The authors have the following interests. Cheuk-Weng Chin is employed by FELDA Agricultural Services Sdn. Bhd and Choo Cheah by ACGT Sdn. Bhd. Support in tissue culture of the palms was provided by: Dr. Hamidah Musa (and her predecessor, Dr. Zaleha Mohd. Mydin) and Ms. Halina Mohd Ramly of Guthrie Biotech Laboratory Sdn Bhd; Dr. Maheran Abu Bakar and Mr. Aw Khoo Teng of FELDA Agricultural Services Sdn Bhd; Dr. Lim Loon Lui of IOI Corporation Bhd; Ms. Ho Yuk Wah formerly from United Plantations Bhd; Dr. Aziah Mohd Yusoff and Ms. Halilah Khafidz of Golden Hope Plantations Bhd; Ms. Suzaini Yahya of Ebor Laboratories; and Ms. Girlie Wong and Ms. Joyce Chong of Applied Agriculture Research Sdn Bhd. Mr. Suhaimi Shamsuddin, oil palm breeder at FELDA, assisted the authors in maintaining the cross and sampling the palms. Part of the work leading to this paper was carried out at Biometris; Dr. Azhar Mohamad allowed the authors to use the ABI3100 genetic analyzer (Applied Biosystems, UK) at Nuclear Malaysia. There are no further patents, products in development or marketed products to declare. This does not alter the authors’ adherence to all the PLOS ONE policies on sharing data and materials, as detailed online in the guide for authors.
Conceived and designed the experiments: NCT JJ ZI CWC SCC SGT RS. Performed the experiments: NCT JN. Analyzed the data: NCT JJ RS. Contributed reagents/materials/analysis tools: ZI CWC JJ RS. Wrote the paper: NCT JJ JN SGT RS.
Current address: ACGT Sdn. Bhd., Bukit Jalil, Kuala Lumpur, Malaysia
Clonal reproduction of oil palm by means of tissue culture is a very inefficient process. Tissue culturability is known to be genotype dependent with some genotypes being more amenable to tissue culture than others. In this study, genetic linkage maps enriched with simple sequence repeat (SSR) markers were developed for
Tissue-cultured oil palm clones are in high demand because of their greater uniformity and higher yields compared to conventional seedling material
However, clonal reproduction of oil palm is beset by a host of challenges and thus requires further improvements to cope with an ever increasing demand. Too long a period in culture can give rise to abnormal ramets, the causes of which are still being investigated. This
Evidence exist that tissue culturability of oil palm has a genetic basis with some genotypes being more amenable to tissue culture than others
In this study, both genomic and EST-SSR markers were generated and mapped to the Ulu Remis Deli
The mapping population (P2) consisted of 87 F1 palms obtained from a cross between Ulu Remis Deli
The general flow of the tissue culture process is described in
Cultures not forming callus (
Both ends of the cabbage and its outer layers were removed except the petioles of frond number 0. All the surfaces were swabbed with absolute alcohol. This was followed by a longitudinal cut to disclose the internal fronds (fronds −3 to −7 or lower) comprising stacks of young leaflets. In order to avoid contamination, about 10 cm at the distal ends of leaflets were discarded and the remaining leaflets were cut into 12 segments of approximately 1.5 cm width. The explants were sterilized in the following steps: i. immersion in a freshly prepared calcium hypochlorite solution (45 g/l) at room temperature for 20 min, ii. rinsing with sterile-distilled water for 10 sec and, iii. dipping in 30 g/l sterile glucose solution before culturing on the modified medium of Murashige and Skoog
In Treatment 1, explants were inoculated at 28±2°C under continuous darkness for three months in 5 mg/l NAA (
Over a period of two years, the callusing rate (CR) and embryogenesis rate (ER) were determined. CR and ER were measured as: CR = (total number of calli formed from
Genomic DNA was extracted from the spear leaves (stored at −80°C) of the 87 progenies and the two parental palms using the modified CTAB method
In this study, SSR primers were mainly obtained from the oil palm SSR collection of MPOB. Additional genomic SSR primer sequences were downloaded from the TropGENE database (
Screening and genotyping of polymorphic SSRs were carried out as described by
Genotype data generated from the SSR analysis were scored based on the segregation profiles 1, 5, 8 and 9 in
RFLP analysis was carried out according to
AFLP markers were generated using three restriction enzyme-combinations:
The SSR data were incorporated into the previous parental data sets consisting of RFLP and AFLP markers. Chi-square analysis was performed to determine markers with distorted segregation at several levels from P<0.0001 to <0.1. Markers showing distorted segregation and missing data were excluded as per the criteria of
Linkage analysis was carried out separately for ENL48 and ML161 using JoinMap® 4.0
Markers of segregation type <hkxhk> were subsequently included with those mapped in the basic maps. The dataset (now including the <hkxhk> markers) was re-analyzed using the regression mapping function in JoinMap® 4.0. Markers were grouped using a recombination frequency threshold of 0.2. The recombination frequencies between markers were transformed into map distances in centiMorgan (cM) using the Haldane mapping function. On each linkage group, the contribution of each marker to the average goodness-of-fit (mean Chi-square) and nearest neighbor fit (N.N. Fit) was inspected to confirm its most likely position in order to get the best possible map. In addition, stability of the marker order on every linkage group was checked by comparing with the parental maps (generated earlier using DH1 format) using MapChart 2.2
The CR was transformed using a log-transformation {
The following analysis was made based on the fact that palms were assigned randomly to eight laboratories. Differences between laboratories and treatments were removed by using a mixed model,
Detection of QTL was carried out using the GenStat QTL library
In the tissue culture of each palm, approximately equal numbers of explants were replicated for culture on Treatments 1 and 2. The exceptions were palm number 87, which had a difference of 92 explants between the two replicates and palm 75 which was unfit for sampling during the period of the research program. The numbers of actual explants for each palm ranged from 412–1,158 depending on the numbers of internal fronds available for tissue culture.
