http://orcid.org/0000-0002-1866-0731
Figures
Abstract
Chagas disease, caused by the parasite Trypanosoma cruzi, develops into chronic Chagas’ cardiomyopathy in ~30% of infected individuals, characterized by conduction disorders, arrhythmias, heart failure, and even sudden cardiac death. Current anti-parasitic treatments are plagued by significant side effects and poor efficacy in the chronic phase of disease; thus, there is a pressing need for new treatment options. A therapeutic vaccine could bolster the protective TH1-mediated immune response, thereby slowing or halting the progression of chronic Chagas’ cardiomyopathy. Prior work in mice has demonstrated therapeutic efficacy of a Tc24 recombinant protein vaccine in the acute phase of Chagas disease. However, it is anticipated that humans will be vaccinated therapeutically when in the chronic phase of disease. This study investigates the therapeutic efficacy of a vaccine prototype containing recombinant protein Tc24, formulated with an emulsion containing the Toll-like receptor 4 agonist E6020 as an immunomodulatory adjuvant in a mouse model of chronic T. cruzi infection. Among outbred ICR mice vaccinated during chronic T. cruzi infection, there is a significant increase in the number of animals with undetectable systemic parasitemia (60% of vaccinated mice compared to 0% in the sham vaccine control group), and a two-fold reduction in cardiac fibrosis over the control group. The vaccinated mice produce a robust protective TH1-biased immune response to the vaccine, as demonstrated by a significant increase in antigen-specific IFNγ-production, the number of antigen-specific IFNγ-producing cells, and IgG2a antibody titers. Importantly, therapeutic vaccination significantly reduced cardiac fibrosis in chronically infected mice. This is a first study demonstrating therapeutic efficacy of the prototype Tc24 recombinant protein and E6020 stable emulsion vaccine against cardiac fibrosis in a mouse model of chronic T. cruzi infection.
Author summary
Chagas disease is a parasitic infection that can cause severe heart disease. Current treatments do not work well and have significant side effects. Because of this, the authors created a new vaccine prototype with the goal that it could be given to infected people to prevent Chagas-associated heart disease. The vaccine contains a manufactured protein identical to a protein in the parasite (called Tc24) as well as a component to help the body produce a protective immune response (a vaccine adjuvant called E6020). The vaccine would boost the body’s natural immune response to the parasite infection, reducing the number of parasites in the body, and protecting the heart. Frequently, people are not diagnosed until later in the infection, because the early (or acute) stage of disease can be mistaken for a common cold. Because of this, it is important to test the vaccine when given in the later (or chronic) stage of infection. The authors tested the vaccine in a mouse model of chronic T. cruzi infection and found that the vaccinated mice had lower levels of parasites in their body and less damage to their hearts. This research shows promising value of a therapeutic vaccine to prevent Chagas-associated heart disease in a mouse model, with the hope that the same effect could be found in humans one day.
Citation: Barry MA, Versteeg L, Wang Q, Pollet J, Zhan B, Gusovsky F, et al. (2019) A therapeutic vaccine prototype induces protective immunity and reduces cardiac fibrosis in a mouse model of chronic Trypanosoma cruzi infection. PLoS Negl Trop Dis 13(5): e0007413. https://doi.org/10.1371/journal.pntd.0007413
Editor: Helton da Costa Santiago, Universidade Federal de Minas Gerais, BRAZIL
Received: October 15, 2018; Accepted: April 25, 2019; Published: May 30, 2019
Copyright: © 2019 Barry et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the manuscript.
Funding: This work was funded by the Carlos Slim Foundation (http://fundacioncarlosslim.org/english/salud/) and the the Global Health Innovation Technology Fund (G2014-002)(https://www.ghitfund.org/). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors are involved in the development of a vaccine that would protect humans against Chagas disease. FG is employed at Eisai Inc, which intends to advance E6020 as a vaccine adjuvant.
Introduction
Chagas disease, caused by infection with the protozoan parasite Trypanosoma cruzi, is a leading neglected tropical disease globally [1], and the cause of Chagas’ cardiomyopathy, the most common form of non-ischemic cardiomyopathy in Latin America [2]. An estimated 7.2 million people are infected with Chagas disease, with 180,000 new cases occurring annually [3]. Chagas disease is responsible for over $7 billion in lost productivity and health care costs annually [4]. Chagas disease is characterized by two clinically distinct phases of disease: acute and chronic. Acute disease is most often a self-limiting febrile illness, however up to 5% of cases develop severe disease including acute myocarditis, pericardial effusion, and meningoencephalitis, with an estimated 0.5% risk of mortality [5, 6]. In chronic disease, 10–30 years after infection, 30% of patients develop chronic cardiomyopathy [2].
Chronic Chagas’ cardiomyopathy (CCC) clinically presents as conduction disorders and malignant arrhythmias, which can then progress to cardiomyopathy, heart failure, and even sudden cardiac death [7]. The disease is characterized histologically by post-inflammatory myocardial fibrosis [8], and human studies have shown that systemic parasite persistence is associated with disease severity [9, 10]. Clinical progression and survival are poorer in patients with CCC compared to patients with noninflammatory dilated cardiomyopathy, and myocardial fibrosis has been shown to be an independent predictor of adverse outcomes in CCC [11] [12]. The annual mortality of CCC is 4% [13]. In Latin America, an estimated 1.17 million people suffer from CCC [1], and it is the leading cause of cardiovascular death in people aged 30–50 [14].
Current pharmacological treatments (nifurtimox and benznidazole) have inadequate efficacy beyond the acute phase of disease, as demonstrated by the recent BENEFIT trial [15]. Additionally, both drugs have a significant side effect profile in up to 50% of patients, most frequently gastrointestinal distress, cutaneous hypersensitivity reactions, and neurological symptoms [16]. In the quest to develop new therapeutics, vaccines offer an attractive solution. Production of the cytokine IFNγ by CD8+ T cells has been correlated with less severe cardiac disease [17]; therefore, a therapeutic vaccine which bolsters the TH1-mediated CD8+ T cell immune response to the infection, might slow or halt the progression of disease [18]. A therapeutic vaccine would be highly cost effective as demonstrated by economic modeling [19].
