “lost” from the L2 to the young adult stage suggests that early stage-specific marks placed by Dam::CEH-60 may be masked during development by an accumulation of methylation in open chromatin by the continuous activity of GFP::Dam in non-dividing cells. Indeed, we found no significant difference in signal intensity between overlapping and non-overlapping (<log2FCoverlap> = 1.36, <log2FCnon-overlap> = 1.51, p = 0.29) genes, indicating that non-overlapping genes are not simply noise in the L2 dataset that was not filtered out.
We compared the expression sites of L2 and young adult DamID gene targets to gain insight into possible shifts in binding preferences of CEH-60 upon reaching adulthood. For example, an increase in primarily intestinal genes in young adult animals (compared to larval animals) could reflect the activation of ceh-60’s intestinal expression from the L4 stage onward [9, 10]. To this end, we queried three lists of CEH-60 gene targets against publicly available single-cell RNA-seq data from L2 larvae [35]: (1) those overlapping between L2 and young adult, (2) those occurring only in L2 and (3) those occurring only in young adults. Because no peer-reviewed, whole-animal single-cell RNA-seq data are available that would allow a similar analysis based on expression patterns of young adults, we were limited to assigning genes—also the young adult ones—to larval expression patterns.
In presumed CEH-60 target genes that overlap between L2 and young adult datasets, body wall muscle expression is most enriched: body wall muscles represent 61% of all CEH-60 target gene expression, while all other tissues represent only 5–9% each. Of all body wall muscle transcripts measured in the Cao et al. dataset [35], 179,5551,000,000=18% are represented by CEH-60 DamID targets found in both L2 and young adults, while this value ranges from 1–2.5% for other tissues.
In genes identified as possible CEH-60 targets in the L2, but not in the young adult stage, no clear tissue preference can be observed: as opposed to what is seen in the shared gene group, here, body wall muscles account for a share of only 19% of target gene expression, which is similar to the 12–17% weight of nearly all other tissues: gonad, hypodermis, neurons, pharynx and glia. Intestinal expression is least abundant, accounting for only 9%.
In genes present as putative CEH-60 targets only in young adults, but not in L2 larvae, body wall muscles again take the lead in tissue weight, claiming 39% of target gene expression, while neurons and pharynx represent 15% and 12% respectively. Based on ceh-60’s known temporal change in expression pattern [9, 10], the limited weight of the intestine in this young-adult-only list may initially seem counter-intuitive. We cannot emphasize explicitly enough, however, that assignment of tissue-resolved expression is based on RNA-seq data from L2 larvae [35]. CEH-60 gene targets may be expressed in different tissues throughout life, just like ceh-60 itself, and targets may for example be expressed in the intestine in young adults, but not in L2 larvae. Thus, our expression analysis should be used as an indication of which categories of genes may be targeted by CEH-60, until future single-cell resolved sequencing data of adult animals will become available that will allow to fully account for life-stage-specific changes. In all three lists, body wall muscles are the most highly represented, corresponding to the previously described GO-proposed roles of CEH-60 in muscle function. In the overlapping gene list, body wall muscle expression is highest (61 vs 19% and 39%), which could be indicative of a constitutive ‘core function’ of CEH-60 in muscles throughout postembryonic life. Neurons represent less expression in overlapping genes than in L2 or young adult-specific genes, which may indicate stage-specific neuronal roles for CEH-60. The intestine represents only 6–10% of total expression in all three datasets, although expression is highest for young-adult only genes, which may reflect the reported increase in intestinal CEH-60 from the L4 stage onwards (cf above, [9, 10]).
3.3 DamID and ChIP-seq are complementary tools for identifying gene targets and revealing new transcription factor functions
When comparing our DamID results with those based on an available ChIP-seq dataset [9], we find that 301 of 872 DamID-based CEH-60 target genes have one or more corresponding ChIP peaks (35%, p < 2.2E-16). Our result of 35% corresponds well with percentages of 32–49% reported for similar comparisons in literature [30, 71]. While this overlap is convincing, it does show that many DamID targets are not found by ChIP-seq and vice versa. This indicates that DamID and ChIP-seq approaches could be complementary when searching for gene targets of transcription factors. Possibly, sterical considerations limit the interactions revealed by either technique: a POI::Dam fusion protein may have different access to the DNA than a POI::GFP protein pulled down with immunoprecipitation. Additionally, the relative accessibility of different tissues might differ between the two techniques.
Among the overlapping targets, many belong to the broad functional categories delineated above, including muscle proteins (lev-11, mlc-1, -2 and -4, mup-2, T22E5.10, tnt-2, unc-54, unc-89) and regulators of neuronal development (lin-14, rig-6, sad-1, sdn-1, unc-130, unc-73, vab-8). On the other hand, one notable set of targets lacking in our DamID-based data are a group of intestinally-expressed genes, the vit genes.
vit genes code for vitellogenin proteins, and are lacking from our gene target list in both young adult and L2 animals, even though they are obvious candidates for direct regulation by intestinal CEH-60 in young adults [9–11]. A recent study of CEH-60 gene targets employing a different approach, did find that CEH-60 directly interacts with the promoters of vit genes in adult animals [9]. In line with this, CEH-60’s known interaction partner UNC-62 is also known to bind to the VPE1 element in the vit gene promoters [72, 73]. One possibility for the peculiar absence of vit genes in our dataset, is that our DamID pipeline may have been more stringent than standard ChIP-seq analysis, as indicated by the 872 gene targets identified through DamID by us, and the 9010 targets identified through ChIP-seq [9]. Alternatively, our DamID sampling may not have been optimal for capturing binding of vit genes in the C. elegans intestine, as this only occurs from the L4 stage on. While we sampled during the young adult stage, methylation of the GATC sites in vit promoters may have required more time to become significantly enriched. This could be a second reason why we are not observing an increase in intestinal targets in young adult animals compared to L2 larvae (Table 2), in addition to the L2 origin of the tissue-specific RNA-seq data (cf above).
10.1371/journal.pone.0242939.t002
Distribution of expression levels over tissues for CEH-60 gene targets identified by DamID present in both L2 and Young Adult (YA) datasets, L2 only or YA only, according to L2-stage single-cell RNA-seq analysis of [35].
Tissue
(1) L2-YA shared
(2) L2 only
(3) Young adult only
tpm
%
tpm
%
tpm
%
Body wall muscle
179555
60.76
47782
18.80
167937
39.05
Glia
18978
6.42
36195
14.24
42751
9.94
Gonad
18425
6.24
41866
16.47
28815
6.70
Hypodermis
14812
5.01
38819
15.27
33500
7.90
Intestine
18744
6.34
22801
8.97
40098
9.32
Neurons
24033
8.13
36197
14.24
64603
15.02
Pharynx
20948
7.09
30502
12.00
52389
12.18
Body wall muscle expression is most abundant in all three gene target lists. “tpm” indicates transcripts per million, this is the number of transcripts represented by genes in the specified list, per one million total transcripts in that tissue (i.e. relative weight of the target gene list within the total transcriptome of the tissue). “%” indicates the percentage of total gene expression represented by the specified tissue in that dataset (i.e. tissue enrichment per list: each column adds up to 100%).
When comparing ChIP-seq data of CEH-60’s known interaction partner UNC-62 [9] with DamID targets of CEH-60, we find that 82 out of 872 CEH-60 DamID targets correspond to one or more of the 2053 ChIP-seq peaks for UNC-62 (9.4%, p = 8.21E-13). This shows that there is a significant overlap in gene targets of CEH-60 and UNC-62, as would be expected from their conserved in vivo interaction. Of these 82 shared genes between CEH-60 DamID and UNC-62 ChIP-seq targets, 69 also occur in the 301 overlapping targets of CEH-60 DamID and CEH-60 ChIP-seq datasets (84.1%, p < 2.2E-16). Together, these data show that gene targets generated using DamID share a significant number of hits with gene targets generated using other methods for the same transcription factor or transcription factors that are—at least in some proven cases—part of the same complex, such as UNC-62.