A high variation of CR was observed in Treatment 1∶0–47.2% and in Treatment 2∶0.14–41.7%. For ER which was calculated as the total number of embryoids formed from calli ranged from 0–21.1% in Treatment 1 and 0–45.2% in Treatment 2 (
In this study, the callusing and embryogenesis data were obtained by eight different laboratories, with two different treatments. Therefore, further analysis was carried out to determine if these experimental variables affected the phenotypic data.
LnCR | binER | ordER | ||||
Random effects: | Component | S.E | Component | S.E | Component | S.E |
Labs and palms | 0.963 | 0.160 | 0.108 | 0.028 | 0.382 | 0.096 |
Residuals | 0.060 | 0.009 | 0.118 | 0.018 | 0.369 | 0.057 |
Fixed effects: | Wald statistic | p-value | Wald statistic | p-value | Wald statistic | p-value |
Labs | 35.41 | <0.001 | 17.45 | 0.023 | 18.01 | 0.019 |
Treatments | 0.06 | 0.800 | 0.80 | 0.374 | 1.29 | 0.259 |
Labs | No. ofpalmscultured | LnCR ± S.E | binER ± S.E | ordER ± S.E |
1 | 33 | 1.032±0.137 | 0.318±0.062 | 0.546±0.113 |
2 | 8 | 2.426±0.336 | 0.375±0.140 | 0.563±0.258 |
3 | 8 | 1.617±0.336 | 0.125±0.140 | 0.250±0.258 |
4 | 2 | 2.409±0.697 | 0.250±0.287 | 0.500±0.528 |
5 | 8 | 1.541±0.336 | 0.813±0.140 | 1.563±0.258 |
6 | 8 | 3.017±0.336 | 0.625±0.140 | 1.063±0.258 |
7 | 11 | 1.732±0.281 | 0.500±0.118 | 0.864±0.217 |
8 | 7 | 2.113±0.361 | 0.571±0.150 | 0.929±0.276 |
In this study, a total of 342 polymorphic SSRs were generated from the collection of sequences at MPOB (sEg, sMg, sMo and sMh) and the public database (mEgCIR). The SSRs were scored for polymorphisms based on the profiles by
Subsequently, the SSR data were combined with the existing RFLP and AFLP data sets to generate the genetic map for the parental palms. Previously, we had generated 152 AFLPs and 102 RFLPs for ENL48 and, 272 AFLPs and 165 RFLPs for ML161 inclusive of data reported in
With the addition of SSR markers, the number of markers in ENL48 increased to 425 (152 AFLPs, 102 RFLPs and 171 SSRs) and 702 (272 AFLPs, 165 RFLPs and 265 SSRs) in ML161. In ENL48, 55 markers (49 AFLPs and 6 RFLPs) with ≥10.0% missing data and 12 markers (9 AFLPs, 1 RFLP and 2 SSRs) with severe segregation distortion (p<0.0001) were excluded from further analysis. A majority of the remaining skewed markers showed distorted segregations at p<0.05–0.1 and less than 10.0% at p<0.0005–0.01. Similar criteria were also used to examine the ML161 data set, where 94 markers were excluded (83 AFLPs, 6 RFLPs and 5 SSRs). After removing the severely distorted markers at p<0.0001, the percentage of distortion observed in ML161 was about 2.0%, considerably lower than that (18.0%) in ENL48.
Finally, the data set used for construction of the ENL48 linkage map consisted of 94 AFLPs, 95 RFLPs and 169 SSRs. Of the 358 markers analyzed, 330 were assembled into 23 groups. In order to determine the best position for every marker in a linkage group, the markers contributing to insufficient linkages were also determined and removed. The final map consisted of 148 markers (33 AFLPs, 38 RFLPs and 77 SSRs) in 23 groups (
Markers showing distorted segregation are indicated by asterisk (*) representing significance at p<0.1; (**) p<0.05; (***) p<0.01; (****) p<0.05 and; (******) p<0.0005.
