The authors have declared that no competing interests exist.
A DNA extraction and preservation protocol that yields sufficient and qualitative DNA is pivotal for the success of any nucleic acid amplification test (NAAT), but it still poses a challenge for soil-transmitted helminths (STHs), including
In a first experiment, DNA was extracted from 37 stool samples with variable egg counts for
The choice of DNA extraction kit significantly affects the outcome of NAATs. Given the clear benefit of bead beating and our validation of ethanol for (long-term) preservation, we recommend that these aspects of the protocol should be adopted by any stool sampling and DNA extraction protocol for downstream NAAT-based detection and quantification of STHs.
DNA-based tools are increasingly being used for the diagnosis of intestinal worm infections in both clinical and research laboratories. However, recovering DNA from intestinal worm eggs in stool remains a challenge since this DNA is protected by a very rigid egg shell. Furthermore, stool contains inhibitors that can affect test results and these should be removed during DNA extraction. Prior to DNA extraction, samples are often preserved, but the impact of the type of preservatives and the duration of preservation remains poorly studied. In the present study, we assessed the impact of four DNA extraction and three preservation protocols on the downstream performance of a DNA-based diagnostic tool for intestinal worms. We found significant differences in DNA recovery across the DNA and preservation protocols, but DNA from worm eggs in stool proved to be stable over time in all preservatives.
Soil-transmitted helminth (STH) infections are among the most common parasitic infections globally and affect more than a quarter of the world’s population, mainly poor populations in (sub)tropical regions. These infections are caused by intestinal helminths (worms) which excrete eggs through human stool, that contaminate soil in areas where sanitation is poor and in turn infect the human host orally or through skin contact. The main STH species are the giant roundworm (
To control the burden caused by these worms, the World Health Organization (WHO) recommends preventive chemotherapy (PC) programs, during which anthelmintic drugs are administered to at-risk populations (i.e., pre-school-aged children, school-aged children and women of reproductive age). WHO recommends a bi-annual PC when the prevalence of any STHs exceeds 50% and an annual PC when the prevalence is between 20% and 50%. For a prevalence below 20%, it is not recommended to initiate a PC program [
Diagnostic tools play a pivotal role in these PC programs as they provide information on the population prevalence and infection intensity distribution that ultimately guides PC program decisions. Today, microscopy of Kato-Katz thick smears is the most widely used tool for the detection and enumeration of STH eggs in stool [
More recently, nucleic-acid amplification tests (NAATs) are being used increasingly in clinical [
For the two experiments (the DNA extraction and the preservation experiment), stool samples were collected from primary school children. The protocols for the two experiments were separately approved by the Institutional Review Board of Jimma University, Ethiopia (DNA extraction experiment: reference RPGC/478/2014; preservation experiment: reference RPGC/547/2016). The school administrators, teachers, parents/legal guardians and children were informed about the objectives of the study. Children that appeared in overall healthy condition, whose parents or legal guardians signed an informed consent and who volunteered to provide a sufficient amount of stool sample were included. Children who were found excreting any of the STH eggs were treated with a single oral dose of 400 mg albendazole (GlaxoSmithKline).
Based upon previous STH prevalence data from Jimma Town (Ethiopia) [
We compared two commercially available DNA extraction kits, i.e. the QIAamp DNA Stool Mini kit and DNeasy Blood & Tissue kit (both Qiagen, Germany). The Qiagen DNeasy Blood & Tissue kit was chosen because it was our in-house DNA extraction protocol, while the QIAamp DNA Stool Mini kit was selected because it is Qiagen’s recommended kit for stool samples. Both kits were tested with and without a preceding bead beating step. This step aims to mechanically rupture the egg shells [
Thereafter, we further followed the manufacturer’s protocol for all four extraction protocols. Briefly, for both QIAamp DNA Stool Mini kit extraction protocols (with and without preceding bead beating), 2 ml of buffer ASL was added to each sample tube and thoroughly mixed by vortexing. Subsequently, 1.6 ml of this suspension was transferred to a 2 ml Eppendorf tube and heated at 70°C for 5 min. After centrifugation at 10,000 rpm (8,944 g) for 2 min, 1.2 ml of supernatant was transferred to a new 2 ml Eppendorf tube containing 1 InhibitEX tablet, which adsorbs inhibitors from the suspension. After centrifugation at 10,000 rpm (8,944 g) for 3 min, 200 μl of supernatant was added to an Eppendorf tube, to which 15 μl of Proteinase K and 200 μl AL lysis buffer was added. Tubes were then incubated at 70°C for 10 min. The complete lysate was added to QIAamp spin column and centrifuged until the lysate completely passed through the spin column membrane enabling nucleic acids to attach to the column membrane. Subsequently, the column was washed with buffers AW1 and AW2. Finally, bound DNA was eluted in 200 μl of AE buffer.