Comparing our results to other DamID studies reveals that the number of putative gene targets identified by us, 872 for YA and 587 for L2 animals, is within the expected range [27, 29, 74, 75]. Still, false positives are definitely possible and gene targets identified by DamID alone should be regarded as putative. We here relied on DamID as a tool to build hypotheses on new functions of the transcription factor CEH-60, which can be subsequently studied using functional assays.
3.4 CEH-60 is not essential for normal AWC morphology or odor-sensing function
The transcription factor CEH-60 targets several genes important for neuronal development (Fig 1), and ceh-60 is expressed throughout life in the AWC neurons [10]. To assess whether the morphology of these neurons depends on CEH-60’s function, we crossed ceh-60(lst466) mutants with the AWC-specific odr-1p::rfp marker and observed the morphology of AWC neurons in both conditions (Fig 2). RFP signal can clearly be observed in the cytoplasm of both wild-type and ceh-60 mutant AWC neurons, with sensory cilia being present and reaching the tip of the nose of the animal. Also, the dendrite connecting the left and right AWC neuron by following a semicircular path along the nerve ring, appears similar in both conditions.
10.1371/journal.pone.0242939.g002
Morphology of AWC neurons in the head of control and ceh-60(lst466) mutant animals is similar.
All animals carry the AWC-specific odr-1p::rfp fluorescent marker. We found no clear difference in morphology of the AWC neurons between mutants and controls. In both cases, the neuron bodies (dashed circles) are clearly formed and extend their projections towards the sensory tip of the nose (dashed arrows) and the nerve ring (solid arrows). Outline of animals is shown as a dotted white line. Scale bar = 20 μm. Both animals are L4 larvae.
We additionally tested whether despite normal overall morphological appearance, AWC function might be affected in ceh-60 mutants. The AWC neurons are best-characterized as sensors of volatile odors such as butanone [13]. Under normal circumstances, C. elegans is attracted to butanone. We found that the chemotaxis index (CI, Fig 3A), which here quantifies a population's attraction to butanone, does not differ between wild-type animals and either of the tested ceh-60 mutant alleles (Fig 3B), despite a proper response of the positive control (che-3 mutants, deficient in a known regulator of volatile odorant sensing [13]). This indicates that the odorant-sensing apparatus, which includes the AWC neurons, is functional in absence of CEH-60, and taken together with the morphological data (Fig 2), likely intact.
10.1371/journal.pone.0242939.g003
ceh-60 mutants have normal butanone sensing capacity.
(A) The butanone sensing assay experimental setup. Animals are collected, washed to remove residual bacteria and released at the origin of a chemotaxis plate, to which 10% butanone (orange) and control (blue) spots have been applied (details: methods). After 1 hour, the chemotaxis index is calculated as CI = ([(nButanone)-(nEtOH)]/[(Total-nOrigin)], with n the number of animals at these positions. (B) Wild-type animals are able to sense butanone, as evidenced by their positive CI. che-3(e1124) animals have a documented defect in sensing butanone, and their (significantly lower) CI is used as a positive control for the assay. Neither ceh-60 mutant strain shows a significant difference in CI. **** p < 0.0001. NS, not significant. Each dot represents an assay of a biologically independent population, N = 6.
As tested by these assays, CEH-60 does not appear to affect AWC morphology or function. However, besides the here presented gene target studies and ceh-60’s expression in AWC, there are other reasons to believe that CEH-60 has a role to play in olfactory neurons. Previously, CEH-60 has been characterized as a modulator of fat mobilization through activation of vitellogenesis in the intestine [9, 10]. Olfactory sensing has often been linked to fat storage and metabolism, with a high-fat diet in mice causing decreased sense of smell and olfactory neuron activity [76], and human anorexia nervosa patients often experiencing increased olfactory sensing [77]. Recently, butanone sensing through AWC neurons in C. elegans was also found to influence fat storage and mobilization, likely signaling through the neuropeptide FLP-1 and its receptor NPR-4, the glucocorticoid-inducible kinase GSK-1 and DAF-16 in peripheral tissues [78]. Because CEH-60 does not appear to influence butanone sensing, we maintain that the method through which CEH-60 alters fat mobilization and storage, is through its documented regulation of vitellogenesis.
Future work may yet unveil CEH-60’s cryptic role or function in olfactory AWC neurons, further motivated by (1) the recent discovery that PBX1, coding for ceh-60’s homolog in vertebrates, acts as a terminal selector for olfactory bulb neuron differentiation in mice [79], and (2) the knowledge that in C. elegans, olfactory learning depends on the odor-sensing (ceh-60-expressing) AWC neurons but also involves signaling from DBL-1/TGF-β [80], which is here identified as a putative gene target for CEH-60 (S1 Table). DBL-1 could indeed be the signaling molecule linking several CEH-60-related phenotypes: DBL-1 regulates vitellogenesis [73], is needed for building of an impermeable epicuticle [81], functions as an olfactory learning cue in the neurons [73, 80, 81], and is a gene target of CEH-60 as identified by DamID (this study). So far however, the exact role of CEH-60 in AWC neurons remains undiscovered. Because simple morphological and functional studies here performed showed no distinct phenotype, it is possible that the function of CEH-60 in AWC neurons is subtle, redundant with other (transcription) factors, or unrelated to neuron morphology or easily quantifiable behavior.
3.5 CEH-60 is not essential for on-food pharyngeal pumping
The C. elegans hermaphrodite muscle system consists of body wall, pharyngeal, anal sphincter, anal depressor, vulval and uterine muscles and a contractile gonadal sheath [82]. Because many CEH-60 targets are involved in muscle contraction and are expressed in the pharyngeal muscle, and because ceh-60 itself is expressed in the PM6 pharyngeal muscle cells, we decided to investigate pharyngeal pumping in ceh-60 mutants by quantifying the pumping rate in the presence of food of adult animals. While eat-2 mutants, which have a well-documented defect in pharyngeal pumping rate [38] indeed show a decreased average pumping rate compared to wild types, ceh-60 mutants do not (Fig 4A). Additionally, we quantified isthmus peristalsis, a contraction of pharynx muscles that carries food from the corpus of the pharynx to the terminal bulb, using fluorescent E. coli OP50 bacteria. We observed no difference between wild type and ceh-60 mutant animals (Fig 4B). Thus, the function of ceh-60 in muscle tissue is still to be determined.
10.1371/journal.pone.0242939.g004
ceh-60 mutants have normal pharyngeal functions.
(A) Wild-type animals and ceh-60 mutant animals have similar pumping rates on food, while eat-2 mutants pump significantly slower. Each dot represents one animal (N), imaged thrice for 15 seconds. Pumping rates were averaged per animal. **** p < 0.0001. NS = not significant. N = 6. (B) Wild-type animals and ceh-60 mutants have similar isthmus peristalsis or “gulp” rates. NS = not significant. N ≥ 6.
DamID results (S1 and S2 Tables), ceh-60 expression patterns [10] and Pbx functions in vertebrate muscle development [20–24] all suggest a role for CEH-60 in muscle structure, specifically in the pharynx, yet both pharyngeal contractions measured were not measurably affected in ceh-60 mutants (Fig 4). CEH-60 function in the pharynx may not be apparent when studying on-food behavior, and may require more demanding conditions such as the absence of food, which normally leads to serotonin-dependent enhanced pumping [83].
While our dataset of CEH-60 targets also contains several genes known to be expressed in body wall muscle, CEH-60 itself is absent from this tissue [10, 35]. Because CEH-60 can also act as a repressor of transcription [9], these data could indicate that in the pharynx, CEH-60 actively represses transcription of certain body wall muscle genes. It would be interesting to explore this further in future research.