A promising antigen target is the T. cruzi 24kDa flagellar Ca2+ binding protein (Tc24) [20]. In humans, recombinant Tc24 is already utilized for serodiagnosis of Chagas disease and to monitor treatment response [21, 22]. Early studies of a DNA vaccine encoding Tc24 have demonstrated therapeutic benefit in mice [23, 24], showing high levels of antigen-specific IFNγ+ CD8+ cells, and protecting against parasitemia and cardiac pathology [25]. As a recombinant protein vaccine, Tc24 has shown prophylactic efficacy in mice when formulated with the Toll-like receptor 4 (TLR4) agonist monophosphoryl lipid A [26]. More recently, nanoparticle-encapsulated Tc24 with the TLR9 agonist CpG oligodeoxynucleotides has shown therapeutic efficacy in the acute phase of disease [27]. However, little is known about the protective efficacy of a Tc24 recombinant protein vaccine in the chronic stage of Chagas disease.
In this study, we utilize the TLR4 agonist E6020, mixed into a squalene based stable oil-in-water emulsion, to modulate the immune response alongside recombinant Tc24. E6020 is a synthetic lipid A derivative that has reduced pyrogenicity, while maintaining immunogenicity. E6020 has been proposed as a safe and cost-effective vaccine adjuvant [28], and has been demonstrated to be effective in mouse models of a meningococcus vaccine and toxic shock syndrome [29, 30]. E6020 has previously been proposed as an adjuvant for a Chagas disease vaccine [31], and has demonstrated high levels of antigen-specific IFNγ when combined with recombinant Tc24 and protected from blood and tissue parasite burdens in the acute stage of a mouse model of T. cruzi infection [32, 33]. Here, we investigate the TH1-mediated IFNγ+ immune response elicited by a Tc24 recombinant protein in a stable emulsion (SE) E6020 vaccine (Tc24+E6020-SE) and the resulting therapeutic efficacy in a mouse model of chronic T. cruzi infection.
Results
Vaccination protects from cardiac pathology and systemic parasitemia
In order to evaluate the therapeutic efficacy of the prototype Tc24+E6020-SE vaccine in mice in the chronic stage of T. cruzi infection, we investigated cardiac pathology and persistence of systemic parasitemia post-vaccination. Mice were infected with T. cruzi and allowed to progress past the acute phase of disease, characterized by elevated parasitemia resolving by 40 days post-infection (Fig 1A), before vaccination at 70 days post-infection with Tc24+E6020-SE or a sham vaccine. T. cruzi infected mice vaccinated with Tc24+E6020-SE vaccine were significantly more likely to have undetectable systemic parasitemia at all measured time points post-vaccination, compared to mice in the sham control group (Fig 1B). Additionally, the therapeutically vaccinated mice had significantly reduced cardiac fibrosis, with an average of 2.5% area of cardiac fibrosis compared to an average of 5% area of cardiac fibrosis in the sham vaccinated control group, as evidenced by analyzing histologic sections of the heart stained for collagen using Masson’s Trichrome (Fig 2). Overall, inflammatory cell infiltrate in the heart was low, approximately 1200 nuclei/mm2 in sham vaccinated mice, but there was a slight reduction in vaccinated mice compared to the sham control group when analyzing histologic sections of the heart stained using H&E (Fig 3). We conclude that the Tc24+E6020-SE vaccine is protective against detectable systemic parasitemia and cardiac fibrosis in chronic T. cruzi infection.
ICR mice were infected with T. cruzi H1 strain parasites. (A) Parasitemia was then measured twice weekly by quantitative real-time PCR through the acute phase of infection. Mice were then subsequently immunized in the early chronic stage of infection in a prime boost model at 70 and 98 days post-infection. The Tc24+E6020-SE vaccine was compared to a sham vaccine group and an uninfected control. Parasitemia in the blood was then measured at five times post-vaccination in the chronic phase of infection (at 77, 98, 115, 140, and 180 days post-infection). (B) Data shown represents the percentage of mice in each group that remained with undetectable systemic parasitemia at all time points post-vaccination (n = 9–10). Significance between the vaccine and the sham was calculated using Fischer’s exact test.
ICR mice were vaccinated with Tc24+E6020-SE vaccine at 70 days post-infection in a prime-boost model, with 4 weeks between prime and boost. The vaccine was compared to a sham vaccine group and an uninfected control. At 180 days post-infection, the hearts were removed, stained with Masson’s Trichrome, and assessed for degree of cardiac fibrosis. (A) Quantification of the percentage of area occupied by fibrosis in the cardiac tissue over 30 representative fields of view. Each point represents an individual mouse (n = 9–10); horizontal lines denote median values; significance was calculated by Kruskal-Wallis test with Dunn’s correction for multiple comparisons. Representative sections of a heart from (B) a vaccinated mouse, (C) a mouse in the sham vaccine group; magnification bar denotes 200 μm.
ICR mice were vaccinated with Tc24+E6020-SE vaccine at 70 days post-infection in a prime-boost model, with 4 weeks between prime and boost. The vaccine was compared to a sham vaccine group and an uninfected control. At 180 days post-infection, the hearts were removed, stained with H&E, and assessed for inflammation. (A) Quantification of the number of nuclei in sections of cardiac tissue over 10 representative fields of view. Each point represents an individual mouse (n = 9–10); horizontal lines denote median values; significance was calculated by Mann-Whitney test comparing each group to the sham vaccinated group. Representative sections of a heart from (B) a vaccinated mouse, (C) a mouse in the sham vaccine group; magnification bar denotes 200 μm.
Tc24+E6020-SE vaccine induces an IFNγ TH1-biased immune response
To characterize the immune response of the vaccine, both antigen-specific IFNγ production and antibody titers were assessed in uninfected mice immunized with the Tc24+E6020-SE vaccine. The vaccine elicits a greater than 5-fold increase in Tc24-specific secreted IFNγ compared to the Tc24 control (Fig 4). IgG2a, a mouse antibody isotype associated with a TH1-bias, is most robust in the vaccine compared to the controls (Fig 5A), further validating the cytokine results. In comparison, both the Tc24+E6020-SE vaccine and the Tc24 control produce a robust IgG1 antibody response (Fig 5B). These results indicate that the Tc24 recombinant protein is capable of producing an antigen-specific immune response, but that the E6020-SE adjuvant is necessary to induce a favorable TH1-biasing of the resulting immune response.
Uninfected ICR mice were vaccinated in a prime-boost model, with 2 weeks between prime and boost. The Tc24+E6020-SE vaccine was compared to control groups with only Tc24 or only E6020-SE. Two weeks after the boost vaccination, the Tc24-specific IFNγ producing lymphocyte response was assessed by ELISA. Data shown here is background subtracted; each point represents an individual mouse (n = 9–10); horizontal lines denote median values; significance calculated by Kruskal-Wallis test with Dunn’s correction for multiple comparisons.