No. | SSR locus | Linkage group | TA (°C) | SSR motif | Accession no. | Putative ID [organism] Blast search was carried out on 12th Oct2012 | |
ENL48 | ML161 | ||||||
1. | sEg00025 | LGD4a | LGP4a | 53 | (TTA)10 | EY397492 |
No significant similarity |
2. | sEg00038 | LGD1 | 52 | (AAT)9 | Pr009947960 |
No significant similarity | |
3. | sEg00047 | LGD12b | LGP12b | 56 | (AT)12 | EY400727 |
Predicted: uncharacterized protein LOC100243686 [ |
4. | sEg00066 | LGD5 | LGP5a | 52 | (AT)8 | EY403542 |
No significant similarity |
5. | sEg00067 | LGD5 | LGP5a | 52 | (TGTA)6 | EY404537 |
No significant similarity |
6. | sEg00068 | LGD5 | LGP5a | 53 | (AT)8 | EY404017 |
No significant similarity |
7. | sEg00086 | LGP10 | 57 | (ATAC)10 | EY407048 |
Predicted: Putative pterin-4-alpha-carbinolamine dehydratase isoform 1 [ |
|
8. | sEg00092 |
LGD9 | LGP9a | 52 | (TATG)6 | EY407741 |
No significant similarity |
9. | sEg00095 | LGP9a | 52 | (TATG)5 | EY405343 |
No significant similarity | |
10. | sEg00098 | LGD4a | LGP4a | 52 | (GGT)6 | EY405527 |
Developmentally regulated GTP-binding protein, putative [ |
11. | sEg00108 | LGP1 | 57 | (CGG)8 | EY408074 |
Histone deacetylase [ |
|
12. | sEg00151 | LGD13 | LGP13 | 57 | (CAG)8 | EY411661 |
Transcription factor [ |
13. | sEg00154 | LGP6 | 57 | (CAG)5 | EY410356 |
Predicted: Transcription factor bHLH96-like [ |
|
14. | sEg00159 | LGP12a | 57 | (AT)9 | EY408671 |
TGA transcription factor [ |
|
15. | sEg00161 | LGD8b | 57 | (AT)15 | EY410342 |
Cytosolic aldehyde dehydrogenase RF2C [ |
|
16. | sEg00175 | LGP1 | 57 | (CT)7gttttttcccctttgttccctggtgaga(TTG)6 | EY413618 |
Uncharacterized protein LOC100502350 precursor [ |
|
17. | sEg00197 |
LGD13 | 59 | (GA)10 | EL684358 |
Predicted: Uncharacterized protein LOC100828466 [ |
|
18. | sEg00203 |
LGD10a | LGP10 | 58 | (CT)7 | EL595513 |
Hypothetical protein SORBIDRAFT_07g019420 [ |
19. | sEg00235 | LGP10 | 51 | (CT)9 | EY409185 |
Putative oxalyl-CoA decarboxylase [ |
|
20. | sEg00236 | LGP1 | 55 | (CT)7 | EY413618 |
Hypothetical protein SORBIDRAFT_10g023220 [ |
|
21. | sMg00009 | LGD2 | LGP2a | 52 | (AT)13 | Pr010615860 |
No significant similarity |
22. | sMg00016 | LGP9b | 52 | (GA)13 | Pr010615861 |
No significant similarity | |
23. | sMg00025 | LGD5 | LGP5a | 52 | (TC)11 | Pr010615864 |
No significant similarity |
24. | sMg00050 | LGP13 | 50 | (TA)17 | Pr010615868 |
No significant similarity | |
25. | sMg00051 | LGD6b | 52 | (CT)7(AGAA)6 | Pr010615869 |
No significant similarity | |
26. | sMg00056 |
LGD11a | LGP11a | 53 | (CT)18 | Pr010615871 |
No significant similarity |
27. | sMg00064 | LGD11b | 52 | (GA)10 | Pr010882584 |
No significant similarity | |
28. | sMg00071 | LGP6 | 54 | (GAA)8GGAG(GCT)13 | Pr010615877 |
No significant similarity | |
29. | sMg00074 |
LGD10a, D14b | 52 | (AGG)9AGCCCAGCCCTCGTCCACCTTTT(GCC)5 | Pr010615878 |
Predicted: |
|
30. | sMg00079 | LGD14a | 54 | (TG)7(AG)11 | Pr010615879 |
No significant similarity | |
31. | sMg00122 | LGD6b | 54 | (AT)18 | Pr010615882 |
No significant similarity | |
32. | sMg00130 | LGD11a | 52 | (TA)14 | Pr010615883 |
No significant similarity | |
33. | sMg00136 | LGP16b | 56 | (AG)11 | Pr010615884 |
No significant similarity | |
34. | sMg00147 | LGP2b | 56 | (AT)11 | Pr010615886 |
No significant similarity | |
35. | sMg00152 | LGD13 | 54 | (AT)13 | Pr010615887 |
No significant similarity | |
36. | sMg00164 | LGD10a | 55 | (TA)12 | Pr010615889 |
No significant similarity | |
37. | sMg00168 | LGD11a | LGP11a | 55 | (CT)11 | Pr010615890 |