CEH-60’s function in the pharynx may not be related to muscle structure directly. Recently, it has been shown that the PM6 pharyngeal muscle cells, in which ceh-60 is abundantly expressed and which surround the pharynx grinder, transdifferentiate into secretory cells during lethargus, possibly aiding in the construction of a new grinder [84]. The grinder is an extracellular matrix, constructed during each larval transition phase, coinciding with earlier-reported cyclic expression of ceh-60 [11, 85]. CEH-60 may act in PM6 cells to aid in this cyclic transdifferentiation from muscle cells to secretory cells, or in re-establishment of muscle nature once the extracellular matrix of the grinder is built.
4. Conclusions
Expression patterns and functional information from homologs and paralogs all point towards the possibility for new roles of the transcription factor CEH-60/PBX in C. elegans. Through DamID, we identified gene targets of CEH-60 and hypothesized on its function in neuron development and muscle structure. Specifically, we tested morphology and function of sensory AWC neurons and pharyngeal muscle. While we did not find evidence for CEH-60-related function in the observed assays, our phenotypic analysis was limited to simple behavioral assays and morphological characterization of neurons. This means that roles for CEH-60 in neurons and muscle are still possible, although they may be subtle or hard to uncover because of genetic redundancy. In addition, we compared our DamID results to available ChIP-seq data and conclude that while there is a common core of genes identified, both techniques also identify unique targets.
Supporting information
Spearman’s rank-order correlation coefficients for dam::ceh-60 and gfp::dam samples.
In both young adults (A) and L2 larvae (B), high correlation values are observed within dam::ceh-60 samples (≥0.67 in YA, ≥0.65 in L2). Correlation between gfp::dam and dam::ceh-60 is also high (≥0.52 in YA, ≥0.51 in L2).
(DOCX)
872 candidate gene targets of CEH-60 identified in young adult animals through DamID.
Start and stop represent the genomic positions on the specified chromosome (chr) of the specified open reading frame. Candidate gene targets are sorted by genomic position (i.e. chromosome number and start position). Log2FC is calculated as the log2 value of the ratio of average number of dam::ceh-60 reads over average number of gfp::dam reads.
(DOCX)
587 candidate gene targets of CEH-60 identified in L2 animals through DamID.
Start and stop represent the genomic positions on the specified chromosome of the specified open reading frame. Candidate gene targets are sorted by genomic position (i.e. chromosome number and start position). Log2FC is calculated as the log2 value of the ratio of average number of dam::ceh-60 reads over average number of gfp::dam reads.
(DOCX)
Complete gene ontology analysis of 872 DamID gene targets in young adult animals.
Complete list of biological processes overrepresented in CEH-60 DamID targets. Observed and expected columns represent the number of genes associated with the specified ontology term and the expected number in a random collection of genes for the C. elegans genome. Fold enrichment represents the number of times the specified process is overrepresented in the dataset. FDR p value represents the false discovery rate corrected p value for the specified biological process. GO terms were sorted by FDR p value. Gene ontology analysis was carried out with PANTHER 15 using a statistical overrepresentation test for biological processes (complete).
(DOCX)
OP50-dsRed E. coli bacteria were a gift from Dr. Andre Brown (Imperial College London, UK). Some strains were provided by the Caenorhabditis genetics center (University of Minnesota, US).
ReferencesLongobardiE, PenkovD, MateosD, FlorianG De, TorresM, BlasiF. Biochemistry of the tale transcription factors PREP, MEIS, and PBX in vertebrates. . 2014; 59–75. doi: 10.1002/dvdy.2401623873833LiuJ, FireA. Overlapping roles of two Hox genes and the exd ortholog ceh-20 in diversification of the C. elegans postembryonic mesoderm. . 2000;127: 5179–5190. 11060243LiuH, StraussTJ, PottsMB, CameronS. Direct regulation of egl-1 of programmed cell death by the Hox protein MAB-5 and CEH-20, a C. elegans homolog of Pbx1. . 2006;133: 641–650. doi: 10.1242/dev.0223416421192Van AukenK, WeaverD, RobertsonB, SundaramM, SaldiT, EdgarL, et al. Roles of the homeothorax/Meis/Prep homolog UNC-62 and the Exd/Pbx homologs CEH-20 and CEH-40 in C. elegans embryogenesis. . 2002;129: 5255–5268. 12399316JiangY, ShiH, LiuJ. Two Hox cofactors, the Meis/Hth homolog UNC-62 and the Pbx/Exd homolog CEH-20, function together during C. elegans postembryonic mesodermal development. . 2009;334: 535–546. doi: 10.1016/j.ydbio.2009.07.03419643105JiangY, ShiH, AminNM, SultanI, LiuJ. Mesodermal expression of the C. elegans HMX homolog mls-2 requires the PBC homolog CEH-20. . 2008;125: 451–461. doi: 10.1016/j.mod.2008.01.00918316179HughesS, BrabinC, ApplefordPJ, WoollardA. CEH-20/Pbx and UNC-62/Meis function upstream of rnt-1/Runx to regulate asymmetric divisions of the C. elegans stem-like seam cells. . 2013;2: 718–727. doi: 10.1242/bio.2013454923862020ZhengC, JinFQ, ChalfieM. Hox proteins act as transcriptional guarantors to ensure terminal differentiation. . 2015;13: 1343–1352. doi: 10.1016/j.celrep.2015.10.04426547238DowenRH. CEH-60/PBX and UNC-62/MEIS coordinate a metabolic switch that supports reproduction in C. elegans. . 2019; 1–16. doi: 10.1016/j.devcel.2019.03.00230956009Van de WalleP, GeensE, BaggermanG, Naranjo-GalindoFJ, AskjaerP, SchoofsL, et al. CEH-60/PBX regulates vitellogenesis and cuticle permeability through intestinal interaction with UNC-62/MEIS in Caenorhabditis elegans. . 2019;17: 1–28. doi: 10.1371/journal.pbio.300049931675356Van RompayL, BorghgraefC, BeetsI, CaersJ, TemmermanL. New genetic regulators question relevance of abundant yolk protein production in C. elegans. . 2015; 1–16. doi: 10.1038/srep1638126553710Altun ZF, Hall DH. Nervous system, general description. In: WormAtlas. 2011.BargmannCI, HartwiegE, HorvitzHR. Odorant-selective genes and neurons mediate olfaction in C. elegans. . 1993;74: 515–527. doi: 10.1016/0092-8674(93)80053-h8348618BeverlyM, AnbilS, SenguptaP. Degeneracy and neuromodulation among thermosensory neurons contribute to robust thermosensory behaviors in Caenorhabditis elegans. . 2011;31: 11718–11727. doi: 10.1523/JNEUROSCI.1098-11.201121832201GabelC V., GabelH, PavlichinD, KaoA, ClarkDA, SamuelADT. Neural circuits mediate electrosensory behavior in Caenorhabditis elegans. . 2007;27: 7586–7596. doi: 10.1523/JNEUROSCI.0775-07.200717626220SongB, AveryL. The pharynx of the nematode C. elegans: A model system for the study of motor control. . 2013;2: e21833. doi: 10.4161/worm.2183324058858WaskiewiczAJ, RikhofH a, MoensCB. Eliminating zebrafish Pbx proteins reveals a aindbrain ground state. . 2002;3: 723–733. doi: 10.1016/s1534-5807(02)00319-212431378EricksonT, PillayLM, WaskiewiczAJ. Zebrafish Tshz3b negatively regulates hox function in the developing hindbrain. . 