The authors have declared that no competing interests exist.
Conceived and designed the experiments: CF PT HB M. Simonato. Performed the experiments: CF PT AB CPB PR M. Soukupova. Analyzed the data: CF PT M. Simonato. Contributed reagents/materials/analysis tools: CPB HB. Wrote the paper: CF PT HB M. Simonato.
Brain-derived neurotrophic factor (BDNF) has been found to produce pro- but also anti-epileptic effects. Thus, its validity as a therapeutic target must be verified using advanced tools designed to block or to enhance its signal. The aim of this study was to develop tools to silence the BDNF signal. We generated Herpes simplex virus type 1 (HSV-1) derived amplicon vectors, i.e. viral particles containing a genome of 152 kb constituted of concatameric repetitions of an expression cassette, enabling the expression of the gene of interest in multiple copies. HSV-1 based amplicon vectors are non-pathogenic and have been successfully employed in the past for gene delivery into the brain of living animals. Therefore, amplicon vectors should represent a logical choice for expressing a silencing cassette, which, in multiple copies, is expected to lead to an efficient knock-down of the target gene expression. Here, we employed two amplicon-based BDNF silencing strategies. The first, antisense, has been chosen to target and degrade the cytoplasmic mRNA pool of BDNF, whereas the second, based on the convergent transcription technology, has been chosen to repress transcription at the
The neurotrophin brain-derived neurotrophic factor (BDNF) is widely expressed in the brain, where it exerts a key role in neuronal survival, differentiation, and plasticity [
Amplicon vectors are HSV-1 particles identical to wild type HSV-1 from the structural and host-range points of view, but which carry a concatemeric form of a DNA plasmid, named amplicon plasmid, instead of the 152 Kb viral genome. HSV-1 amplicon vectors hold considerable promise as gene-transfer vehicles because of their very high capacity to host foreign DNA with high number of repeats of the transgene [
Two silencing strategies have been pursued in this study. The first, called “antisense”, has been chosen to target and degrade the cytoplasmic messenger RNA (mRNA) pool of BDNF via an RNA interference (RNAi) mechanism [
The second strategy, based on the “convergent transcription technology” [
In the present study, the silencing effect of amplicon vectors has been assessed by examining their efficiency in down-regulating BDNF levels
For construction of the plasmid containing antisense BDNF (plasmid pAM2-BDNF-antisense-GFP), the XbaI-BamHI fragment containing the cytomegalovirus (CMV) promoter was cut from the pMA-RQ-CMV plasmid and cloned in the XbaI-BamHI sites of pAM-GFP, a plasmid expressing the green fluorescent protein (GFP) under control of the IE4/5 promoter, to obtain the pAM-GFP-CMV plasmid. The BDNF fragment was cut from the plasmid pBSK-BDNF using EcoRI blunted-end sites by Klenow and cloned in the polylinker NheI blunted-end sites of pAM2-GFP-CMV, flanked by the CMV promoter and a Simian Virus 40 (SV40) polyadenylation signal (
(A) The pAM2-BDNF-antisense-GFP plasmid (6.84 Kb) results by insertion in antisense orientation of a fragment (1.1 Kb) containing the BDNF sequence and a poly-A tail. (B) In the pAM-CT-BDNF-GFP plasmid (7.07 Kb), the BDNF sequence (1.1 Kb) is inserted in convergent transcription, between two CMV promoters. (C) The control plasmid, pAM2-GFP plasmid (5.70 Kb). These 3 plasmids were used to produce stocks of amplicon vectors at high purities (see text).