No significant similarity |
38. | sMg00172 | LGP15 | 56 | (CT)14 | Pr010615891 |
Predicted protein [ |
|
39. | sMg00175 | LGD7 | 54 | (CGG)10 | Pr010615892 |
||
40. | sMg00188 | LGP13 | 52 | (ACCG)8 | Pr010615894 |
No significant similarity | |
41. | sMg00194 | LGP2a | 54 | (TA)26 | Pr010615897 |
No significant similarity | |
42. | sMg00197 | LGP1 | 56 | (AG)15 | Pr010615898 |
No significant similarity | |
43. | sMg00198 | LGD15 | 56 | (AG)14 | Pr010615899 |
No significant similarity | |
44. | sMg00200 | LGD8b | LGP8b | 60 | (CT)18 | Pr010615900 |
No significant similarity |
45. | sMg00209 | LGP4a | 54 | (GA)14 | Pr010615903 |
No significant similarity | |
46. | sMg00214 | LGP12c | 52 | (AT)14 | Pr010615905 |
No significant similarity | |
47. | sMg00217 | LGD3 | LGP3 | 54 | (GA)16 | Pr010615907 |
No significant similarity |
48. | sMg00220 | LGP13 | 52 | (AT)19 | Pr010615909 |
No significant similarity | |
49. | sMg00222 | LGP7 | 50 | (AG)20 | Pr010615910 |
No significant similarity | |
50. | sMg00223 | LGD8b | 56 | (GA)14 | Pr010615911 |
No significant similarity | |
51. | sMg00225 | LGP8b | 56 | (TC)14 | Pr010615912 |
No significant similarity | |
52. | sMg00228 | LGP8b | 54 | (AT)25 | Pr010615913 |
No significant similarity | |
53. | sMg00232 | LGP12c | 54 | (GA)15 | Pr010615915 |
No significant similarity | |
54. | sMg00235 | LGD2 | LGP2a | 58 | (GA)15 | Pr010615916 |
Predicted: |
55. | sMg00236 | LGD8a | LGP8b | 56 | (TC)18 | Pr010615917 |
No significant similarity |
56. | sMg00259 | LGP16a | 57 | (C)11 | Pr010615923 |
No significant similarity | |
57. | sMg00260 | LGP8a | 57 | (CTG)5 | Pr010615924 |
Predicted: |
|
58. | sMo00007 | LGP2a | 50 | (TA)12 | Pr010615926 |
No significant similarity | |
59. | sMo00020 | LGP2a | 58 | (AG)15 | Pr009947964 |
No significant similarity | |
60. | sMo00027 | LGP15 | 50 | (TC)14 | Pr009947965 |
No significant similarity | |
61. | sMo00043 | LGP5b | 50 | (AG)14 | Pr010615928 |
No significant similarity | |
62. | sMo00051 | LGP3 | 54 | (TA)20 | Pr010615929 |
No significant similarity | |
63. | sMo00054 | LGP1 | 54 | (TA)12 | Pr010615930 |
No significant similarity | |
64. | sMo00056 | LGP12a | 54 | (CT)11 | Pr010615931 |
No significant similarity | |
65. | sMo00061 | LGP12a | 56 | (CT)12 | Pr010615932 |
No significant similarity | |
66. | sMo00063 | LGD14b | 54 | (GA)12 | Pr010615933 |
No significant similarity | |
67. | sMo00071 | LGD1 | LGP1 | 56 | (AG)22 | Pr010615934 |
No significant similarity |
68. | sMo00085 | LGP13 | 56 | (TC)12 | Pr010882585 |
cDNA clone:OSIGCRA119H18, full insert sequence [ |
|
69. | sMo00102 | LGD7 | LGP7 | 53 | (AG)11 | Pr010615939 |
No significant similarity |
70. | sMo00106 | LGP8a | 52 | (CT)20 | Pr010615940 |
No significant similarity | |
71. | sMo00108 | LGP15 | 53 | (AT)19 | Pr010882586 |
Predicted: |
|
72. | sMo00109 | LGP16b | 56 | (TA)23 | Pr010882587 |
No significant similarity | |
73. | sMo00117 | LGP5b | 54 | (AG)14 | Pr010615941 |
No significant similarity | |
74. | sMo00123 | LGP13 | 54 | (TC)12 | Pr010882588 |
No significant similarity | |
75. | sMo00131 | LGD16 | LGP16b | 54 | (TTA)19 | Pr010615943 |
No significant similarity |
76. | sMo00151 | LGP7 | 50 | (TG)6tc(TA)10a(AATAT)5 | Pr010615945 |
No significant similarity | |
77. | sMo00161 | LGP12a | 54 | (TG)8(AG)8 | Pr010317032 |
No significant similarity | |
78. | sMo00170 | LGP7 | 53 | (GA)17 | Pr010615948 |
No significant similarity | |
79. | sMo00182 | LGP1 | 58 | (CTC)5gtctacctccgcctccaccgccaccgcagagccatccttctcttctgcacct(TCC)5 | Pr010615949 |