Uninfected ICR mice were vaccinated in a prime-boost model, with 2 weeks between prime and boost. The Tc24+E6020-SE vaccine was compared to control groups with only Tc24 or only E6020-SE. Two weeks after the boost vaccination, the antigen-specific antibody response was assessed by ELISA. (A) Tc24-specific IgG2a antibody titer, a TH1-associated antibody isotype. (B) Tc24-specific IgG1 antibody titer. Each point represents an individual mouse (n = 9–10); horizontal lines denote median values; significance was calculated by one-way ANOVA with Tukey’s correction for multiple comparisons on log transformed data.
Vaccine induces protective TH1-biased immune response in chronic disease
The protective immune response resulting in therapeutic efficacy was then investigated in mice in the chronic stage of T. cruzi infection, by characterizing both antigen-specific TH1- and TH2-associated cytokine production, as well as antibody titers. T. cruzi infected mice vaccinated with the Tc24+E6020-SE vaccine at 70 days post-infection have a two-fold increase in Tc24-specific IFNγ producing cells compared to the sham control group (Fig 6A). Additionally, they have a six-fold increase in Tc24-specific secreted IFNγ compared to the sham control group (Fig 6B), but no significant difference in Tc24-specific secreted IL-4, a TH2-associated cytokine (Fig 6C). Comparing the ratio of IFNγ to IL-4 in order to determine the extent to which the immune response is TH1-biased, the Tc24+E6020-SE vaccine produces a three-fold larger IFNγ/IL-4 ratio compared to the sham control group (Fig 6D). Tc24-specific antibody isotype titers further corroborate the cytokine results demonstrating a favorable TH1-biased immune response. The Tc24+E6020-SE vaccine produces a significantly greater IgG2a antibody isotype response compared to the sham (Fig 7A), as well as an overall robust IgG1 antibody response (Fig 7B). These results demonstrate that the Tc24+E6020-SE vaccine produces a robust TH1-biased immune response in T. cruzi-infected mice vaccinated in the chronic stage of T. cruzi infection.
ICR mice were vaccinated at 70 days post-infection in a prime-boost model, with 4 weeks between prime and boost. The Tc24+E6020-SE vaccine was compared to a sham vaccine group and an uninfected control. At 180 days post-infection, the antigen-specific cytokine response was assessed. (A) Tc24-specific IFNγ producing lymphocytes as assessed by ELISPOT. (B) Tc24-specific IFNγ secreted by lymphocytes as assessed by ELISA. (C) Tc24-specific IL-4 secreted by lymphocytes as assessed by ELISA. (D) TH1-biasing of the immune response as determined by the ratio of Tc24-specific secreted IFNγ to IL-4. Data shown here is background subtracted; each point represents an individual mouse (n = 9–10); horizontal lines denote median values; significance shown only between the vaccine and the sham groups and was calculated using the Mann–Whitney U test.
ICR mice were vaccinated at 70 days post-infection in a prime-boost model, with 4 weeks between prime and boost. The Tc24+E6020-SE vaccine was compared to a sham vaccine group and an uninfected control. At 180 days post-infection, the antigen-specific antibody response was assessed by ELISA. (A) Tc24-specific IgG2a antibody titer, a TH1-associated antibody isotype. (B) Tc24-specific IgG1 antibody titer. Each point represents an individual mouse (n = 9–10); horizontal lines denote median values; significance shown only between the vaccine and the sham groups and was calculated by one-way ANOVA with Tukey’s correction for multiple comparisons on log transformed data.
Discussion
This work is a stride towards the development of a therapeutic Chagas disease vaccine that seeks to prevent or delay the onset of CCC in patients infected with T. cruzi [31]. Prior studies by this group have shown therapeutic efficacy of Tc24 protein vaccines in a mouse model of acute T. cruzi infection as evidenced by a reduction in both systemic parasitemia and cardiac parasite burden, and protection from cardiac inflammation [27, 32, 33]. However, it is anticipated that humans will be diagnosed and vaccinated in the chronic stage of disease, as the acute phase of disease is often asymptomatic or a self-limiting febrile illness [31]. Therefore, it is critical to investigate therapeutic vaccine candidates in a model of chronic T. cruzi infection to more closely replicate the proposed clinical vaccination strategy. Prior studies of a therapeutic Tc24 DNA vaccine administered at 70 days post-infection in the early chronic phase of disease in a mouse model of Chagas disease, similar to the model utilized here, showed improved survival and reduced cardiac inflammation [23]. More recently, an adenovirus-based therapeutic vaccine demonstrated improvements in cardiac histopathology and electrical conduction abnormalities as markers of reduction in CCC disease progression, similar to outcomes measured in this study [34]. However, while precedent exists for licensure of recombinant protein vaccines in humans, no DNA or adenovirus-based vaccines have progressed to market. This is the first study that demonstrates therapeutic efficacy of a Tc24 recombinant protein-based vaccine in a mouse model of chronic T. cruzi infection.
In this study, we show that a Tc24 recombinant protein vaccine with a stable emulsion containing E6020 as an immunomodulatory adjuvant results in a statistically significant reduction in cardiac fibrosis and inflammation in vaccinated mice compared to mice receiving the sham vaccination. This reduction in cardiac fibrosis is evidence of vaccine protection from chronic Chagas’ cardiomyopathy, as supported by studies that show the cardiac disease is characterized by inflammatory infiltrate and extensive reactive and reparative fibrosis [8, 35, 36]. Additionally, the Tc24+E6020-SE vaccine results in a reduction in detectable systemic parasitemia in vaccinated mice. We propose this reduction and subsequent decrease in parasite-driven tissue damage is one mechanism by which fibrosis is prevented. These findings are supported by studies in human showing systemic parasite persistence is associated with CCC and disease severity [9, 10]. We conclude that the Tc24+E6020-SE vaccine is protective from myocardial fibrosis when used therapeutically in a mouse model of chronic T. cruzi infection.