2011;49: 725–742. doi: 10.1002/dvg.2078121714061ZhengC, Diaz-CuadrosM, ChalfieM. Hox genes promote neuronal subtype diversification through posterior induction in Caenorhabditis elegans. . 2015;88: 514–527. doi: 10.1016/j.neuron.2015.09.04926539892BerkesCA, BergstromDA, PennBH, SeaverKJ, KnoepflerPS, TapscottSJ. Pbx marks genes for activation by MyoD indicating a role for a homeodomain protein in establishing myogenic potential. . 2004;14: 465–477. doi: 10.1016/s1097-2765(04)00260-615149596MavesL, WaskiewiczAJ, PaulB, CaoY, TylerA, MoensCB, et al. Pbx homeodomain proteins direct Myod activity to promote fast-muscle differentiation. . 2007;134: 3371–3382. doi: 10.1242/dev.00390517699609BryantsevAL, DuongS, BrunettiTM, ChechenovaMB, LovatoTAL, NelsonC, et al. Extradenticle and Homothorax control adult muscle fiber identity in Drosophila. . 2012;23: 664–673. doi: 10.1016/j.devcel.2012.08.00422975331YaoZ, FarrGH, TapscottSJ, MavesL. Pbx and Prdm1a transcription factors differentially regulate subsets of the fast skeletal muscle program in zebrafish. . 2013;2: 546–555. doi: 10.1242/bio.2013392123789105ChoOH, MallappaC, Hernández-HernándezJM, Rivera-PérezJA, ImbalzanoAN. Contrasting roles for MyoD in organizing myogenic promoter structures during embryonic skeletal muscle development. . 2015;244: 43–55. doi: 10.1002/dvdy.2421725329411SteenselB Van, HenikoffS. Identification of in vivo DNA targets of chromatin proteins using tethered Dam methyltransferase. . 2000;18. doi: 10.1038/7448710748524VogelMJ, Peric-HupkesD, van SteenselB. Detection of in vivo protein—DNA interactions using DamID in mammalian cells. . 2007;2: 1467–1478. doi: 10.1038/nprot.2007.14817545983SchusterE, McElweeJJ, TulletJMA, DoonanR, MatthijssensF, Reece-HoyesJS, et al. DamID in C. elegans reveals longevity-associated targets of DAF-16/FoxO. . 2010;6: 1–6. doi: 10.1038/msb.2010.5420706209La FortezzaM, GrigolonG, CosoloA, PinduyrinA, BreimannL, BlumH, et al. DamID profiling of dynamic Polycomb-binding sites in Drosophila imaginal disc development and tumorigenesis. . 2018;11: 1–17. doi: 10.1186/s13072-017-0171-z29310712VissersJHA, FroldiF, SchröderJ, PapenfussAT, ChengLY, HarveyKF. The Scalloped and Nerfin-1 transcription factors cooperate to maintain neuronal cell fate. . 2018;25: 1561–1576.e7. doi: 10.1016/j.celrep.2018.10.03830404010TostiL, AshmoreJ, TanBSN, CarboneB, MistriTK, WilsonV, et al. Mapping transcription factor occupancy using minimal numbers of cells in vitro and in vivo. . 2018;28: 592–605. doi: 10.1101/gr.227124.11729572359LewisJA, FlemingJT. Basic Culture Methods. . 1995. pp. 3–29. doi: 10.1016/S0091-679X(08)61381-38531730Muñoz-JiménezC, AyusoC, DobrzynskaA, TorresA, AskjaerP. An efficient FLP-based toolkit for spatiotemporal control of gene expression in Caenorhabditis elegans. . 2017;206: 1–16. doi: 10.1534/genetics.117.20162428476859Gómez-SalvidarG, MeisterP, AskjaerP. DamID analysis of nuclear organization in Caenorhabditis elegans. In: ShackletonS, editor. . Springer; 2016. pp. 341–358. doi: 10.1007/978-1-4939-3530-7SharmaR, RitlerD, MeisterP. Tools for DNA adenine methyltransferase identification analysis of nuclear organization during C. elegans development. . 2016;54: 151–159. doi: 10.1002/dvg.2292526845390CaoJ, PackerJS, RamaniV, CusanovichDA, HuynhC, DazaR, et al. Comprehensive single-cell transcriptional profiling of a multicellular organism. . 2017;357: 661–667. doi: 10.1126/science.aam894028818938SchindelinJ, Arganda-carrerasI, FriseE, KaynigV, LongairM, PietzschT, et al. Fiji: an open-source platform for biological-image analysis. . 2012;9. doi: 10.1038/nmeth.201922743772KauffmanA, ParsonsL, SteinG, WillsA, KaletskyR, MurphyC. C. elegans positive butanone learning, short-term, and long-term associative memory assays. . 2011; e2490. doi: 10.3791/249021445035MosbechMB, KruseR, HarvaldEB, OlsenASB, GallegoSF, Hannibal-BachHK, et al. Functional loss of two ceramide synthases elicits autophagy-dependent lifespan extension in C. elegans. . 2013;8. doi: 10.1371/journal.pone.007008723894595Van SinayE, MirabeauO, DepuydtG, Van HielMB, PeymenK, WatteyneJ, et al. Evolutionarily conserved TRH neuropeptide pathway regulates growth in Caenorhabditis elegans. . 2017;114: E4065–E4074. doi: 10.1073/pnas.161739211428461507ShaK, GuSG, Pantalena-FilhoLC, GohA, FleenorJ, BlanchardD, et al. Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans. . 2010;11: 1–15. doi: 10.1186/1471-2164-11-120044946SenSQ, ChanchaniS, SouthallTD, DoeCQ. Neuroblast-specific open chromatin allows the temporal transcription factor, Hunchback, to bind neuroblast-specific loci. . 2019;8: 1–26. doi: 10.7554/eLife.4403630694180BloomL, HorvitzHR. The Caenorhabditis elegans gene unc-76 and its human homologs define a new gene family involved in axonal outgrowth and fasciculation. . 1997;94: 3414–3419. doi: 10.1073/pnas.94.7.34149096408ClarkSG, ChiuC. C. elegans ZAG-1, a Zn-finger-homeodomain protein, regulates axonal development and neuronal differentiation. . 2003;130: 3781–3794. doi: 10.1242/dev.0057112835394NashB, ColavitaA, ZhengH, RoyPJ, CulottiJG. The forkhead transcription factor UNC-130 is required for the graded spatial expression of the UNC-129 TGF-β guidance factor in C. elegans. . 2000;14: 2486–2500. doi: 10.1101/gad.83150011018016CrumpJG, ZhenM, JinY, BargmannCI. The SAD-1 kinase regulates presynaptic vesicle clustering and axon termination. . 2001;29: 115–129. doi: 10.1016/s0896-6273(01)00184-211182085WangX, KweonJ, LarsonS, ChenL. A role for the C. elegans L1CAM homologue lad-1/sax-7 in maintaining tissue attachment. . 2005;284: 273–291. doi: 10.1016/j.ydbio.2005.05.02016023097JiaL, EmmonsSW. Genes that control ray sensory neuron axon development in the Caenorhabditis elegans male. . 2006;173: 1241–1258. doi: 10.1534/genetics.106.05700016624900KatidouM, TavernarakisN, KaragogeosD. The contactin RIG-6 mediates neuronal and non-neuronal cell migration in Caenorhabditis elegans. . 2013;373: 184–195. doi: 10.1016/j.ydbio.2012.10.02723123963ShenK, FetterRD, BargmannCI. Synaptic specificity is generated by the synaptic guidepost protein SYG-2 and its receptor, SYG-1. . 2004;116: 869–881. doi: 10.1016/s0092-8674(04)00251-x15035988HristovaM, BirseD, HongY, AmbrosV. The Caenorhabditis elegans heterochronic regulator LIN-14 is a novel transcription factor that controls the developmental timing of transcription from the insulin/insulin-like growth factor gene ins-33 by direct DNA binding. . 2005;25: 11059–11072. doi: 10.1128/MCB.25.24.11059-11072.200516314527CassataG, KagoshimaH, AndachiY, KoharaY, DürrenbergerMB, HallDH, et al. The LIM homeobox gene ceh-14 confers thermosensory function to the AFD neurons in Caenorhabditis elegans. . 2000;25: 587–597. doi: 10.1016/s0896-6273(00)81062-410774727WolfFW, HungMS, WightmanB, WayJ, GarrigaG. vab-8 is a key regulator of posteriorly directed migrations in C. elegans and encodes a novel protein with kinesin motor similarity. . 1998;20: 655–666. doi: 10.1016/s0896-6273(00)81006-59581759McardleK, AllenTS, BucherEA. Ca2+-dependent muscle dysfunction caused by mutation of the Caenorhabditis elegans troponin T-1 gene. . 1998;143: 1201–1213. doi: 10.1083/jcb.143.5.12019832549RushforthAM, WhiteCC, AndersonP. Functions of the Caenorhabditis elegans regulatory myosin light chain genes mlc-1 and mlc-2. . 