No significant similarity | |
80. | sMo00196 | LGD13 | 56 | (ACAA)8(ACAT)10(AT)10 | Pr010615950 |
No significant similarity | |
81. | sMo00200 | LGD1 | 57 | (ATAC)6(AT)18 | Pr010615951 |
No significant similarity | |
82. | sMo00208 | LGD15 | LGP15 | 58 | (TC)10 | Pr010615952 |
No significant similarity |
83. | sMo00211 | LGP1 | 57 | (AC)7 | Pr010615953 |
No significant similarity | |
84. | sMo00222 | LGD2 | LGP2a | 57 | (CT)8 | Pr010615956 |
Predicted: |
85. | sMo00234 | LGD8b | 57 | (TC)8 | Pr010615957 |
||
86. | sMo00240 | LGP11a | 57 | (GA)8 | Pr010615958 |
Predicted: |
|
87. | sMo00242 | LGD8b | 51 | (TC)11 | Pr010615959 |
No significant similarity | |
88. | sMo00259 | LGD3 | 56 | (AGA)5 | Pr010615961 |
No significant similarity | |
89. | sMo00270 | LGD7 | LGP7 | 57 | (TTC)6 | Pr010615963 |
No significant similarity |
90. | sMo00274 | LGP2a | 58 | (AGA)5 | Pr010882589 |
No significant similarity | |
91. | sMo00285 | LGD10b | 56 | (ACC)6 | Pr010615964 |
No significant similarity | |
92. | sMo00286 | LGP8b | 57 | (CGG)8 | Pr010615965 |
No significant similarity | |
93. | sMo00289 | LGD14a | 58 | (TGT)8 | Pr010615966 |
No significant similarity | |
94. | sMo00294 | LGD8b | 57 | (ACAT)8 | Pr010615968 |
No significant similarity | |
95. | sMo00302 | LGP6 | 56 | (AG)7 | Pr010615970 |
No significant similarity |
Putative IDs were deduced for the SSR-containing sequences by comparing to the non-redundant protein database (Blastx for EST sequences) and nucleotide database of GenBank (tBlastx for genomic sequences). A threshold score of >80 was used to assign significant similarity.
Two SSR markers were mapped.
SSRs developed from oil palm sequences from NCBI GenBank.
Accession numbers of NCBI GenBank.
Probe Unique Identifiers (PUIDs) of NCBI Probe Database.
No. | RFLP locus | Linkage group | Accession no. | Putative ID [organism] Blast search was carried out on 12th Oct 2012 | |
ENL48 | ML161 | ||||
1 | CA00026B | LGP16b | EY396203 | Aquaporin [ |
|
2 | CA00077 | LGP16a | JK629436 | Hox12, partial [ |
|
3 | CA00095 | LGP4b | JK629437 | Ubiquitin carrier protein [ |
|
4 | CA00184 | LGD8a | LGP8b | GH159163 | Cyclin d, putative [ |
5 | CA00197 | LGP4a | EY396360 |
Predicted: uncharacterized protein LOC100249262 [ |
|
6 | CB00001F | LGP11b | EY396521 | Predicted: heat shock cognate 70 kDa protein-like [ |
|
7 | CB00006F | LGP10 | EY396591 | Predicted: phosphoenolpyruvate/phosphate translocator 2, chloroplastic [ |
|
8 | CB00055F | LGD10b | LGP10 | EY396468 | GST6 protein [ |
9 | CB00142 | LGD3 | JK629438 | Pathogenesis-related protein 10c [ |
|
10 | CB00145 | LGD8b | JK629439 | Hypersensitive-induced response protein [ |
|
11 | CEO02026 | LGP12c | EY398261 | Hypothetical protein SORBIDRAFT_09g002030 [ |
|
12 | CEO02683 | LGD9 | EY397095 | Sucrose synthase1 [ |
|
13 | EO02487 | LGP10 | EY408525 | Pathogenesis-related protein [ |
|
14 | EO02817 | LGP8b | EY410649 | Serine/threonine protein phosphatase PP1 [ |
|
15 | FDA00089 | LGD11c | LGP11b | JK629440 | No significant similarity |
16 | FDB00046 | LGD14a | Failed to sequence | – | |
17 | FDB00074 | LGP6 | JK629441 | No significant similarity | |
18 | FDB00086 | LGP3 | JK629442 | No significant similarity | |
19 | FDB00120 | LGP1 | JK629443 | No significant similarity | |
20 | G00016 | LGP6 | JK629444 | Ribosomal protein L32 [ |
|
21 | G00037 | LGD8b | GH159168 | No significant similarity | |
22 | G00057 | LGP2b | JK629445 | Glyceraldehyde 3-phosphate dehydrogenase [ |
|
23 | G00058 | LGP13 | JK629446 | Predicted: probable polygalacturonase-like [ |