For both DNeasy Blood & Tissue kit extraction protocols (with and without preceding bead beating), 180 μl of buffer ATL containing 20 μl of Proteinase K was added to the sample and incubated at 55°C for 2 h. Subsequently, 400 μl of buffer AL was added and samples where incubated at 70°C for 10 min. Then, the suspension was centrifuged at 10,000 rpm (8,944 g) for 30 seconds, and the supernatant was transferred to an Eppendorf containing 400 μl of 96% ethanol. A total of 600 μl of the mixture was pipetted to a spin column supported by a 2 ml collecting tube and centrifuged at 10,000 rpm (8,944 g) until the lysate completely passed through spin column and the same step applied for rest of the lysate. Subsequently, the column was washed with buffers AW1 and AW2. Finally, bounded DNA was eluted in 200 μl of buffer AE. All DNA extracts were stored at -20°C until shipment on dry ice to the Laboratory for Medical Microbiology and Immunology, Elisabeth-TweeSteden Hospital, Tilburg (The Netherlands) for qPCR analysis.
DNA of
Species | Primer/ |
Sequence (5’-3’) | Target region | References |
---|---|---|---|---|
Fwd | GTAATAGCAGTCGGCGGTTTCTT | ITS-1 | [ |
|
Rev | GCCCAACATGCCACCTATTC | [ |
||
Probe | Texas Red-TTGGCGGACAATTGCATGCGAT-BHQ2 | [ |
||
Fwd | TTGAAACGACTTGCTCATCAACTT | 18S | [ |
|
Rev | CTGATTCTCCGTTAACCGTTGTC | [ |
||
Probe | Yakima Yellow-CGATGGTACGCTACGTGCTTACCATGG-BHQ1 | [ |
||
Fwd | GAATGACAGCAAACTCGTTGTTG | ITS-2 | [ |
|
Rev | ATACTAGCCACTGCCGAAACGT | [ |
||
Probe |
Cy5-ATCGTTTACCGACTTTAG- BHQ2 | [ |
||
Fwd | CTGTTTGTCGAACGGTACTTGC | ITS-2 |
[ |
|
Rev | ATAACAGCGTGCACATGTTGC | [ |
||
Probe |
FAM-CTGTACTACGCATTGTATAC-BHQ1 | [ |
*Minor groove binding probes; Fwd: forward primer; Rev: reverse primer; BHQ1: black hole quencher 1; BHQ2: black hole quencher 2; ITS-1: internal transcribed spacer 1; 18S: 18S ribosomal RNA gene; ITS-2: internal transcribed spacer 2
In April 2016, a total of 140 stool samples were collected from children of two primary schools in Jimma Town, with the ultimate aim to have 20 stool samples with at least 150 EPG for two STH species. Stool samples were microscopically screened applying a single Kato-Katz thick smear as previously described (WHO, 1992). To avoid clearance of hookworm eggs, all smears were examined within 30–60 min for the presence of STH eggs. The number of STH eggs was counted as per STH species basis and multiplied by 24 to obtain the FECs in EPG.
After homogenization, three aliquots of 0.5 gram from each of the selected samples were preserved in 1 ml of 96% ethanol, three aliquots in 1 ml of 5% potassium dichromate and three aliquots in 1 ml of RNA
DNA of preserved stool samples were extracted using the in-house protocol of the Laboratory for Medical Microbiology and Immunology, Elisabeth-TweeSteden Hospital, Tilburg (The Netherlands). Briefly, 250 μl of stool suspension was placed in an Eppendorf tube and washed by centrifugation at 8,500 g for 1 min. Subsequently, the supernatant was aspirated and discarded. A total volume of 1 ml PBS was added to the pellet, which was again vortexed and centrifuged at 8,500 g for 1 min. Then the supernatant was once more discarded. Subsequently, 500 μl of 2% polyvinylpyrrolidone (PVPP, Sigma) was added to prevent inhibition in downstream qPCR steps, and the suspension was transferred to Green Bead tubes (Roche). A freeze-thaw cycle was performed by placing the tubes at -80°C for 30 min. After thawing, mechanical disruption of the sample was performed by placing the tubes in the MagNA Lyser (Roche) for 1 min at 3,000 rpm. After a short spin, 500 μl of ATL buffer (Qiagen) containing 50 μl of Proteinase K (Qiagen) was added and placed at 55°C for 2 h. Subsequently, samples were placed in the automated QiaSymphony platform for purification. Finally, extracted DNA from each preservative and each time point was used as a template in qPCR assays for the quantification of DNA of
The performance of the different extraction protocols was assessed by comparing the sensitivity and the DNA concentration of the different STHs expressed as GE/ml. The sensitivity was determined using the principle of the composite reference standard method [
Significant differences in sensitivity and DNA concentration across DNA extraction protocols were assessed applying generalized linear mixed effect models. For the sensitivity, the ‘glmer’ function in R was used, incorporating the binary qPCR test (positive or negative for that particular target) as dependent variable and STH species (2 levels:
We assessed the impact of different preservatives, duration of preservation and FECs by comparing the sensitivity and the DNA concentration of the different STHs expressed as GE/ml applying the aforementioned methodologies. For the sensitivity, a stool sample was classified as positive for a STH species if at least one egg was detected applying microscopy or one of the preservatives had a downstream positive qPCR at least one time point of DNA extraction for that particular STH species. For the generalized linear mixed effect models, the STH species (3 levels:
Eggs and/or DNA of
The left panel represents the sensitivity (sen) and geometric mean of DNA concentration expressed as genome equivalents per ml of DNA extract (mean; GE/ml) for 20
The intensity of infection was classified as low (
N | QIAamp DNA Stool Mini kit | DNeasy Blood & Tissue kit | ||||
---|---|---|---|---|---|---|
Without bead beating (%) | With bead beating (%) | Without bead beating (%) | With bead beating (%) | |||
Zero FECs | 15 | 66.7 | 73.3 | 73.3 | 86.7 | |
Low | 11 | 54.5 | 81.8 | 90.9 | 100 | |
Moderate-to-heavy | 10 | 100 | 100 | 100 | 100 | |
Zero FECs | 9 | 22.2 | 44.4 | 44.4 | 66.7 | |
Low | 14 | 21.4 | 64.3 | 64.3 | 78.6 |
For
The outcome of the general linear mixed effect regression models confirmed significant differences in sensitivity and DNA recovery across both STHs, DNA extraction protocols and FECs. The odds of detecting a case of
The DNA concentration increased approximately 6.3 (95%CI: 3.5–11.5) times when the DNeasy Blood & Tissue kit was used instead of the QIAamp DNA Stool Mini kit. A bead beating step increased the DNA concentration 3.6 (96%CI: 1.8–7.4) times. There was no significant difference in DNA recovery across
Eggs and/or DNA of
The line graphs represent the sequential differences in sensitivity (Sen) and geometric mean (mean) of DNA concentration expressed genome equivalents/ml (GE/ml) of DNA over time (65, 125 and 425 days) for 17
The outcome of the regression models indicated a significant difference in sensitivity between STHs and FECs, but did not reveal any significant difference between preservatives and duration of preservation. Compared to
Research and clinical laboratories are increasingly using NAATs for both detection and quantification of STHs in stool. However, any DNA based examination requires DNA extraction method that yields sufficient and qualitative DNA. In the current study, we assessed the performance of the different extraction and preservation protocols by comparing the sensitivity and the DNA concentration (expressed as GE/ml) of the different STHs. To our knowledge, we are the first to compare the preservation of stool samples over a period of 14 months in three widely used preservatives for STHs, i.e. ethanol, potassium dichromate and RNA
The DNA extraction experiment indicated that extracting DNA applying the DNeasy Blood & Tissue kit improved the sensitivity and DNA concentration for both
The DNA extraction experiment clearly showed that a bead beating step too has an important impact on the sensitivity and DNA recovery. This is in line with previous studies that compared DNA extraction protocols with and without bead beating for the detection of parasites, including but not limited to human STHs (
We found that ethanol and RNA
This study has six important limitations, which needs to be considered when both interpreting extrapolating the results. First, we only evaluated a restricted number of DNA extraction (DNA extraction kit and beads) and preservative protocols, focusing on DNA extraction protocols previously used by our laboratory and widely used preservatives. Consequentially, extrapolation to any other combination of DNA and preservation protocol should be done with care. Second, the two experiments were conducted on two different sets of stool samples at different time points applying a different microscopic method for screening cases (DNA extraction experiment: McMaster and preservation experiment: Kato-Katz thick smear) and a slightly adapted DNA extraction protocol on the selected samples (e.g. manual vortexing
In conclusion, DNeasy Blood & Tissue kit DNA extraction protocol with preceded bead beating maximized the extraction of STH DNA in stool in our study. Ethanol was found to be the most cost-effective preservative. Given the clear benefit of bead beating and our validation of ethanol for (long-term) preservation, we recommend that these aspects of the protocol should be adopted by any stool sampling and DNA extraction protocol for downstream NAAT-based detection and quantification of STHs.
(PDF)
The raw data of the DNA and preservation experiment can be found in the worksheets ‘DNA extraction’ and ‘Preservation’, respectively. The worksheet ‘Legend’ explains the headers (variables) in across both data sets.
(XLSX)
The fecal egg counts are expressed as eggs per gram of stool (EPG), whereas the DNA concentration is expressed as genome equivalents per ml (GE/ml).
(PDF)
The fecal egg counts are expressed as eggs per gram of stool (EPG), whereas the DNA concentration is expressed as genome equivalents per ml (GE/ml).
(PDF)
The intensity of infection was classified as low (
(DOCX)
The scatterplot illustrate the agreement in fecal egg counts (FECs; expressed as eggs per gram of stool (EPG) and the DNA concentration (expressed as genome equivalents per ml (GE/ml)) across ethanol, potassium dichromate and RNA
(PDF)