1998;150: 1067–1077. 9799259MillerDM, StockdaleFE, KarnJ. Immunological identification of the genes encoding the four myosin heavy chain isoforms of Caenorhabditis elegans. . 1986;83: 2305–2309. doi: 10.1073/pnas.83.8.23052422655MoermanDG, PluradS, WaterstonRH, BaillieDL. Mutations in the unc-54 myosin heavy chain gene of Caenorhabditis elegans that alter contractility but not muscle structure. . 1982;29: 773–781. doi: 10.1016/0092-8674(82)90439-17151169BenianGM, KiffJE, NeckelmannN, MoermanDG, WaterstonRH. Sequence of an unusually large protein implicated in regulation of myosin activity in C. elegans. . 1989;342: 45–50. doi: 10.1038/342045a02812002BenianGM, TinleyTL, TangX, BorodovskyM. The Caenorhabditis elegans gene unc-89, required for muscle M-line assembly, encodes a giant modular protein composed of Ig and signal transduction domains. . 2010;132: 171–173. doi: 10.1016/B978-0-12-374105-9.00223–9SpoonerPM, BonnerJ, MaricqA V., BenianGM, NormanKR. Large isoforms of UNC-89 (obscurin) are required for muscle cell architecture and optimal calcium release in Caenorhabditis elegans. . 2012;7. doi: 10.1371/journal.pone.004018222768340KagawaH, GengyoK, MclachlanAD, BrennerS, KarnJ. Paramyosin gene (unc-15) of Caenorhabditis elegans. Molecular cloning, nucleotide sequence and models for thick filament structure. . 1989;207: 311–333. doi: 10.1016/0022-2836(89)90257-x2754728TrojanowskiNF, RaizenDM, Fang-YenC. Pharyngeal pumping in Caenorhabditis elegans depends on tonic and phasic signaling from the nervous system. . 2016;6: 1–10. doi: 10.1038/s41598-016-0001-828442746SmallTM, GernertKM, FlahertyDB, MercerKB, BorodovskyM, BenianGM. Three new isoforms of Caenorhabditis elegans UNC-89 containing MLCK-like protein kinase domains. . 2004;342: 91–108. doi: 10.1016/j.jmb.2004.07.00615313609MatsunagaY, HwangH, FrankeB, WilliamsR, PenleyM, QadotaH, et al. Twitchin kinase inhibits muscle activity. . 2017;28: 1591–1600. doi: 10.1091/mbc.E16-10-070728428253ArdizziJR, EpsteinHF. Immunochemical localization of myosin heavy chain isoforms and paramyosin in developmentally and structurally diverse muscle cell types of the nematode Caenorhabditis elegans. . 1987;105: 2763–2770. doi: 10.1083/jcb.105.6.27633320053MatsuoK, KogaA, IharaS. Visualization of endogenous NID-1 and EMB-9 in C. elegans. . 2019. doi: 10.17912/micropub.biology.00011032550405GieselerK, MariolMC, BessouC, MigaudM, FranksCJ, Holden-DyeL, et al. Molecular, genetic and physiological characterisation of dystrobrevin-like (dyb-1) mutants of Caenorhabditis elegans. . 2001;307: 107–117. doi: 10.1006/jmbi.2000.448011243807McKeownCR, HanHF, BeckerleMC. Molecular characterization of the Caenorhabditis elegans ALP/Enigma gene alp-1. . 2006;235: 530–538. doi: 10.1002/dvdy.2063316278882MercerKB, MillerRK, TinleyTL, ShethS, QadotaH, BenianGM. Caenorhabditis elegans UNC-96 is a new component of M-lines that interacts with UNC-98 and paramyosin and is required in adult muscle for assembly and/or maintenance of thick filaments. . 2007;18: 976–985. doi: 10.1091/mbc.e06-09-081317202407RuksanaR, KurodaK, TeramiH, BandoT, KitaokaS, TakayaT, et al. Tissue expression of four troponin I genes and their molecular interactions with two troponin C isoforms in Caenorhabditis elegans. . 2005;10: 261–276. doi: 10.1111/j.1365-2443.2005.00829.x15743415GuanG, WongM-K, Sze HoVW, AnX, ChanL-Y, TianB, et al. System-level quantification and phenotyping of early embryonic morphogenesis of Caenorhabditis elegans. . 2019.CheethamSW, GruhnWH, van den AmeeleJ, KrautzR, SouthallTD, KobayashiT, et al. Targeted DamID reveals differential binding of mammalian pluripotency factors. . 2018;145. doi: 10.1242/dev.17020930185410van NostrandEL, Sánchez-BlancoA, WuB, NguyenA, KimSK. Roles of the developmental regulator unc-62/Homothorax in limiting longevity in Caenorhabditis elegans. . 2013;9. doi: 10.1371/journal.pgen.100332523468654GoszczynskiB, CaptanV V., DanielsonAM, LancasterBR, McGheeJD. A 44 bp intestine-specific hermaphrodite-specific enhancer from the C. elegans vit-2 vitellogenin gene is directly regulated by ELT-2, MAB-3, FKH-9 and DAF-16 and indirectly regulated by the germline, by daf-2/insulin signaling and by the TGF-β/Sma. . 2016;413: 112–127. doi: 10.1016/j.ydbio.2016.02.03126963674OrianA, SteenselB Van, DelrowJ, BussemakerHJ, LiL, SawadoT, et al. Genomic binding by the Drosophila Myc, Max, Mad/Mnt transcription factor network. . 2003;17: 1101–1114. doi: 10.1101/gad.106690312695332Gutierrez-TrianaJA, MateoJL, IbbersonD, RyuS, WittbrodtJ. iDamIDseq and iDEAR: An improved method and computational pipeline to profile chromatin-binding proteins. . 2016;143: 4272–4278. doi: 10.1242/dev.13926127707796ThiebaudN, JohnsonMC, ButlerJL, BellG a., FergusonKL, FadoolAR, et al. Hyperlipidemic diet causes loss of olfactory sensory neurons, reduces olfactory discrimination, and disrupts odor-reversal learning. . 2014;34: 6970–6984. doi: 10.1523/JNEUROSCI.3366-13.201424828650Fernández-ArandaF, AgüeraZ, Fernández-GarcíaJC, Garrido-SanchezL, Alcaide-TorresJ, TinahonesFJ, et al. Smell–taste dysfunctions in extreme weight/eating conditions: analysis of hormonal and psychological interactions. . 2016;51: 256–267. doi: 10.1007/s12020-015-0684-99 26198367MutluAS, GaoSM, ZhangH, WangMC. Olfactory specificity regulates lipid metabolism through neuroendocrine signaling in Caenorhabditis elegans. . 2020;11: 1450. doi: 10.1038/s41467-020-15296-832193370RemesalL, Roger-BaynatI, ChirivellaL, MaicasM, Brocal-RuizR, Pérez-VillalvaA, et al. PBX1 acts as terminal selector for olfactory bulb dopaminergic neurons. . 2020. doi: 10.1242/dev.18684132156753ZhangX, ZhangY. DBL-1, a TGF-β, is essential for Caenorhabditis elegans aversive olfactory learning. . 2012;109: 17081–17086. doi: 10.1073/pnas.120598210923019581SchultzRD, BennettEE, EllisEA, GumiennyTL. Regulation of extracellular matrix organization by BMP signaling in Caenorhabditis elegans. . 2014;9. doi: 10.1371/journal.pone.010192925013968AltunZF, HallDH. Muscle system, introduction. . 2009.HorvitzHR, ChalfieM, TrentC, SulstonJE, PeterD. Serotonin and octopamine in the nematode Caenorhabditis elegans. . 1982;216: 1012–1014. doi: 10.1126/science.68050736805073SparacioAP, TrojanowskiNF, SnetselaarK, NelsonMD, RaizenDM. Teething during sleep: Ultrastructural analysis of pharyngeal muscle and cuticular grinder during the molt in Caenorhabditis elegans. . 2020;15: 1–24. doi: 10.1371/journal.pone.023305932433687HendriksG, GaidatzisD, AeschimannF, GroßhansH. Extensive Oscillatory Gene Expression during C. elegans Larval Development. . 2014;53: 380–392. doi: 10.1016/j.molcel.2013.12.0132444050410.1371/journal.pone.0242939.r001Decision Letter 0DupuyDenisAcademic Editor2020Denis DupuyThis is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.Submission Version0
18 Sep 2020
PONE-D-20-27700
DamID identifies targets of CEH-60/PBX that are associated with neuron development and muscle structure in Caenorhabditis elegans
PLOS ONE
Dear Dr. Van de Walle,
Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
In particular it would be important to address in more details the conflicting expression data for the putative targets of CEH-60.