For construction of the BDNF convergent transcription plasmid (pAM-CT-BDNF-GFP), a new CMV fragment (HindIII/PmeI) was subcloned into the HindIII/EcoRV site of pAM-GFP-CMV, in the opposite direction compared to the other CMV promoter, obtaining the pAM-CT-GFP plasmid. The pAM-CT-BDNF-GFP plasmid was then obtained by cloning the EcoRI blunted-end sites by Klenow BDNF fragment of pBSK-BDNF plasmid in the EcoRV-digested pAM-CT-GFP plasmid, in order to put the BDNF sequence between the two CMV promoters (
The cell lines employed in this study were the following: genetically modified mesoangioblasts producing BDNF and GFP (MABs-BDNF; [
Amplicon vectors were produced by transfecting 10 μg of each amplicon plasmid (pAM2-BDNF-antisense-GFP, pAM-CT-BDNF-GFP and pAM2-GFP) into trans-complementing-producing-Vero cells using the jetPRIME reagent (Polyplus-transfection, France). Cells were superinfected the following day with the LaLΔJ helper virus at a multiplicity of infection (MOI) of 0.5 plaque forming units (pfu)/cell in medium M199 (Gibco) supplemented with 1% FBS and 1% penicillin/streptomycin. Three days later, cells were harvested and amplicon viral particles were extracted by several rounds of freeze/thaw and sonication. To calculate purity of the production, amplicon and helper particles were titrated to obtain transduction units (tu)/ml (using cell number counting assay on Gli36 cells) and pfu/ml (on trans-complementing Vero cells). Several successive rounds of infections and productions were performed to obtain high quantity of amplicon particles and a final infection-production step was performed on a trans-complementing-purifying-Vero cell to obtain a final high purity working stock of amplicon vectors over the helper. The degree of purity was greater than 99% for all amplicon vectors. All virus stocks were checked for no revertant helper viruses on Vero cells.
Confluent MABs-BDNF cells seeded in 6-well plates were infected with the GFP-control, BDNF-antisense or BDNF-CT amplicon at MOI 5, and maintained at 34°C in DMEM with 10% FBS for 24, 48, 72 or 96 h. At each time point, cells were washed twice in PBS, then scraped and resuspended in 50 μl of lysis buffer (50 mM Tris-HCL pH 8, 150 mM NaCl, 1% NP-40) containing a protease inhibitor cocktail (Roche, Germany). Lysate was used for western blot analysis. The protein content of the lysates was evaluated by the Bradford method using the Bio-Rad protein assay kit (Bio-Rad Laboratories, CA, USA).
Male Sprague-Dawley rats (240–260 g; Harlan, Italy) were used for
Under ketamine and xylazine (43 and 7 mg/kg, intra-peritoneal, i.p.) anesthesia, a glass needle connected to a perfusion pump was implanted in the right dorsal hippocampus using a stereotaxic apparatus for small animals, with the following coordinates: A −1.7; L −1.5; D +3.7 [
Pilocarpine was administered i.p. (340 mg/kg), 30 min after a single subcutaneous injection of methyl-scopolamine (1 mg/kg, to prevent peripheral effects of pilocarpine), and the rats’ behavior was monitored for several hours thereafter, using the scale of Racine [
Brains were removed, immersed in 10% formalin for 48 h and then paraffin embedded. Serial sections of 6 μm were cut with a Microtome (Leica RM2125RT, Germany). In all experiments, adjacent sections were used for different staining procedures.
Sections were dewaxed (2 washes in xylol, 10 min each; 5 min in 100% ethanol, 5 min in 95% ethanol, 5 min in 80% ethanol) and re-hydrated in distilled water for 5 min. All antigens were unmasked using a commercially available kit (Unmasker, Diapath), according to the manufacturer’s instructions. After washing in phosphate buffered saline (PBS), sections were incubated with Triton x-100 (Sigma; 0.3% in PBS 1×, room temperature, 10 min), washed twice in PBS 1×, and incubated with 5% bovine serum albumin (BSA) and 5% serum of the species in which the secondary antibody was produced, for 30 min. They were incubated overnight at 4°C in humid atmosphere with a primary antibody specific for different cellular markers: glial fibrillary acid protein (GFAP; mouse polyclonal, Sigma) 1:100; ionized calcium binding adaptor molecule 1 (IBA-1; rabbit monoclonal, AbCam MA, USA) 1:200; GFP (rabbit polyclonal, Santa Cruz, Texas) 1:50. After 5-min rinses in PBS, sections were incubated with Triton (as above, 30 min), washed in PBS and incubated with a goat anti-mouse Alexa 594 secondary antibody (1:250, Invitrogen) for mouse primary antibodies, or with a goat anti-rabbit, Alexa 488 secondary antibody (1:250; Invitrogen) for rabbit primary antibodies, at room temperature for 3.5 hours. NeuroTrace (1:150) was included in the secondary antibody incubation. After staining, sections were washed in PBS, counterstained with 0.0001% 4’-6-diamidino-2-phenylindole (DAPI) for 15 min, and washed again. Coverslips were mounted using anti fading, water based Gel/Mount (Sigma).