|
24 | G00069 | LGD12a | LGP12a | JK629447 | Os01g0300200 [ |
25 | G00080 | LGP10 | JK629448 | Beta-mannosidase 1 [ |
|
26 | G00122 | LGD11b | JK629449 | Hypothetical protein SORBIDRAFT_01g017570 [ |
|
27 | G00132 | LGD13 | LGP13 | JK629450 | No significant similarity |
28 | G00138A | LGP11a | JK629451 | Ubiquitin-conjugating enzyme E2, putative [ |
|
29 | G00142 | LGD12b | LGP12b | GH159171 | No significant similarity |
30 | G00146 | LGP11b | JK629452 | Putative DIM-like protein [ |
|
31 | G00152 | LGP4a | JK629453 | OMT4 [ |
|
32 | G00158 | LGP6 | JK629454 | Hypothetical protein VITISV_030281 [ |
|
33 | G00163 | LGD16 | LGP16b | JK629455 | 40S ribosomal protein S23 [ |
34 | G00170 | LGD4b | JK629456 | S-adenosylmethionine synthetase 1 [ |
|
35 | G00200 | LGP12a | JK629457 | Translationally controlled tumor protein [ |
|
36 | G00233 | LGP4b | JK629458 | Chain A, crystal structure of highly glycosylated peroxidase from royal palm [ |
|
37 | G00246 | LGP8b | JK629459 | Ubiquitin conjugating enzyme [ |
|
38 | GT00008 | LGD12b | LGP12b | GH159173 | No significant similarity |
39 | K00007 | LGD10a | LGP10 | JK629460 | Ras-related protein RIC1 [ |
40 | K00032A | LGP6 | JK629461 | Predicted: Low quality protein: polyadenylate-binding protein 3 [ |
|
41 | KT00015 | LGD14b | JK629462 | Hypothetical protein SORBIDRAFT_02g028940 [ |
|
42 | KT00029 | LGP8b | JK629463 | Predicted: universal stress protein A-like protein [ |
|
43 | KT00040 | LGD11c | LGP11b | JK629464 | Endochitinase precursor (EC 3.2.1.14) [ |
44 | M00013A | LGD2 | JK629465 | No significant similarity | |
45 | M00020A | LGP14 | JK629466 | No significant similarity | |
46 | ME00051 | LGP10 | JK629467 | No significant similarity | |
47 | MET00004 | LGP8b | JK629468 | Metallothionein-like protein [ |
|
48 | MT00002 | LGP2b | JK629469 | Putative cytochrome c oxidase subunit 6b-1 [ |
|
49 | MT00030 | LGD5 | LGP5a | JK629470 | No significant similarity |
50 | MT00045 | LGP15 | JK629471 | No significant similarity | |
51 | MT00060 | LGD14a | JK629472 | Predicted: Uncharacterized protein LOC100253066 isoform 2 [ |
|
52 | MT00137 | LGD13 | JK629473 | Predicted: Histone H2A-like [ |
|
53 | MT00142 | LGP8b | JK629474 | No significant similarity | |
54 | RD00049 | LGP3 | JK629475 | Pathogenesis-related protein 10c [ |
|
55 | SFB00003 | LGD4b | JK629476 | No significant similarity | |
56 | SFB00012 | LGP5b | JK629477 | No significant similarity | |
57 | SFB00015 | LGP12a | JK629478 | Translationally controlled tumor protein [ |
|
58 | SFB00016 | LGD8b | LGP8b | JK629479 | No significant similarity |
59 | SFB00021 | LGP5b | GH159184 | No significant similarity | |
60 | SFB00022 | LGP12a | JK629480 | No significant similarity | |
61 | SFB00031 | LGP8b | GH159186 | Profilin 2 [ |
|
62 | SFB00039 | LGP5b | GH159189 | No significant similarity | |
63 | SFB00041 | LGD1 | GH159190 | No significant similarity | |
64 | SFB00042 | LGD11c | JK629481 | SK3-type dehydrin [ |
|
65 | SFB00043 | LGP6 | JK629482 | No significant similarity | |
66 | SFB00047 | LGP15 | JK629483 | Cationic peroxidase 2 [ |
|
67 | SFB00054 | LGD12b | LGP12b | GH159191 | Pectinesterase family protein [ |
68 | SFB00062 | LGP2a | GH159193 | Hypothetical protein ARALYDRAFT_899257 [ |
|
69 | SFB00063 | LGD11a | LGP11a | JK629484 | Predicted: 60S ribosomal protein L8 [ |
70 | SFB00066 | LGP12a | JK629485 | Predicted: 60S ribosomal protein L8 [ |
|
71 | SFB00072 | LGP16b | JK629486 | No significant similarity | |
72 | SFB00073 | LGP11a | JK629487 | Hypothetical protein SORBIDRAFT_06g018700 [ |