Please submit your revised manuscript by Nov 02 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.
Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.
If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols
We look forward to receiving your revised manuscript.
Kind regards,
Denis Dupuy, Ph.D.
Academic Editor
PLOS ONE
Journal Requirements:
When submitting your revision, we need you to address these additional requirements.
1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at
https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and
2. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.
[Note: HTML markup is below. Please do not edit.]
Reviewers' comments:
Reviewer's Responses to Questions
Comments to the Author
1. Is the manuscript technically sound, and do the data support the conclusions?
The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.
Reviewer #1: Yes
Reviewer #2: Partly
**********
2. Has the statistical analysis been performed appropriately and rigorously?
Reviewer #1: Yes
Reviewer #2: I Don't Know
**********
3. Have the authors made all data underlying the findings in their manuscript fully available?
The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.
Reviewer #1: Yes
Reviewer #2: Yes
**********
4. Is the manuscript presented in an intelligible fashion and written in standard English?
PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.
Reviewer #1: Yes
Reviewer #2: Yes
**********
5. Review Comments to the Author
Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)
Reviewer #1: Van de Walle et al. investigate the role of the CEH-60/PBX transcription factor in neuron and muscle development in C. elegans using a molecular and a phenotypic approach. While the investigation does not identify any roles for CEH-60 in neuron or muscle development/function, the logic and rationale for the investigation are solid and the negative results are likely to be of interest to various sub-disciplines. For example, ceh-60 is expressed in some muscles and AWC sensory neurons and PBX-family TFs have known roles in muscle and neuron development across species, including paralogs in worm.
This work does not rule out a role for CEH-60 in nueorn and muscle, and these caveats are made known, although should be summarized in the conclusion (see below).
The authors use a DamID approach to identify potential CEH-60 binding sites in the genome, and through extrapolation, target genes that are regulated. Since this study is done at different time points, the data suggest possible changes in target gene regulation. While DamID is not the newest technology that could be used for this approach, it is still appropriate especially in metazoa. The DamID experiments appear to have been done with great care, appropriate controls, and in triplicate with good data correlation across repeats. This data set, which the authors indicate will be made available online, should be a useful resource for the community.
I commend the authors for a refreshingly well-written manuscript that was easy to read because of a strong flow of logic, good attention to detail, and adherence to standard genetic nomenclature. I only noted a few errors and places where clarification or citations are needed (see below).
Specific comments to address:
Line 63: Would be useful to also cite Choksi et al 2006 as a more recent and excellent example of DamID use in fly.
Lines 94 and 97: FLP_D5 is used with and without an underscore (with underscore in the table). Simply needs consistent use throughout.
Lines 215-216: There is a statement that GFP prefers open chromatin and this is used as a rationale for why CEH-60::Dam and GFP::Dam have a high correlation with each other. The statement that GFP prefers open chromatin would need a reference to support this. While it seems likely that GFP::Dam would lead to random methylation in open chromatin at a low frequency, it seems overstated to say it prefers open chromatin as GFP has no DNA binding affinity on its own. It also seems concerning that a negative control has significant correlation with the experiment suggesting that random DNA methylation is not too different than TF-driven methylation. This point should be addressed, perhaps by comparing this to past DamID results in other papers in fly/worm assuming similar results were obtained there for TF DamID experiments and GFP controls.
Lines 316-318: Similar to above, there is another claim about GFP::Dam continuously marking open chromatin, which can hide a signal. This should also be referenced citing past examples of this with other DamID studies.
The Table associated with the strains used and genotypes is listed as Table 3 yet is presented as the first table in the paper. Seems like it should be Table 1, given that do not see a table numbered as #1 and the next table to appear is #2.
Conclusion: A more thorough discussion of the caveats of the study are appropriate here such as the fact that CEH-60 may have roles in neuron and muscle that have not been uncovered here simply because of the limited scope of phenotypic analysis and possible genetic redundancy. Such information is alluded to in other places of the manuscript but a concise statement of the caveats in the conclusion seems appropriate.
Reviewer #2: 1. Its difficult to build a compelling story focused on the role of a gene product in particular cell types (AWCs and PM6) when the gene lacks a mutant phenotype in those cell types. The authors looked at two different ceh-60 mutants for phenotypes in AWC and PM6, but failed to detect functional deficits. One possible explanation raised by the authors is redundancy. I wonder whether phenotype would be detected if the authors built a dominant-negative type of construct whereby the DNA-binding domain was intact, but the transactivating domain lacked activity, thereby displacing redundant factors but preventing activity. Or engineering a hypermorphic state by replacing ceh-60’s transactivating domain with a ‘stronger’ one (whatever that means).
Based on the Cao et al data, I would not put much faith in ceh-60 expression in AWC (see below), so I would not focus a phenotypic search there. But, there is good expression of ceh-60 in the pharynx muscle. PM6 surrounds the grinder, and there are some fascinating biology that is going on there (see David Raizen’s 2020 PLoS One paper). Perhaps ceh-60 is involved in grinder formation, or the transdifferaction of surrounding cells, or re-establishing the muscle-nature of PM6 after it has transdifferentiated. If ceh-60 had an important role in grinder formation, I would expect a slow-growth phenotype, but no one has reported that, so maybe there is nothing there. The authors could look at the maceration of fluorescent bacteria for example to quantify grinder efficiency. Should the authors look at other large-scale datasets, they will find that ceh-60 oscillates in a time sequence in larval development that is consistent with a role in grinder formation or some other aspect of the larval development cycle.
2. The body wall muscle targets are very perplexing. If one examines the Cao et al 2017 data in detail, one will see that ceh-60 transcripts are detected at only very low levels (~40X less than in the intestine and ~100X less than in the pharynx muscle). Several of those genes are well-known to be exclusively expressed in non-pharynx muscle (unc-54, myo-3 etc). This, in combination with the lack of vit-gene targets detected, call into question the validity of the experiments (sorry). It's a head scratcher and some things don't add up.
On that note, the Cao et al data shows no expression of ceh-60 in ciliated neurons (which would include AWC) in L2s, which should raise some concern about reporter expression of ceh-60 in the AWC being a result of transgene artifact. (Sorry, but its not clear if the authors are making a claim that ceh-60 is expressed in the AWCs only in adults; if so, then the Cao data would not necessarily be relevant.
The authors might want to cross-reference their list of targets (as revealed by DamID or ChIP) with theose genes that are co-expressed with ceh-20 in the pharynx muscle. These would be high-value targets and worth further discussion.