A key challenge in the development of this vaccine is the induction of the necessary immune response; unlike most vaccines that rely on an antibody-mediated immune response, a Chagas vaccine will require a protective cell-mediated immune response to be efficacious against the parasite. In this study, to elicit a protective TH1-mediated IFNγ+ immune response we combined a previously validated protein antigen, Tc24, with a stable emulsion of E6020 as an immunomodulatory adjuvant. In this study, the Tc24+E6020-SE vaccine produces a robust TH1-biased immune response, as measured by cytokine and antibody production, in both uninfected ICR mice and ICR mice in the chronic stage of T. cruzi infection. Our findings of a robust TH1-biased immune response are consistent with our previous observations using this adjuvant in other mouse models [32, 33]. In contrast to Aluminum hydroxide vaccine adjuvants (such as Alhydrogel), the adjuvant type utilized in 80% of currently licensed vaccines that produces a predominantly TH2-skewed immune response, [37, 38] E6020 preferentially induces a TH1-skewed immune response through the TLR4 pathway [39]. It is key to note that chronically infected humans have high serum levels of circulating pro-inflammatory cytokines, including IFNγ, IL-6, TNFα and IL-1β [40], as well as antigen specific pro-inflammatory cells [17]. In pre-clinical models it has been demonstrated that T. cruzi derived glycoinositolphospholipid (GIPL) is a potent agonist of the TLR4 receptor, enhancing production of TNFα and MIP while increasing neutrophil recruitment, and conferring some resistance to T. cruzi infection [41]. However, TLR4 receptor engagement by GIPL does not provide long term benefit on disease pathogenesis as wild type TLR4 mice still succumb to infection, although at a later time than TLR4 deficient mice [41]. Additionally, GIPL has been shown to have immunomodulatory effects, downregulating IL-2 production and proliferation of T cells in a reversible manner, since removal of GIPL restores T cell proliferation to baseline levels [42]. Further, GIPL downregulates costimulatory molecule expression on APCs, including macrophages and dendritic cells [43]. These data indicate that while T. cruzi derived GIPL induces pro-inflammatory responses via TLR4 receptor engagement, it plays a larger role in subverting the immune response. In the face of T. cruzi derived GIPL being present in chronically infected mice, we hypothesize that the TLR4 agonist E6020 is a more potent stimulator of the TLR4 receptor, similar to LPS which has been shown to induce increased TNFα both locally and systemically, and for a longer duration, when compared to GIPL [41]. E6020 has been shown to have a promising safety profile based on studies in animal models [44]. Precedent exists for utilizing a TLR4 agonist in humans: the licensed vaccines Fendrix, for the prevention of hepatitis B, and Cervarix, the HPV vaccine, both utilize the TLR4 agonist monophosphoryl lipid A [45]. Compared with monophosphoryl lipid A, E6020 has a simplified structure, replacing the typical disaccharide backbone with a simple hexa-acylated acyclic backbone, allowing for faster compound synthesis and improved yield of high-purity material [28, 46].
While small animal models do not mimic all aspects of human Chagas disease, the mouse model described here developed significant cardiac fibrosis, which is a key component of CCC [11, 47]. In the model described in this manuscript mice developed significant cardiac fibrosis, which is a hallmark of chronic determinate disease in humans [35, 48]. Further, it has been shown that up to 72% of patients in the clinically silent chronic indeterminate phase have evidence of cardiac fibrosis [49], thus the mouse model described here does mimic a key component of human disease and can be used to screen novel therapies for efficacy prior to advancing to human studies. One limitation of this model is the overall low level of cardiac inflammation, which is a key finding in human cases of CCC [47]. Here we showed that infected sham vaccinated outbred ICR mice had an average inflammatory infiltrate of approximately 1200 nuclei per mm2 tissue (Fig 3), which is very low compared to our prior studies showing approximately 6000 nuclei per mm2 tissue in acutely infected inbred BALB/c mice [50]. This difference in cardiac pathology depending on mouse genetic background mimics the differences in cardiac inflammation found by Pereira and colleagues who showed that C3H mice had much greater cardiac inflammation when compared to C57BL/6 mice when both were infected with the Colombian T. cruzi strain [51]. However, despite the comparatively low cardiac inflammation, infected C57BL/6 mice did develop significant cardiac fibrosis which the authors concluded represented a mild CCC phenotype [51]. In the outbred ICR model of chronic T. cruzi H1 infection we report in this manuscript, we do see significant cardiac fibrosis where the infected untreated mice had an average of 5.0% fibrotic area compared to 1% in naïve age matched controls (Fig 2), demonstrating that this model does mimic the significant cardiac fibrosis seen in human disease and is useful for evaluating the effect of novel therapies for reducing cardiac fibrosis. Further, this finding of significant cardiac fibrosis in the outbred ICR model of chronic infection supports our previously published finding of significant cardiac fibrosis in acutely infected inbred BALB/c mice (2%) compared to age matched uninfected controls (~0.5%) [52]. Thus, while we predict that our findings of vaccine induced immunogenicity and therapeutic efficacy against cardiac fibrosis in a mouse model of chronic T. cruzi infection will be translatable to humans, additional studies in other models that develop CCC more characteristic of human disease, such as non-human primates, will be necessary before the vaccine can be moved into clinical trials.
In the quest to develop a therapeutic vaccine against Chagas disease, only limited work has been conducted using therapeutic recombinant protein vaccine prototypes in the chronic stage of T. cruzi infection. This is the first reported study of a therapeutic vaccine utilizing Tc24 protein and a stable emulsion of E6020 as an immunomodulatory adjuvant in a mouse model of chronic T. cruzi infection. It is also an important proof of principle study that a vaccine administered in the chronic stage of disease reduces parasitemia and myocardial fibrosis, and may thus slow chronic Chagas’ cardiomyopathy disease progression. Ultimately, a vaccine-linked chemotherapy strategy may be employed in Chagas disease treatment, in which the vaccine is paired with reduced-dose chemotherapy to increase efficacy and reduce side effects [31, 33]. Future studies could elucidate the efficacy of this strategy utilizing the Tc24+E6020-SE vaccine. Additionally, scale-up production of the Tc24 recombinant protein (modified to avoid or limit intermolecular disulfide bond formation and aggregation) suitable for non-human primate or human testing is in process [32, 53]. In conclusion, the Tc24+E6020-SE vaccine demonstrates robust TH1-biased immunogenicity, decreased systemic parasitemia, and protection from chronic myocardial fibrosis in a mouse model of chronic T. cruzi infection.
Methods
Ethics statement
All studies were approved by the Institutional Animal Care and Use Committee of Baylor College of Medicine (Protocol AN-5973), Assurance numbers D16-00475 (current) and 3823–01 (previous) and were performed in strict compliance with The Guide for the Care and Use of Laboratory Animals (8th Edition)[54].