For interferon-beta (IΦN–β)immunohistochemistry, we employed the Dako Cytomation EnVision® + Dual Link System-HRP (DAB+) kit. Adjacent sections were unmasked as described above and, after washing in PBS, were incubated for 10 min at room temperature with Endogenous Enzyme Block to quench endogenous peroxidase activity. Subsequently, they were incubated overnight at 4°C in humid atmosphere with the primary antibody (rabbit polyclonal anti-IFN-β,1:50 dilution, MyBioSource, CA, USA). After 5-min rinses in PBS, sections were incubated for 30 min with Labeled Polymer-HRP [Dako Cytomation EnVision® + Dual Link System-HRP (DAB+)]. Staining was completed by a 5 min incubation with 3,3’-diaminobenzidine (DAB) substrated-chromogen, resulting in a brown staining of the antigen-antibody complex. Finally, coverslips were mounted using a water-based mounting medium (Gel Mount™, Sigma).
The left and right dorsal hippocampi were dissected by cutting the brain coronally using a metallic matrix (Zivic Instruments, PA, USA) up to a level corresponding to plate 38–57 of the rat brain atlas [
Infected MABs and dissected dorsal hippocampal extracts, corresponding to 20 and 30 μg total proteins respectively, were analyzed by Western blotting. Proteins were quantified using the Bradford method using the Bio-Rad protein assay kit (Bio-Rad Laboratories, CA, USA) and a Bio-spectrometer (Eppendorf, Germany). Each sample was diluted in sodium dodecyl sulfate (SDS)-gel loading buffer, boiled for 10 min and centrifuged before loading. Samples were then electrophoretically separated onto a 12% SDS-polyacrylamide gel and transferred to nitrocellulose membranes. After blocking in a buffer (PBS-Tween20) containing 5% dried milk, membranes were incubated with the primary antibody in a buffer containing 2.5% dried milk overnight at 4°C. After three washings, incubations were performed with the secondary antibody in buffer/dried milk at room temperature for 1 h. The pro-BDNF protein was revealed using a rabbit anti-proBDNF monoclonal antibody (AbCam, dilution 1:1000) that is specific for pro-BDNF and does not detect mature BDNF; GFP using a mouse anti-GFP monoclonal antibody (Roche; 1:1000); actin using a rabbit anti-actin monoclonal antibody (Sigma, MO, USA; 1:1000). Mouse monoclonal antibodies were revealed using a goat anti-mouse horseradish peroxidase (HRP)-conjugated secondary antibody (Dako, Denmark; dilution 1:1000) and rabbit monoclonal antibodies by a swine anti-rabbit HRP-conjugated secondary antibody (Dako; dilution 1:3000). The immunocomplexes were detected using the ECL Western blot detection kit (GE Healthcare, NJ, USA) and ChemiDoc™ XRS (Bio-rad) for electronic blot pictures. Quantification was performed using the Image Lab software (Bio-rad).