Minor point: On line 280, it is not clear what the authors mean by writing, ‘9 are specifically expressed in pharyngeal muscle’. Certainly, they must not mean ‘exclusively expressed in pharynx muscle’, since those genes are known to be expressed in BWMs. Perhaps they mean that there is good evidence that they are also expressed in the pharynx. If so, they should clarify that sentence.
**********
6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.
If you choose “no”, your identity will remain anonymous but your review may still be made public.
Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.
Reviewer #1: No
Reviewer #2: No
[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]
While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
10.1371/journal.pone.0242939.r002Author response to Decision Letter 0Submission Version1
4 Nov 2020
Reviewer 1:
Line 63: Would be useful to also cite Choksi et al 2006 as a more recent and excellent example of DamID use in fly.
This suggestion has been implemented in the revised manuscript on line 61.
Lines 94 and 97: FLP_D5 is used with and without an underscore (with underscore in the table). Simply needs consistent use throughout.
FLP is now used throughout the revised manuscript for simplicity, as the addition “_D5” is not relevant in this manuscript.
Lines 215-216: There is a statement that GFP prefers open chromatin and this is used as a rationale for why CEH-60::Dam and GFP::Dam have a high correlation with each other. The statement that GFP prefers open chromatin would need a reference to support this. While it seems likely that GFP::Dam would lead to random methylation in open chromatin at a low frequency, it seems overstated to say it prefers open chromatin as GFP has no DNA binding affinity on its own. It also seems concerning that a negative control has significant correlation with the experiment suggesting that random DNA methylation is not too different than TF-driven methylation. This point should be addressed, perhaps by comparing this to past DamID results in other papers in fly/worm assuming similar results were obtained there for TF DamID experiments and GFP controls.
We apologize that the original text was unclear on this point and we have rephrased the text in the revised manuscript (lines 221-224):
“This is not surprising, as open chromatin is more accessible than dense chromatin to both proteins: transcription factor fusions, such as Dam::CEH-60, and diffusible GFP::Dam (Sha et al. 2010; Sen et al. 2019)”.
As discussed in the early DamID protocols, “methylation by dam is modulated by the local structure of chromatin: DNA in condensed chromatin, such as heterochromatin, is generally less accessible to dam than DNA in transcriptionally active, decondensed euchromatin” (Greil et al, Methods in Enzymology, Volume 410, 2006, Pages 342-359). Therefore, a diffusible Dam-only or Dam-GFP fusion is included to normalize for the different degrees of chromatin accessibility across the genome. Similar to our study, other C. elegans groups also use Dam-GFP rather than Dam-only as control (e.g. BMC Genomics. 2010 Aug 6;11:465. doi: 10.1186/1471-2164-11-465; Mol Syst Biol. 2010 Aug 10;6:399. doi: 10.1038/msb.2010.54.). The modified sentence includes a reference to a recent study in flies that used DamID to study chromatin accessibility and the interaction of Hunchback with target genes (https://doi.org/10.7554/eLife.44036). In line with our results and with the above, this study also finds a high correlation between Dam-Hunchback and Dam-only signal, both globally (Figure 6A-C), and at particular loci (Figure 6D-E).
Lines 316-318: Similar to above, there is another claim about GFP::Dam continuously marking open chromatin, which can hide a signal. This should also be referenced citing past examples of this with other DamID studies.
We are not aware of other studies that have analyzed non-dividing cells at two different developmental time points with basal or “leaky” expression of Dam fusion proteins. We have rephrased the text to more precisely reflect that this is an assumption based on our observations, rather than a fact (lines 319-322 in the revised manuscript):
“The observation that many genes are also “lost” from the L2 to the young adult stage suggests that early stage-specific marks placed by Dam::CEH-60 may be masked during development by an accumulation of methylation in open chromatin by the continuous activity of GFP::Dam in non-dividing cells.”
The Table associated with the strains used and genotypes is listed as Table 3 yet is presented as the first table in the paper. Seems like it should be Table 1, given that do not see a table numbered as #1 and the next table to appear is #2.
Apologies for the oversight. Table 1 is now used for the strain table, both in table legend and revised manuscript text.
Conclusion: A more thorough discussion of the caveats of the study are appropriate here such as the fact that CEH-60 may have roles in neuron and muscle that have not been uncovered here simply because of the limited scope of phenotypic analysis and possible genetic redundancy. Such information is alluded to in other places of the manuscript but a concise statement of the caveats in the conclusion seems appropriate.
To implement this suggestion, the lines in the revised conclusion now read (lines 539-543 in the revised manuscript):
“While we did not find evidence for CEH-60-related function in the observed assays, our phenotypic analysis was limited to simple behavioral assays and morphological characterization of neurons. This means that roles for CEH-60 in neurons and muscle are still possible, although they may be subtle or hard to uncover because of genetic redundancy.”
Reviewer 2:
The authors looked at two different ceh-60 mutants for phenotypes in AWC and PM6, but failed to detect functional deficits. One possible explanation raised by the authors is redundancy. I wonder whether phenotype would be detected if the authors built a dominant-negative type of construct whereby the DNA-binding domain was intact, but the transactivating domain lacked activity, thereby displacing redundant factors but preventing activity. Or engineering a hypermorphic state by replacing ceh-60’s transactivating domain with a ‘stronger’ one (whatever that means).
While we can only agree that it would be very interesting to study the effects of modifying different CEH 60 domains, this is not yet possible because it first requires additional insight into its protein complex; information that is currently lacking. We already know that CEH-60 associates with at least two other transcription factors in spatiotemporally restricted ways (UNC-62 and PQM-1, Dowen et al. 2019 and Van de Walle et al. 2019), and that depending on unknown interactions, CEH-60 can switch between acting as a repressor vs activator of transcription. Because the dynamic nature of the transcription factor is complex and because its specific interactions are largely unknown, it is not yet possible to make strong hypotheses on expected outcomes of the alleles suggested by the reviewer.
Based on the Cao et al data, I would not put much faith in ceh-60 expression in AWC (see below), so I would not focus a phenotypic search there. But, there is good expression of ceh-60 in the pharynx muscle. PM6 surrounds the grinder, and there are some fascinating biology that is going on there (see David Raizen’s 2020 PLoS One paper). Perhaps ceh-60 is involved in grinder formation, or the transdifferaction of surrounding cells, or re-establishing the muscle-nature of PM6 after it has transdifferentiated. If ceh-60 had an important role in grinder formation, I would expect a slow-growth phenotype, but no one has reported that, so maybe there is nothing there.
It is certainly a reasonable hypothesis for expression of ceh-60 in the PM6 muscle cells to be related to pharynx grinder formation; and we agree it would be worth investigating grinder structure in future research - for example using TEM as recently done by David Raizen’s team (2020) - in ceh-60 mutants. We now discuss this in the revised manuscript (lines 525-532):
“CEH-60’s function in the pharynx may not be related to muscle structure directly. Recently, it has been shown that the PM6 pharyngeal muscle cells, in which ceh-60 is abundantly expressed and which surround the pharynx grinder, transdifferentiate into secretory cells during lethargus, possibly aiding in the construction of a new grinder (Sparacio et al. 2020). The grinder is an extracellular matrix, constructed during each larval transition phase, coinciding with earlier-reported cyclic expression of ceh-60 (Hendriks et al. 2014, Van Rompay et al. 2015). CEH-60 may act in PM6 cells to aid in this cyclic transdifferentiation from muscle cells to secretory cells, or in re-establishment of muscle nature once the extracellular matrix of the grinder is built.”
We do not observe an obvious slow growth phenotype in mutants carrying any of the ceh-60 alleles mentioned in our (current and previous) work, although we cannot yet rule out minor differences (few minutes to hours).
We have addressed concerns about the CEH-60 expression pattern in AWC neurons below, where the question is posed in more detail.
The authors could look at the maceration of fluorescent bacteria for example to quantify grinder efficiency.