Protein production and vaccine formulation
Recombinant Tc24 protein was expressed in an E. coli system and purified with Ni-column chromatography as has been described previously. [26, 27] Briefly, codon-optimized DNA encoding full-length Tc24 from a Yucatan H1-strain of T. cruzi was cloned into a pET41a E. coli expression vector (EMD Millipore, 70556) with deleted fusion GST (NdeI/XhoI). The resulting plasmid DNA was transformed into BL21(DE3) cells (EMD Millipore, 69450) and induced with IPTG for protein production. The recombinant Tc24 was purified with IMAC Ni-column chromatography (GE Healthcare, Little Chalfont, United Kingdom), and then endotoxin contamination was removed with Q column purification (GE Healthcare, Little Chalfont, United Kingdom).
The synthetically produced TLR4 agonist E6020 was obtained from Eisai Inc., Andover, MA, mixed into a stable oil-in-water emulsion (1mg/mL E6020, 5% Squalene, 0.92% D-α-Tocopherol polyethylene glycol 1000 succinate, 0.76% Span 80) in PBS (E6020-SE). The Tc24 protein sample, also in PBS, and E6020 adjuvant were mixed in a 1:1 ratio at bedside, immediately before injection (Tc24+E6020-SE). For all experiments, 0.1mL of the final formulation was injected subcutaneously. In the study assessing therapeutic efficacy in chronic disease, the Tc24+E6020-SE vaccine contained 100μg Tc24 and 25μg E6020 and the sham contained only PBS. In the immunogenicity study, the Tc24+E6020-SE vaccine contained 25μg Tc24 and 5μg E6020, a Tc24 control contained only 25μg Tc24 and an E6020-SE control contained only 5μg E6020. The sham vaccine group contained only PBS (Corning 21-040-CV).
Mice, infection, and immunization
Female ICR mice (Taconic Biosciences), aged 6–8 weeks, were used in all experiments. Animal experiments were performed in full compliance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, 8th edition, under a protocol approved by Baylor College of Medicine’s Institutional Animal Care and Use Committee (IACUC), assurance numbers 3823–01 and D16-00475. Two studies were conducted, one investigating the vaccine efficacy and immunology in mice chronically infected with T. cruzi, and a second study elucidating the immune response to the vaccine in uninfected mice.
T. cruzi H1 strain parasites, previously isolated from a human case in Yucatan, Mexico, [23, 55] were maintained by serial passage in mice. To test therapeutic efficacy of the vaccine, naïve mice were infected intraperitoneally with 500 trypomastigotes then subsequently immunized in a prime boost model with vaccine or sham. The mice were first immunized subcutaneously at 70 days post-infection, and then a boost vaccination was administered four weeks later at 98 days post-infection. Mice were sacrificed at 180 days post-infection.
For the immunogenicity study, mice were vaccinated in a prime boost model subcutaneously with vaccine, control groups, or sham, and then a boost vaccination was administered two weeks later. Mice were sacrificed two weeks after the boost vaccination. At the conclusion of both studies, mice were humanely euthanized using ketamine/xylazine-induced deep anesthesia followed by cervical dislocation and then blood, spleens, and hearts were collected. Throughout the studies, all efforts were made to minimize suffering.
Evaluation of parasitemia
Blood was collected from infected mice semi-weekly through the acute phase of disease and then at five time points post-vaccination in the chronic phase of disease (at 77, 98, 115, 140, and 180 days post-infection). Total DNA was isolated from blood using a DNEasy 96 blood and tissue kit (Qiagen, 69581). Parasitemia was assessed by quantitative real-time PCR as previously described [27]. Briefly, PCR was performed using 10ng purified DNA, TaqMan Fast Advanced Master Mix (Life Technologies, 4444557), and oligonucleotides specific for the satellite region of T. cruzi nuclear DNA (primers 5’ ASTCGGCTGATCGTTTTCGA 3’ and 5’ AATTCCTCCAAGCAGCGGATA 3’, probe 5’ 6-FAM CACACACTGGACACCAA MGB 3’, Life Technologies, 4304972, 4316032) [56, 57]. Data were normalized to GAPDH (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’ GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’, Life Technologies, 4304972, 4316032) [58], and parasite equivalents were calculated from a standard curve [27, 59, 60].
Cytokine production
For cytokine production analysis, whole spleens from sacrificed mice were passed through 40μm strainers (BD Biosciences, 352340) to dissociate cells and then red blood cells were lysed with ACK lysis buffer (Lonza, 10-548E). Cells were stained with AOPI Staining Solution and viable cells counted using a Cellometer Auto 2000 automated cell counter (Nexcelom Biosciences, Lawrence, MA). Cells were diluted to appropriate concentrations in 10% FBS, 1X Pen/Strep in RPMI-1640 (all from Corning, 35-011-CV, 30-002-CI, 10-040-CV) for cellular assays.
Antigen-specific cytokine release from splenocytes was quantified by ELISA as previously described [27]. Briefly, 2x106 splenocytes/mL were incubated with 50μg/mL Tc24, 5μg/mL ConA, or media only for 72hrs, 37°C, 5% CO2. Supernatant IFNγ and IL-4 was measured by a sandwich ELISA method using Mouse IFNγ and IL-4 ELISA kits (eBioscience, 88–7314, 88–7044). Cytokine concentrations produced by antigen-specific cells were calculated by background subtraction of the media only stimulated cells.
Antigen-specific IFNγ-producing splenocytes were quantified by ELISpot using an ImmunoSpot kit (Cellular Technology Limited, MIFNG-1M). Briefly, 2.5x105 splenocytes were incubated with 50μg/mL Tc24, 5μg/mL Concanavalin A (ConA, Sigma-Aldrich, C0412), or media only for 24hrs, 37°C, 5% CO2. After the cytokine detection process, spots were analyzed using a CTL-ImmunoSpot S6 Macro Analyzer (Cellular Technology Limited, Shaker Heights, OH). The frequencies of antigen-specific IFNγ-producing cells were calculated by background subtraction of the media only stimulated cells.
Serum antibody titers
Serum antibodies specific for Tc24 were measured by ELISA as previously described [27]. Briefly, blood samples from mice were allowed to coagulate in Serum-Gel clotting tubes (SARSTEDT, 41.1378.005) and then centrifuged to separate serum per manufacturer’s instructions. Plates (Thermo Scientific, 44-2404-21) were coated with 1.25μg/mL Tc24 in coating solution (KPL, 50-84-00), blocked, and serially diluted serum samples were added. Bound antibody was detected with HRP-conjugated goat anti-mouse IgG1 or IgG2a secondary antibody (LifeSpan Biosciences, LS-C59107, LS-C59112) and the reaction was developed with TMB Substrate (Thermo Scientific, 34021). Titers were recorded as the last dilution above a threshold O.D., calculated by O.D.Avg+ 3SD of serum from naïve mice.