RNA concentration was determined using a Bio-spectrometer (Eppendorf, Germany). Strand-specific cDNA was synthetized using the cDNA first Strand Superscipt III kit (Invitrogen, USA) according to the manufacturer’s instructions, with minor modifications. Following incubation at 65°C for 5 min in ice, 500 ng total RNA from the tissue samples were reverse-transcribed with specific BDNF-antisense (AS-RT) and GAPDH primers (GAPDH-RT) at a final concentration of 0.1 μM, using the SuperScript III reverse transcriptase, at 55°C for 50 min. The AS-RT primer was designed to be specific to the amplicon sequence of the BDNF antisense mRNA and not to the endogenous BDNF or to the natural antisense BDNF sequence (
(A to D) Infection of mesoangioblast cells (MABs) constitutively expressing BDNF with the BDNF-antisense-GFP amplicon vector at MOI 5. Infection of the cells with amplicon vectors was confirmed by GFP fluorescence (A) and GFP detection on western blot (C). Pro-BDNF expression was analyzed by western blot in the 4 days following infection and pro-BDNF signal was normalized to α-actin for quantification (D). (E to H) Infection of MABs with the BDNF-CT-GFP amplicon vector at MOI 5. Infection of the cells was confirmed by GFP fluorescence (E) and GFP detection on western blot (G). Pro-BDNF expression was analyzed by western blot in the 4 days following infection and pro-BDNF signal was normalized to α-actin for quantification (H). Data in D and H are the mean±SEM of 6 experiments. * p<0.05, **p<0.01, ***p<0.001: ANOVA and post-hoc Dunnett test. Horizontal bars in panels A, B, E and F = 25 μm.
Primers | Sequences | |
---|---|---|
AS-RT | AATAGCATCACAAATTTCACAA | |
GAPDH-RT | TGGTCCAGGGTTTCTTACTC | |
qPCR AS For | AATTCACGCGTGGTACCTCTA | |
qPCR AS Rev | CACTGCATTCTAGTTGTGGTTTG | |
qPCR ratGAPDH For | GGGTGTGAACCACGAGAAAT | |
qPCR ratGAPDH Rev | ACTGTGGTCATGAGCCCTTC |
BDNF-antisense was assessed by qRT-PCR on a Bio-Rad CFX96 Real-Time PCR Detection System (Bio-rad) using SSoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories). Primers were designed using the Prirmer3 Plus Software (
Statistical comparisons of the data were performed using ANOVA and
We developed two silencing strategies to down-regulate BDNF protein level. The antisense strategy targets and degrades the cytoplasmic mRNA pool of BDNF. For this purpose, we generated an amplicon plasmid, pAM2-BDNF-antisense-GFP, that expresses both the mRNA for GFP and the synthetic antisense rat BDNF mRNA (
Following the cloning steps, large purified stocks of 3 corresponding amplicon vectors were produced. The titer of each stock was 9.4×108 t.u./ml, 1.05×109 t.u./ml and 1.05×107 t.u./ml, respectively for BDNF-antisense-GFP, BDNF-CT-GFP and control GFP amplicon vectors. The BDNF-antisense-GFP and BDNF-CT-GFP amplicon vectors contain more than 20 copies of the silencing cassette. As described, we produced each amplicon vector with a GFP expression cassette for monitoring the infection in cells and animals.
The next step was to evaluate the effect of each amplicon vector against BDNF
The same experiment was performed using the BDNF-CT-GFP amplicon vector and, again, we observed a nearly complete cancellation of pro-BDNF expression from MAB cells at 96 h after the injection (
We first explored the toxicity of the amplicon vectors after direct injection in the rat hippocampus. To this aim, we injected 5×105 t.u. of either vector in a volume of 1 μl in the right hippocampus dentate gyrus area of naïve rats and, 5 days after injection, examined gliosis, microcytosis and neuronal loss using GFAP, IBA-1 immunofluorescence and NeuroTrace staining, respectively. Administration of the BDNF-antisense-GFP or of the BDNF-CT-GFP amplicon vectors did not alter the morphology of the hippocampus (
Dentate gyrus (DG) of the dorsal hippocampus injected (ipsilateral) and non-injected (controlateral) with BDNF-antisense-GFP or with BDNF-CT-GFP amplicon vector. Nuclei are marked by DAPI in blue, GFAP-positive astrocytes in red, IBA-1-positive microglia in green and neuronal nuclei are labeled by NeuroTrace in magenta. Horizontal bars = 100 μm.
