Human MARC1 variant detection

To expand on MARC1 genetics and potentially identify novel MARC1 variants, we performed association testing of genetic variants in the MARC1 gene with liver and other health-related phenotypes in over 540,000 individuals from five ancestry groups who had available exome sequencing data.

The previously known protein coding variant Ala165Thr (p.A165T) in MARC1 was significantly associated with 0.50 U/L lower ALT levels (95% CI, -0.45 to -0.56; p = 7.4 x10^-75) which is similar to individuals carrying rare putative loss of function (pLOF) alleles in MARC1 (-0.76; 95% CI; -1.25 to -0.27; p = 0.0022; Fig 1A and S1 Table). In addition, we tested 332 rare (MAF<0.01) missense variants in MARC1, of which only Met187Lys (M187K) was significantly associated with lower ALT levels (-0.48 U/L; 95% CI, -0.72 to -0.24; p = 9.9 x 10⁻⁵; Fig 1A) [11]. The association of M187K with ALT levels was independent of common fine-mapped variants, including A165T (S1 Fig).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. MARC1 putative loss of function variants (pLOF) show protection from liver disease in exon-wide studies.

(A) MARC1, its two common (A165T, M187K) and rare pLOF variants effects on serum ALT, (B) Magnetic resonance imaging (MRI)-estimated proton density liver fat fraction (PDFF) and (C) liver disease (any, liver disease by ICD or by PDFF). Cohort consists of 480,000 controls, except “Fatty liver by PDFF group” which included only 26,000 subjects. ICD—International Classification of Diseases, AAF—alternate allele frequency.

https://doi.org/10.1371/journal.pgen.1011179.g001

In addition to the associations with reduced ALT levels, we found that the burden of rare pLOF variants in MARC1 A165T and M187K were significantly associated with reduced liver fat (Fig 1B), as estimated by proton density of the fat fraction which is quantified using magnetic resonance imaging (PDFF-MRI), and with various liver disease etiologies, including alcoholic and non-alcoholic liver diseases, and liver cirrhosis (Fig 1C and S2 Table). We next estimated the associations of these MARC1 variants with cardiometabolic traits to better understand the broader impact on health and functional mechanism. We observed significant associations (P<0.001) between MARC1 loss of function variants and lower circulating apolipoprotein B, LDL-C and HDL-C levels, but higher circulating triglyceride levels (S2 Fig and S3 Table). In addition, we identified 2 homozygote MARC1 putative loss of function carriers, one individual in UKB, and one in GHS (S1 Table). Both individuals had no reports of liver disease, had normal BMI, average ALT, blood pressure and lipid levels.

MARC1 genetic variant p.A165T shows protein instability and aberrant protein localization in hepatocytes

First, we sought to evaluate the effect of MARC1 pLOF on MARC1 protein expression. Both the published and our own in silico prediction studies showed that MARC1 p.A165T can cause protein instability as indicated residue is highly conserved and disrupts the alpha helix [26]. To assess A165T/M187K MARC1 variant effect on expression and localization of MARC1 protein in vitro, we overexpressed the human wild-type and two MARC1 variants (A165T and M187K) in a human HuH-7 hepatoma cell line. Levels of MARC1 mRNA were comparable in cells expressing wild-type and the two variants of human MARC1, however the level of A165T variant protein was reduced by 64%. Interestingly, MARC1 M187K variant protein levels were similar to MARC1 WT (Fig 2A–2C). Identical experiments with MARC1 variant overexpression were repeated on the second human hepatoma cell line (HepG2) with comparable results (S4 Fig). To avoid a potential non-physiological effect of transfection on protein expression level, we performed human liver protein analysis utilizing livers from A165T variant carriers. Consistent with findings from transient recombinant protein overexpression, the analysis of these human livers revealed 60% reduction in MARC1 p.165T variant protein level compared to the most common (p.165A) variant. Concurrently, the mRNA levels of both variants were similar. No changes were observed in MARC2 mRNA or protein levels in these same samples (Fig 2D–2F). To uncover the cause of the discrepancy between mRNA and the protein level for A165T variant, we performed confocal microscopy studies in HuH-7 cells. These studies revealed that the protein from cells that overexpressed human recombinant A165T variant showed only partial colocalization within mitochondria, while both proteins from cells overexpressing MARC1 wild-type and M187K variants fully colocalize within mitochondria (Figs 3 and S5). These data suggest that human MARC1 substitution of alanine with threonine in A165T led to partially unstable mislocated protein. To evaluate if A165T protein was degraded by proteasomal or lysosomal degradation, we overexpressed wild-type and A165T variant in HuH-7 cells and incubated cells with or without proteasomal inhibitor MG132 and lysosomal inhibitor chloroquine. The use of either inhibitor did not rescue MARC1 A165T variant protein, (S6A and S6B Fig). In order to differentiate between the compromised translation and stability of the MARC1 protein, we overexpressed wild-type and A165T variant in HuH-7 cells and then treated the cells with the protein synthesis inhibitor cycloheximide (CHX). We also added either MG132 or chloroquine to CHX and compared the expressions of the MARC1 proteins at 0, 3, 6, and 9 hours post-treatment. The addition of MG-132 or chloroquine to CHX for the cells expressing MARC1 p.165T variant did not lead to p.165T variant protein protection from degradation compared to CHX alone treatment, implying that p.165T variant protein instability is not caused by either proteasomal or lysosomal degradation (S6C and S6D Fig).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. MARC1 A165T substitution leads to reduction in MARC1 protein expression.