Cardiac fibrosis and inflammation
For histopathological analysis, heart tissue fixed in 10% neutral buffered formalin was embedded in paraffin, cut into 5μm sections, and stained with either Masson’s Trichrome or hematoxylin and eosin (H&E) stain. To assess fibrosis representative tissue sections were chosen for each mouse and 30 images were acquired with a Micromaster microscope (Fisher Scientific) and Micron software at 20x magnification. Image analysis was performed using ImageJ software 1.48v (National Institutes of Health, Bethesda, MD). Pixels corresponding to fibrosis were quantified and normalized to total pixels of the sample to assess the percentage of fibrotic area in the cardiac tissue. To assess inflammation, representative tissue sections were chosen for each mouse and 10 images were acquired with an EVOS microscope (EVOS). Image analysis was performed using ImageJ software 1.48v (National Institutes of Health, Bethesda, MD). The number of total nuclei was quantified and normalized to total tissue area analyzed in the cardiac tissue.
Statistical analysis
Results were analyzed by the Kruskal-Wallis test with Dunn’s correction for multiple comparisons, or, when only two comparison groups were analyzed, Mann–Whitney U test. Results for serum antibody were log-transformed and analyzed by one-way ANOVA with Tukey’s correction for multiple comparisons, as has been previously described [27]. Results for systemic parasitemia were analyzed by Fischer’s exact test. Differences between treatment groups were considered statistically significant if the p-value was less than 0.05. Statistical analysis was performed using Prism software 6.0 (GraphPad Software, La Jolla, CA).
References
- 1. Chagas disease in Latin America: an epidemiological update based on 2010 estimates. Wkly Epidemiol Rec. 2015;90(6):33–43. pmid:25671846.
- 2. Rassi A Jr, Rassi A, Marin-Neto JA. Chagas disease. Lancet. 2010;375(9723):1388–402. pmid:20399979.
- 3. Disease GBD, Injury I, Prevalence C. Global, regional, and national incidence, prevalence, and years lived with disability for 328 diseases and injuries for 195 countries, 1990–2016: a systematic analysis for the Global Burden of Disease Study 2016. Lancet. 2017;390(10100):1211–59. pmid:28919117.
- 4. Lee BY, Bacon KM, Bottazzi ME, Hotez PJ. Global economic burden of Chagas disease: a computational simulation model. The Lancet infectious diseases. 2013. Epub 2013/02/12. pmid:23395248.
- 5. Malik LH, Singh GD, Amsterdam EA. The Epidemiology, Clinical Manifestations, and Management of Chagas Heart Disease. Clinical cardiology. 2015;38(9):565–9. pmid:25993972.
- 6. Perez-Molina JA, Perez AM, Norman FF, Monge-Maillo B, Lopez-Velez R. Old and new challenges in Chagas disease. The Lancet infectious diseases. 2015;15(11):1347–56. pmid:26231478.
- 7. Rassi A Jr, Rassi A, Marin-Neto JA. Chagas heart disease: pathophysiologic mechanisms, prognostic factors and risk stratification. Memorias do Instituto Oswaldo Cruz. 2009;104 Suppl 1:152–8. Epub 2009/09/24. pmid:19753470.
- 8. Uellendahl M, Siqueira ME, Calado EB, Kalil-Filho R, Sobral D, Ribeiro C, et al. Cardiac Magnetic Resonance-Verified Myocardial Fibrosis in Chagas Disease: Clinical Correlates and Risk Stratification. Arquivos brasileiros de cardiologia. 2016;107(5):460–6. pmid:27982271 article was reported.
- 9. Sabino EC, Ribeiro AL, Lee TH, Oliveira CL, Carneiro-Proietti AB, Antunes AP, et al. Detection of Trypanosoma cruzi DNA in blood by PCR is associated with Chagas cardiomyopathy and disease severity. Eur J Heart Fail. 2015;17(4):416–23. pmid:25678239.
- 10. Monteon-Padilla V, Hernandez-Becerril N, Ballinas-Verdugo MA, Aranda-Fraustro A, Reyes PA. Persistence of Trypanosoma cruzi in chronic chagasic cardiopathy patients. Arch Med Res. 2001;32(1):39–43. pmid:11282179.
- 11. Senra T, Ianni BM, Costa ACP, Mady C, Martinelli-Filho M, Kalil-Filho R, et al. Long-Term Prognostic Value of Myocardial Fibrosis in Patients With Chagas Cardiomyopathy. J Am Coll Cardiol. 2018;72(21):2577–87. pmid:30466515.
- 12. Freitas HF, Chizzola PR, Paes AT, Lima AC, Mansur AJ. Risk stratification in a Brazilian hospital-based cohort of 1220 outpatients with heart failure: role of Chagas’ heart disease. International journal of cardiology. 2005;102(2):239–47. pmid:15982491.
- 13. Rassi A Jr., Rassi A, Little WC, Xavier SS, Rassi SG, Rassi AG, et al. Development and validation of a risk score for predicting death in Chagas’ heart disease. The New England journal of medicine. 2006;355(8):799–808. pmid:16928995.
- 14. Rassi A Jr., Rassi A, Little WC. Chagas’ heart disease. Clinical cardiology. 2000;23(12):883–9. Epub 2000/12/29. pmid:11129673.
- 15. Morillo CA, Marin-Neto JA, Avezum A, Sosa-Estani S, Rassi A Jr., Rosas F, et al. Randomized Trial of Benznidazole for Chronic Chagas’ Cardiomyopathy. The New England journal of medicine. 2015;373(14):1295–306. pmid:26323937.
- 16. Perez-Molina JA, Norman F, Lopez-Velez R. Chagas disease in non-endemic countries: epidemiology, clinical presentation and treatment. Current infectious disease reports. 2012;14(3):263–74. Epub 2012/04/06. pmid:22477037.
- 17. Laucella SA, Postan M, Martin D, Hubby Fralish B, Albareda MC, Alvarez MG, et al. Frequency of interferon- gamma -producing T cells specific for Trypanosoma cruzi inversely correlates with disease severity in chronic human Chagas disease. The Journal of infectious diseases. 2004;189(5):909–18. Epub 2004/02/21. pmid:14976609.