|
73 | SFB00082 | LGP4a | JK629488 | Ribosomal protein S27 [ |
|
74 | SFB00088 | LGP12c | JK629489 | Metallothionein type 2a-FL [ |
|
75 | SFB00093 | LGD15 | JK629490 | Hypothetical protein SORBIDRAFT_10g028130 [ |
|
76 | SFB00097 | LGP11a | JK629491 | Hypothetical protein SORBIDRAFT_06g018700 [ |
|
77 | SFB00109 | LGD14b | JK629492 | No significant similarity | |
78 | SFB00111 | LGP2a | JK629493 | No significant similarity | |
79 | SFB00118 | LGP3 | JK629494 | Histone H4 [ |
|
80 | SFB00120 | LGD2 | LGP2a | JK629495 | Predicted: pectinesterase inhibitor [ |
81 | SFB00130 | LGP3 | GH159198 | No significant similarity | |
82 | SFB00131 | LGD4b | JK629496 | Ubiquitin [ |
|
83 | SFB00141 | LGD15 | JK629497 | No significant similarity | |
84 | SFB00144 | LGP11b | JK629498 | Putative DIM-like protein [ |
|
85 | SFB00145 | LGD10b | JK629499 | No significant similarity | |
86 | SFB00152 | LGP3 | JK629500 | Metallothionein-like protein [ |
|
87 | SFB00154 | LGD14a | JK629501 | Ubiquitin extension protein-like protein [ |
|
88 | SFB00157 | LGD15 | JK629502 | Histone H2B [ |
|
89 | SFB00167 | LGP12c | JK629503 | Metallothionein-like protein [ |
|
90 | SFB00219 | LGD8b | JK629504 | Ribosomal protein L35A [ |
|
91 | SFB00241 | LGP2a | JK629505 | Histone H4 [ |
|
92 | SFB00243 | LGP12c | JK629506 | No significant similarity | |
93 | SFB00246 | LGD12b | LGP12b | JK629507 | Histone H2A [ |
Putative IDs were deduced for the SSR-containing sequences by comparing to the non-redundant protein database of GenBank (Blastx). A threshold score of >80 was used to assign significant similarity.
Two RFLP markers were mapped.
The individual linkage groups were linked to the map published by
As for ML161, of the 608 markers analyzed, 27 were ungrouped and 341 could not be positioned confidently on the map. The remaining 50 AFLPs, 71 RFLPs and 119 SSRs were assigned to 24 groups. In comparison with ENL48, a denser map was constructed for ML161 with 240 markers spanning a total map length of 1,328.6 cM at an average density of 5.5 cM between markers. Similar to ENL48, the linkage groups were labeled accordingly with ‘P’ representing
The resulting ML161 map was used as second reference map for the ENL48 map by using the co-segregating SSR (from MPOB database) and RFLP markers. This was particularly useful for linking groups between the two parental maps, especially for those that did not have any or with only one mEgCIR marker, such as LGD3, D4a, D5, D7, D10a, D10b, D11a, D11c, D12b, D13, D15 and D16. Using this approach, the alignment of linkage groups between the two parental maps was determined and presented in
A total of 53 co-segregating markers (16 RFLPs and 37 SSRs) were mapped on both the ENL48 and ML161 maps. Theoretically, map integration is possible with at least 2 common co-segregating markers in a group. This would indicate that most of the groups in the two parental maps (D1/P1, D2/P2a, D3/P3, D4a/P4a, D4b/P4b, D5/P5a, D7/P7, D8b/P8b, D10a/P10, D11a/P11a, D11c/P11b, D12b/P12b, D13/P13, D15/P15 and D16/P16b) could be integrated. However, our experience in this study was that the numbers of co-segregating markers were not sufficient to accurately combine the two parental maps. It was observed that in almost all the integrated groups (data not shown), the differences in recombination frequencies between the parents were high (0.3–0.5). This could be due to the markers being sparse in one of the parental linkage groups (in this case, mostly on the ENL48 map).