(A) Plasmids with empty vector (Vector), wild-type and common variants of human MARC1 (pTK promoter, C terminal 3x Flag tag) were expressed in HuH-7 cells. 48 hours after transfection, cells were split into two parts. First part of cells were solubilized in RIPA buffer, proteins separated on SDS-PAGE (4–20%) gels and blotted with corresponding antibodies, (B) immunoblot quantitation was performed. (C) Second part of cells was used to measure MARC1 mRNA levels using Real-Time PCR. (D) Human liver samples DNA were extracted, and human MARC1 gene third exon that contains MARC1 variants p.165A/T and p.187M/K was amplified by PCR and Sanger sequenced, and samples with homozygous MARC1 p.187M variant selected. Liver samples proteins were extracted, size fractioned and blotted as described in Methods. (E) Western Blot signals were measured with ECL imager build-in software, (F) RNA was extracted from the same livers, and MARC1, MARC2 and house-keeping gene (36B4) expression levels were detected by qRT-PCR. For human MARC1 primary antibody control MARC1 deficient HuH-7 cell line (CAS9/Crispr) was used as negative control. For MARC2 primary antibody control MARC1 deficient HuH-7 cell line (expressing no MARC1 and 2) was used as negative control and the same cell line with transient overexpression of recombinant human MARC2 without tags, as positive control. Red arrows–reduction (%) of MARC1 protein. Mean ± s.e.m. are shown in all graphs, **p<0.01.

https://doi.org/10.1371/journal.pgen.1011179.g002

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Human MARC1 p.165T variant causes mislocalization of MARC1 protein in hepatic cells.

HuH-7 cells were transfected with plasmids containing wild type or 2 common genetic variants (p.A165T and p.M187K) of human MARC1 (with C terminal Flag tag and gene expression driven under CVM promoter). 48 hours after transfection cells were incubated with Mitotracker Orange CMTMRos staining (Thermo Fisher) solution in serum free media for 20 minutes, cells were washed, fixed, permeabilized and blocked as described in Methods. After additional washing, cells were incubated with Flag antibody (Sigma) for 1 hour, washed and incubated with Alexa Fluor 647 conjugated secondary antibody. After final wash, cells were incubated in mounting medium with DAPI (Ibidi) and imaged with Leica confocal microscope. The experiment was repeated once with the equivalent results.

https://doi.org/10.1371/journal.pgen.1011179.g003

Marc1 is predominantly expressed in the liver in mice

In humans, MARC1 is mainly expressed in white adipose tissue, thyroid, breast and liver, with adipose expression being 3 times higher than the liver (GTEX portal). To estimate tissue distribution and expression levels of Marc1 mRNA and protein in mouse, we analyzed various tissues from wild type C57BL/6 male mice. Marc1 mRNA was expressed almost exclusively in the liver, with very minor expression in brown adipose tissues (BAT), as well as in the descending aorta and white adipose tissues (Fig 4A). Similarly, Marc1 protein was mainly expressed in the liver, followed by brown and white adipose tissues (Fig 4C). The closest Marc1 paralogous protein Marc2, was highly expressed in all three parts of the small intestine, liver and kidney consistent with its mRNA expression pattern in mice (Fig 4B and 4C), and with liver being the tissue where human MARC2 is expressed at the highest level (GTEX portal). Notably, the tissue expression of two cofactors of Marc1 and 2 enzymes (Cyb5b and Cyb5r3) show an expression pattern in mice similar to Marc2 but not Marc1 (Fig 4C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Marc1 and Marc2 have distinct mRNA and protein expression patterns in mouse tissues.