In response to this comment, we performed extra experiments using OP50-dsRed E. coli bacteria and quantified isthmus peristalsis, the “swallowing” motion of the pharynx that moves food from the pharynx corpus to the terminal bulb. We observed no differences between wild-type animals and ceh-60 mutants, strengthening our hypothesis that food intake in these animals is essentially normal. The results are presented in Fig. 4B and lines 501-504 of the revised manuscript:
“Additionally, we quantified isthmus peristalsis, a contraction of pharynx muscles that carries food from the corpus of the pharynx to the terminal bulb, using fluorescent E. coli OP50 bacteria. We observed no difference between wild type and ceh-60 mutant animals (Fig 4.B).”
The assay is described in the methods section, in lines 203-212 of the revised manuscript.
Should the authors look at other large-scale datasets, they will find that ceh-60 oscillates in a time sequence in larval development that is consistent with a role in grinder formation or some other aspect of the larval development cycle.
Indeed, we have also reported on ceh-60’s transcriptional oscillation pattern in previous work (Van Rompay et al. 2015, Van de Walle et al. 2019), which correlates with molting cycles, hence also with grinder formation. We have updated the manuscript to include this hypothesis, as per details quoted two comments above.
The body wall muscle targets are very perplexing. If one examines the Cao et al 2017 data in detail, one will see that ceh-60 transcripts are detected at only very low levels (~40X less than in the intestine and ~100X less than in the pharynx muscle). Several of those genes are well-known to be exclusively expressed in non-pharynx muscle (unc-54, myo-3 etc). This, in combination with the lack of vit-gene targets detected, call into question the validity of the experiments (sorry). It's a head scratcher and some things don't add up.
We agree that the data present a “head scratcher”, but not an unsolvable one. All technical parameters indicate that the data quality and analysis are sound, which means that integrating these results with previous knowledge on CEH-60 is in essence a conceptual challenge.
The presence of CEH-60 gene targets in the body wall muscle, where CEH-60 itself is not expressed, does not necessarily pose a problem, because CEH-60 can also act as a repressor of transcription (Dowen 2019). It can therefore be hypothesized that in pharyngeal muscle cells, CEH-60 could act as a repressor of body wall muscle genes such as unc-54 and myo¬-3. To clarify these points, we added the following lines to the revised manuscript (lines 520-524)
“While our dataset of CEH-60 targets also contains several genes known to be expressed in body wall muscle, CEH-60 itself is absent from this tissue (Cao et al. 2017; Van de Walle et al. 2019). Because CEH-60 can also act as a repressor of transcription (Dowen 2019), these data could indicate that in the pharynx, CEH-60 actively represses transcription of certain body wall muscle genes. It would be interesting to explore this further in future research.”
In the revised text, these lines are followed by the pharynx/grinder rationale tying into David Raizen’s work, mentioned three comments back, as a plausible and fascinating route for future investigation (lines 525-532).
On that note, the Cao et al data shows no expression of ceh-60 in ciliated neurons (which would include AWC) in L2s, which should raise some concern about reporter expression of ceh-60 in the AWC being a result of transgene artifact. (Sorry, but its not clear if the authors are making a claim that ceh-60 is expressed in the AWCs only in adults; if so, then the Cao data would not necessarily be relevant.
Different fluorescent reporter constructs made by us and others (Reece-Hoyes et al. 2007, Van Rompay et al. 2015, Dowen et al 2019, Van de Walle et al. 2019) all point towards expression of ceh-60 in amphid neurons. These include transcriptional, translational and fosmid-based constructs with different fluorescent markers inserted at different points in the sequence, and driven by different promoter variants. In our experience, AWC expression is present throughout life. This means that there is indeed a disagreement between all these reporters and the Cao et al. curated dataset, where ceh-60 was not assigned to the ciliated neuron cluster. However, many technical reasons may equally well explain ceh-60’s transcript absence in the latter, and unfortunately, no other single-cell datasets are available that contain any ceh-60 data at all (Lorenzo et al. 2020, Nucleic Acids Res., Hammerlund et al. 2018, Neuron). The ceh-60 locus is rather complex, containing an internal transcription start site and several overlapping possible transcripts, which have not yet been teased out. Clearly, the last ink has far from been spilled on a possible role for CEH-60 in these cells, but we uphold that evidence at present argues for the presence of this transcription factor in AWC.
The authors might want to cross-reference their list of targets (as revealed by DamID or ChIP) with theose genes that are co-expressed with ceh-20 in the pharynx muscle. These would be high-value targets and worth further discussion.
We are unsure what the reviewer means by this. As far as we know, there is no list of CEH-20 gene targets in pharynx muscle nor a list of pharyngeal genes differentially expressed on ceh-20 knockout. We agree that, should a list of pharyngeal targets of CEH-20 become available, cross-referencing it with our CEH-60 pharyngeal muscle targets would indeed be very interesting.
Minor point: On line 280, it is not clear what the authors mean by writing, ‘9 are specifically expressed in pharyngeal muscle’. Certainly, they must not mean ‘exclusively expressed in pharynx muscle’, since those genes are known to be expressed in BWMs. Perhaps they mean that there is good evidence that they are also expressed in the pharynx. If so, they should clarify that sentence.
We apologize for the confusion. The lines now read (lines 282-284 in the revised manuscript):
“Indeed, for 9 out of the 23 genes classified under “muscle structure development”, the largest muscle-related biological process in the GO analysis (Fig 1), there is evidence for expression in pharyngeal muscle.”
In addition, we made following small adjustments:
- Throughout the manuscript and in Fig S1: ceh-60::dam � dam::ceh-60
This was done to correctly reflect the order of the sequences in the fusion construct.
- Line 223-224: the dam::ceh-60 read number � the normalized dam::ceh-60 read number.
- Line 224: read number � normalized read number.
Submitted filename: Response to reviewers_R1.docx
10.1371/journal.pone.0242939.r003Decision Letter 1DupuyDenisAcademic Editor2020Denis DupuyThis is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.Submission Version1
12 Nov 2020
DamID identifies targets of CEH-60/PBX that are associated with neuron development and muscle structure in Caenorhabditis elegans
PONE-D-20-27700R1
Dear Dr. Van de Walle,
We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.
Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.
An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.
If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.
Kind regards,
Denis Dupuy, Ph.D.
Academic Editor
PLOS ONE
Additional Editor Comments (optional):
Reviewers' comments:
Reviewer's Responses to Questions
Comments to the Author
1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.
Reviewer #1: All comments have been addressed
Reviewer #2: All comments have been addressed
**********
2. Is the manuscript technically sound, and do the data support the conclusions?
The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.
Reviewer #1: Yes
Reviewer #2: (No Response)
**********
3. Has the statistical analysis been performed appropriately and rigorously?
Reviewer #1: Yes
Reviewer #2: (No Response)
**********
4. Have the authors made all data underlying the findings in their manuscript fully available?
The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.
Reviewer #1: Yes
Reviewer #2: (No Response)
**********
5. Is the manuscript presented in an intelligible fashion and written in standard English?
PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.
Reviewer #1: Yes
Reviewer #2: (No Response)
**********
6. Review Comments to the Author
Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)
Reviewer #1: All concerns raised during peer review have been adequately addressed. I feel that the paper is now ready for publication.
Reviewer #2: (No Response)
**********
7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.
If you choose “no”, your identity will remain anonymous but your review may still be made public.
Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.
Reviewer #1: No
Reviewer #2: No
10.1371/journal.pone.0242939.r004Acceptance letterDupuyDenisAcademic Editor2020Denis DupuyThis is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
23 Nov 2020
PONE-D-20-27700R1
DamID identifies targets of CEH-60/PBX that are associated with neuron development and muscle structure in Caenorhabditis elegans
Dear Dr. Van de Walle:
I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.
If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.
If we can help with anything else, please email us at plosone@plos.org.
Thank you for submitting your work to PLOS ONE and supporting open access.