- 18. Autran B, Carcelain G, Combadiere B, Debre P. Therapeutic vaccines for chronic infections. Science. 2004;305(5681):205–8. Epub 2004/07/13. pmid:15247470.
- 19. Lee BY, Bacon KM, Wateska AR, Bottazzi ME, Dumonteil E, Hotez PJ. Modeling the economic value of a Chagas’ disease therapeutic vaccine. Human vaccines & immunotherapeutics. 2012;8(9). Epub 2012/08/17. pmid:22894964.
- 20. Engman DM, Krause KH, Blumin JH, Kim KS, Kirchhoff LV, Donelson JE. A novel flagellar Ca2+-binding protein in trypanosomes. The Journal of biological chemistry. 1989;264(31):18627–31. Epub 1989/11/05. pmid:2681200.
- 21. Godsel LM, Tibbetts RS, Olson CL, Chaudoir BM, Engman DM. Utility of recombinant flagellar calcium-binding protein for serodiagnosis of Trypanosoma cruzi infection. J Clin Microbiol. 1995;33(8):2082–5. pmid:7559952.
- 22. Guevara AG, Taibi A, Alava J, Guderian RH, Ouaissi A. Use of a recombinant Trypanosoma cruzi protein antigen to monitor cure of Chagas disease. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1995;89(4):447–8. Epub 1995/07/01. pmid:7570896.
- 23. Dumonteil E, Escobedo-Ortegon J, Reyes-Rodriguez N, Arjona-Torres A, Ramirez-Sierra MJ. Immunotherapy of Trypanosoma cruzi infection with DNA vaccines in mice. Infect Immun. 2004;72(1):46–53. Epub 2003/12/23. pmid:14688079.
- 24. Sanchez-Burgos G, Mezquita-Vega RG, Escobedo-Ortegon J, Ramirez-Sierra MJ, Arjona-Torres A, Ouaissi A, et al. Comparative evaluation of therapeutic DNA vaccines against Trypanosoma cruzi in mice. FEMS immunology and medical microbiology. 2007;50(3):333–41. Epub 2007/05/25. pmid:17521394.
- 25. Limon-Flores AY, Cervera-Cetina R, Tzec-Arjona JL, Ek-Macias L, Sanchez-Burgos G, Ramirez-Sierra MJ, et al. Effect of a combination DNA vaccine for the prevention and therapy of Trypanosoma cruzi infection in mice: role of CD4+ and CD8+ T cells. Vaccine. 2010;28(46):7414–9. Epub 2010/09/21. pmid:20850536.
- 26. Martinez-Campos V, Martinez-Vega P, Ramirez-Sierra MJ, Rosado-Vallado M, Seid CA, Hudspeth EM, et al. Expression, purification, immunogenicity, and protective efficacy of a recombinant Tc24 antigen as a vaccine against Trypanosoma cruzi infection in mice. Vaccine. 2015;33(36):4505–12. pmid:26192358
- 27. Barry MA, Wang Q, Jones KM, Heffernan MJ, Buhaya MH, Beaumier CM, et al. A therapeutic nanoparticle vaccine against Trypanosoma cruzi in a BALB/c mouse model of Chagas disease. Human vaccines & immunotherapeutics. 2016:0. Epub 2016/02/19. pmid:26890466.
- 28. Ishizaka ST, Hawkins LD. E6020: a synthetic Toll-like receptor 4 agonist as a vaccine adjuvant. Expert review of vaccines. 2007;6(5):773–84. Epub 2007/10/13. pmid:17931157.
- 29. Singh M, Kazzaz J, Ugozzoli M, Baudner B, Pizza M, Giuliani M, et al. MF59 oil-in-water emulsion in combination with a synthetic TLR4 agonist (E6020) is a potent adjuvant for a combination Meningococcus vaccine. Human vaccines & immunotherapeutics. 2012;8(4):486–90. pmid:22832252.
- 30. Morefield GL, Hawkins LD, Ishizaka ST, Kissner TL, Ulrich RG. Synthetic Toll-like receptor 4 agonist enhances vaccine efficacy in an experimental model of toxic shock syndrome. Clin Vaccine Immunol. 2007;14(11):1499–504. pmid:17715328.
- 31. Dumonteil E, Bottazzi ME, Zhan B, Heffernan MJ, Jones K, Valenzuela JG, et al. Accelerating the development of a therapeutic vaccine for human Chagas disease: rationale and prospects. Expert review of vaccines. 2012;11(9):1043–55. pmid:23151163.
- 32. Seid CA, Jones KM, Pollet J, Keegan B, Hudspeth E, Hammond M, et al. Cysteine mutagenesis improves the production without abrogating antigenicity of a recombinant protein vaccine candidate for human chagas disease. Human vaccines & immunotherapeutics. 2017;13(3):621–33. pmid:27737611.
- 33. Jones K, Versteeg L, Damania A, Keegan B, Kendricks A, Pollet J, et al. Vaccine-Linked Chemotherapy Improves Benznidazole Efficacy for Acute Chagas Disease. Infection and immunity. 2018;86(4). pmid:29311242.
- 34. Pereira IR, Vilar-Pereira G, Marques V, da Silva AA, Caetano B, Moreira OC, et al. A human type 5 adenovirus-based Trypanosoma cruzi therapeutic vaccine re-programs immune response and reverses chronic cardiomyopathy. PLoS pathogens. 2015;11(1):e1004594. Epub 2015/01/27. pmid:25617628.
- 35. Marin-Neto JA, Cunha-Neto E, Maciel BC, Simoes MV. Pathogenesis of chronic Chagas heart disease. Circulation. 2007;115(9):1109–23. pmid:17339569.
- 36. Rossi MA. The pattern of myocardial fibrosis in chronic Chagas’ heart disease. International journal of cardiology. 1991;30(3):335–40. pmid:2055674.
- 37. Lindblad EB. Aluminium compounds for use in vaccines. Immunology and cell biology. 2004;82(5):497–505. Epub 2004/10/14. pmid:15479435.
- 38. Hedayat M, Netea MG, Rezaei N. Targeting of Toll-like receptors: a decade of progress in combating infectious diseases. The Lancet infectious diseases. 2011;11(9):702–12. Epub 2011/07/02. pmid:21719349.
- 39. Baudner BC, Ronconi V, Casini D, Tortoli M, Kazzaz J, Singh M, et al. MF59 emulsion is an effective delivery system for a synthetic TLR4 agonist (E6020). Pharm Res. 2009;26(6):1477–85. pmid:19255727.