Two QTLs were detected: each for callogenesis (PLnCR) and embryogenesis (PordER). As shown in
Upper panel shows the QTL profiles at –log10 (P-value) which resulted from interval mapping scanning. The horizontal line shows the genome-wide significant threshold determined by Li and Ji (P = 3.5). Lower panel shows the QTL effects (green square) resulting from multi-trait interactions: QTL on LGD4b was affected by PLnCR (dark blue square) and PordER (light blue square) while; QTL on LGP16b only contains effect from PordER (brown square).
Crosses involving
The height of oil palm makes sampling of its young leaves for culture a challenging task. The process requires skilled workers to climb the palm and harvest the very young spear leaves, which have not yet even emerged, without damaging the apical growing point. Because of the sustained damage, repeat sampling of a palm is only possible after three to five years
Most of the palms were recalcitrant to tissue culture as was to be expected from previous experience on oil palm worldwide. Significant deviation of tissue culture amenity data from normal distribution had also been frequently reported for other crops, such as red clover
The SSRs were developed from both ESTs and genomic libraries of oil palm. Mining of these SSRs was previously reported by
The additional co-segregating SSR markers used in this study are crucial for further saturating and integrating both parental maps. The approach taken was to focus on SSRs rather than RFLPs which are known to be of low throughput and costly. EST-derived SSRs are essentially similar to cDNA RFLP-probes as they are also from the genic regions. The approach was thus appropriate as the EST-SSRs revealed more co-segregating markers (about 38.0%) than the 24.4% obtained by using RFLPs. Previously
The current maps were constructed using very stringent parameters (as described in
The mapping of published SSR markers (mEgCIR) allowed comparison with a published oil palm genetic map. This, in turn, allowed labeling of linkage groups in the current map to match those by
The genome size for
In this study, the numbers of QTLs detected for tissue culture response are within the range reported for rice, barley, wheat, maize, sunflower,
The existing tissue culture laboratories in Malaysia do routinely culture oil palm. The numbers of palms and the different genotypes cultured may allow for association analysis of markers to tissue culturability. This may allow for validation of existing markers linked to the QTLs for CR and ER and/or allow detection of additional QTLs. However, the standardization of phenotype data collection and effect of the different media used by the various laboratories on CR and ER will have to be sorted out before this is possible.
It has been suggested that only a few simply inherited genes are of major importance in the genetics of embryogenesis
Ideally the marker-QTL should be evaluated in other independent crosses of oil palm. This had been done for barley with common QTLs associated with callus growth detected across four populations by
Subject to confirmation of the QTLs in other mapping populations or genotypes, they could be important for selecting ortets to be cultured. Unlike expressed traits (e.g. yield and height), tissue culture amenity remains unknown until the palms are actually cloned. Furthermore, some high yielding palms have at times failed to be cultured. The availability of markers linked to tissue culturability can facilitate the cloning of such palms where, the favorable alleles can be incorporated into the progenies of these palms through marker assisted selection (MAS), and the progenies then cloned. As the markers for yield are becoming available for oil palm
Although the production of oil palm clones has increased, this has more to do with more laboratories entering the fray than a real improvement of the tissue culture process
(TIF)
(TIF)
(DOC)
(DOC)
The authors would like to thank the Director-General of MPOB for the permission to publish this paper. We would also like to thank the tissue culturists from the various oil palm agencies, namely, Dr. Hamidah Musa (and her predecessor, Dr. Zaleha Mohd Mydin) and Ms. Halina Mohd Ramly of Guthrie Biotech Laboratory Sdn Bhd; Dr. Maheran Abu Bakar and Mr. Aw Khoo Teng of FELDA Agricultural Services Sdn Bhd; Dr. Lim Loon Lui of IOI Corporation Bhd; Ms. Ho Yuk Wah formerly from United Plantations Bhd; Dr. Aziah Mohd Yusoff and Ms. Halilah Khafidz of Golden Hope Plantations Bhd; Ms. Suzaini Yahya of Ebor Laboratories; and Ms. Girlie Wong and Ms. Joyce Chong of Applied Agriculture Research Sdn Bhd, for their support in tissue culturing the palms. Guthrie Biotech Laboratory Sdn Bhd, Golden Hope Plantations Bhd and Ebor Laboratories are now part of Sime Darby Berhad. We would also like to extend our appreciation to Mr. Suhaimi Shamsuddin, oil palm breeder at FELDA, for his assistance in maintaining the cross and sampling the palms. Part of the work leading to this paper was carried out at Biometris, Wageningen University and Research Centre, the Netherlands. We would like to thank Dr. Azhar Mohamad for his kindness in allowing us to use the ABI3100 genetic analyzer (Applied Biosystems, UK) at the Malaysian Nuclear Agency. We would also like to extend our appreciation to Mr. Andy Kwong Choong Chang for his valuable comments on this manuscript.