We also evaluated the interferon response by using IFN-β immunohistochemistry. IFN-β positive cells were detected at the site of injection of BDNF-antisense-GFP, and the majority of these cells appeared to be microglial based on IBA-1 immunofluorescence (
Next, we tested the biological efficiency for down-regulation of BDNF protein levels. To this aim, we decided to employ the pilocarpine model. Intra-peritoneal injection of pilocarpine in rodents provokes generalized seizures leading to a status epilepticus (SE), which drives a massive increase in BDNF levels in the hippocampus [
(A) Representative GFP immunofluorescence in the dorsal hippocampus of a rat at 5 days post injection with the BDNF-antisense-GFP amplicon vector. (B) Quantification of the pro-BDNF signal, normalized to α-actin, 3, 6 and 24 h after pilocarpine status epilepticus induced 5 days after injection of the amplicon vectors in the right dorsal hippocampus. Data in B are the mean±SEM of 4–5 rats per group. * p<0.05, ANOVA and post-hoc Dunnett test. Horizontal bar in A = 250 μm.
Pro-BDNF expression was then measured by western blot in the hippocampus at 3 different time points after SE, and the signal was normalized to α-actin before calculating the ratio between the ipsilateral (right) and contralateral (left) hippocampus. The control GFP amplicon vector did not produce any effect, whereas the low dose (1×104 t.u.) of the BDNF-antisense-GFP amplicon vector exhibited a robust reduction of pro-BDNF protein levels at all time points (
The model system we employed for analysis of
(A) Time to enter convulsive status epilepticus following administration of the different doses of BDNF-antisense-GFP vector. * p<0.05, ANOVA and post-hoc Dunnett test. (B) Mortality of pilocarpine-treated animals injected with the different doses of BDNF-antisense-GFP amplicon vector. Data in are the mean±SEM of 10–14 animals.
In this study, we generated two types of amplicon vectors to locally knock down the levels of BDNF: a classical antisense approach and an approach based on convergent transcription. The latter technology was used for the first time in combination with a viral vector, both
HSV-1-based amplicon particles were generated following a recently described method that produces relatively high titers of vector stocks with reduced amounts of helper virus [
HSV-1 based amplicon vectors also share many useful features of the HSV-1 parent virus [
The two strategies for knocking down
To study the effects of amplicon
Therefore, we decided to test the ability of our vectors to down-regulate BDNF expression in the pilocarpine model system. First, in keeping with previous reports [
Importantly, the knock-down of BDNF levels induced with BDNF-antisense-GFP was sufficient to produce significant behavioral effects, in spite of the fact that it was produced in a part of a single hippocampus and not in the entire epileptogenic area. Moreover, the kind of behavioral results that were obtained are also worth noting, in that they reflect the double-edge pattern of BDNF effects in epileptogenesis. On one hand, consistent with the pro-epileptic effects of BDNF [
In conclusion, this study demonstrates a reliable effect of amplicon vectors in knocking down gene expression. At variance with the CT strategy, which is effective only
Dorsal hippocampus injected (ipsilateral) and non injected (contralateral) with BDNF-antisense-GFP or with BDNF-CT-GFP amplicon vector. Nuclei are marked by DAPI in blue, GFAP-positive astrocytes in red, IBA-1-positive microglia in green and neuronal nuclei are labeled by NeuroTrace in magenta. Horizontal bars = 200 μm (12,5 μm in CA1/CA3 boxes).
(TIF)
Representative sections showing IFN-β immunohistochemistry in the dorsal hippocampus injected with the BDNF-antisense-GFP (left panel, A) or with the BDNF-CT-GFP amplicon vector (right panel, B). In the insert, nuclei are marked in blue by DAPI and IBA-1-positive cells (microglia) are in red. Horizontal bar = 25 μm.
(TIF)
(A) Synthetic antisense BDNF mRNA. (B) Endogenous BDNF mRNA. CDS: coding DNA sequence. UTR: untranslated region. Rev: reverse. For: forward.
(TIF)
(A) Representative GFP immunofluorescence in the dorsal hippocampus of a rat at 5 days post injection with the BDNF-CT-GFP amplicon vector. (B) Quantification of the pro-BDNF signal, normalized to α-actin, 3 h after pilocarpine status epilepticus induced 5 days after injection of the amplicon vectors in the right dorsal hippocampus. (n = 5 animals per group). Horizontal bar in A = 250 μm.
(TIF)
This work has been supported by a grant from the European Community [FP7-PEOPLE-2011-IAPP project 285827 (EPIXCHANGE)] to MS and HB.