- 40. Sousa GR, Gomes JA, Fares RC, Damasio MP, Chaves AT, Ferreira KS, et al. Plasma cytokine expression is associated with cardiac morbidity in chagas disease. PloS one. 2014;9(3):e87082. Epub 2014/03/08. pmid:24603474.
- 41. Oliveira AC, Peixoto JR, de Arruda LB, Campos MA, Gazzinelli RT, Golenbock DT, et al. Expression of functional TLR4 confers proinflammatory responsiveness to Trypanosoma cruzi glycoinositolphospholipids and higher resistance to infection with T. cruzi. Journal of immunology. 2004;173(9):5688–96. Epub 2004/10/21. pmid:15494520.
- 42. Gomes NA, Previato JO, Zingales B, Mendonca-Previato L, DosReis GA. Down-regulation of T lymphocyte activation in vitro and in vivo induced by glycoinositolphospholipids from Trypanosoma cruzi. Assignment of the T cell-suppressive determinant to the ceramide domain. Journal of immunology. 1996;156(2):628–35. Epub 1996/01/15. pmid:8543814.
- 43. Brodskyn C, Patricio J, Oliveira R, Lobo L, Arnholdt A, Mendonca-Previato L, et al. Glycoinositolphospholipids from Trypanosoma cruzi interfere with macrophages and dendritic cell responses. Infection and immunity. 2002;70(7):3736–43. Epub 2002/06/18. pmid:12065516.
- 44. Przetak M, Chow J, Cheng H, Rose J, Hawkins LD, Ishizaka ST. Novel synthetic LPS receptor agonists boost systemic and mucosal antibody responses in mice. Vaccine. 2003;21(9–10):961–70. pmid:12547609.
- 45.
Ott G, Barchfeld G, Chernoff D, Radhakrishnan R, van Hoogevest P, Van Nest G. MF59 Design and Evaluation of a Safe and Potent Adjuvant for Human Vaccines. In: Powell MF, Newman MJ, editors. Vaccine Design: The Subunit and Adjuvant Approach New York: Springer; 1995. p. 277–96.
- 46. Hawkins LD, Ishizaka ST, McGuinness P, Zhang H, Gavin W, DeCosta B, et al. A novel class of endotoxin receptor agonists with simplified structure, toll-like receptor 4-dependent immunostimulatory action, and adjuvant activity. J Pharmacol Exp Ther. 2002;300(2):655–61. pmid:11805229.
- 47. Higuchi Mde L, Benvenuti LA, Martins Reis M, Metzger M. Pathophysiology of the heart in Chagas’ disease: current status and new developments. Cardiovasc Res. 2003;60(1):96–107. pmid:14522411.
- 48. Punukollu G, Gowda RM, Khan IA, Navarro VS, Vasavada BC. Clinical aspects of the Chagas’ heart disease. International journal of cardiology. 2007;115(3):279–83. Epub 2006/06/14. pmid:16769134.
- 49. Macedo CT, Larocca TF, Noya-Rabelo M, Correia LCL, Moreira MIG, Caldas AC, et al. Assessment of speckle tracking strain predictive value for myocardial fibrosis in subjects with Chagas disease. Int J Cardiol Heart Vasc. 2015;8:75–80. pmid:28785684.
- 50. Jones K. Vaccine-Linked Chemotherapy Improves Benznidazole Efficacy for Acute Chagas Disease. 2018;86(4). pmid:29311242.
- 51. Pereira IR, Vilar-Pereira G, Silva AA, Lannes-Vieira J. Severity of chronic experimental Chagas’ heart disease parallels tumour necrosis factor and nitric oxide levels in the serum: models of mild and severe disease. Memorias do Instituto Oswaldo Cruz. 2014;109(3):289–98. Epub 2014/06/18. pmid:24937048.
- 52. Konduri V, Halpert MM, Liang D, Levitt JM, Cruz-Chan JV, Zhan B, et al. Genetic Adjuvantation of a Cell-Based Therapeutic Vaccine for Amelioration of Chagasic Cardiomyopathy. Infection and immunity. 2017;85(9). pmid:28674032.
- 53. Biter AB, Weltje S, Hudspeth EM, Seid CA, McAtee CP, Chen WH, et al. Characterization and Stability of Trypanosoma cruzi 24-C4 (Tc24-C4), a Candidate Antigen for a Therapeutic Vaccine Against Chagas Disease. Journal of pharmaceutical sciences. 2018;107(5):1468–73. Epub 2017/12/25. pmid:29274820.
- 54.
Council NR. Guide for the Care and Use of Laboratory Animals. 8th ed. Washington, DC.: National Academy Press; 2011 2011.
- 55. Ruiz-Sanchez R, Leon MP, Matta V, Reyes PA, Lopez R, Jay D, et al. Trypanosoma cruzi isolates from Mexican and Guatemalan acute and chronic chagasic cardiopathy patients belong to Trypanosoma cruzi I. Memorias do Instituto Oswaldo Cruz. 2005;100(3):281–3. Epub 2005/08/23. pmid:16113869.
- 56. Melo MF, Moreira OC, Tenorio P, Lorena V, Lorena-Rezende I, Junior WO, et al. Usefulness of real time PCR to quantify parasite load in serum samples from chronic Chagas disease patients. Parasit Vectors. 2015;8:154. pmid:25890282.
- 57. Piron M, Fisa R, Casamitjana N, Lopez-Chejade P, Puig L, Verges M, et al. Development of a real-time PCR assay for Trypanosoma cruzi detection in blood samples. Acta tropica. 2007;103(3):195–200. pmid:17662227.
- 58. Gangisetty O, Reddy DS. The optimization of TaqMan real-time RT-PCR assay for transcriptional profiling of GABA-A receptor subunit plasticity. J Neurosci Methods. 2009;181(1):58–66. pmid:19406150.
- 59. Caldas S, Caldas IS, Diniz Lde F, Lima WG, Oliveira Rde P, Cecilio AB, et al. Real-time PCR strategy for parasite quantification in blood and tissue samples of experimental Trypanosoma cruzi infection. Acta Trop. 2012;123(3):170–7. pmid:22609548.
- 60. Cencig S, Coltel N, Truyens C, Carlier Y. Parasitic loads in tissues of mice infected with Trypanosoma cruzi and treated with AmBisome. PLoS neglected tropical diseases. 2011;5(6):e1216. pmid:21738811.