Chow fed 8–10 weeks old wild type C57BL/6N male mice (n = 10) were sacrificed at ad lib fed state, tissues collected, and Marc1 (A) and Marc2 (B) mRNA gene expression detected by RNAseq as described in Methods. Data plotted as mean with standard error. From some tissues only 3–6 samples were analyzed. Values were calculated as Transcripts Per Million (TPM). (C) 12 weeks old wild type C57BL/6N male mice fed ad lib chow diet were sacrificed and represented tissues collected. Tissue proteins were extracted, 20 μg of total protein of each organ were size fractionated by SDS-PAGE (4–20%) and blotted as described in Methods. Calnexin served as protein loading control for the experiment. GA–Gastrocnemius muscule; WAT–epididymal white adipose tissue; BAT–brown adipose tissue. Small intestine was cut into 3 equal parts, washed and protein extracted.

https://doi.org/10.1371/journal.pgen.1011179.g004

Development and validation of Marc1 knockout mice

To support a hypothesis that A165T of MARC1 variant is a loss of protein function mutation and to understand if MARC1 deletion or inhibition may have a beneficial effect on liver disease in humans, we generated whole body Marc1 knockout mouse. The mouse Marc1 gene was inactivated by DNA homologous recombination, replacing Marc1 exon 2 and 3 with antibiotic selection marker, β-galactosidase gene (LacZ), Cre recombinase (self-deleting protamine promoter), as well as with 2 Cre sites. After the first expression of new construct in mouse spermatids antibiotic selection marker and Cre recombinase were deleted by Cre recombination, leaving the β-galactosidase gene (LacZ) and one LoxP site in the flanking intron (Fig 5A). The subsequently generated Marc1^-/- (Marc1 KO) mice were born live with the expected Mendelian mode of inheritance and displayed no overtly abnormal phenotype. Adult Marc1 KO were fertile and nursed their pups normally (S4 Table). Full deletion of Marc1 gene in Marc1 homozygous KO mouse was confirmed in liver on DNA (PCR), mRNA (qRT-PCR) and protein levels (Western Blot) (Fig 5B–5D). Marc2 paralogue or Marc1/2 cofactors (Cyb5B and Cyb5r3) proteins expression were not affected by Marc1 deletion (Fig 5D).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Generation and validation of Marc1 knockout mice.

(A) Homologous recombination was used to replace the second and third exons of mouse Marc1 gene. The antibiotic selection marker (Neo) located between two LoxP sites was deleted with Cre recombinase under self-deleting protamine promoter, leaving β-galactosidase gene (LacZ) and one LoxP site in the flanking intron. (B) Total DNA was extracted from the wild type, heterozygous and homozygous Marc1 knockout male mice livers using commercial kit. Genotyping was performed by PCR with dedicated primers (green arrows) to amplify a 4 kB fragment from genomic DNA flanking Marc1 gene second and third exons. Amplified PCR DNA fragments were digested by EcoRV restriction enzyme (present in LacZ, but not in mouse genome form Marc1 Exon 2 to 3) and size separated on agarose gel by electrophoresis. (C) mRNA (qRT-PCR) and (D) immunoblotting analysis of hepatic Marc1, Marc2 and cofactor proteins in 16-week-old male WT, Marc1 ^+/- and Marc1 ^-/- mice. Liver lysates were prepared for Western Blot as described under “Methods”. Each sample (45 μg) was size-fractionated by SDS-PAGE (4–15%), and immunoblotting was performed using a rabbit anti-mouse Marc1 polyclonal antibody (DB0161 (1ug/ml); antibody targeting C-terminus of mouse Marc1 protein). Calnexin served as protein loading control for the experiment. PCR–polymerase chain reaction. SA—splice site acceptor.

https://doi.org/10.1371/journal.pgen.1011179.g005

Marc1 ablation does not elicit hepatoprotective effect in NASH mouse models

Initial phenotyping of Marc1 KO male mice fed ad lib chow diet showed reduction in liver triglycerides and phospholipids, however no changes in serum liver injury markers (ALT and AST), or other markers were observed (S5 Table). Liver gene expression profiling of Marc1 KO chow fed mice revealed no major changes in gene expression in the liver, including de novo lipogenesis or oxidation pathways genes. (S7 and S8 Tables).

To determine Marc1 effect on liver lipid accumulation, inflammation, and fibrosis, we challenged Marc1 KO and WT male mice with NASH/NAFLD-causing diets: high fat/high fructose diet (HFHFD) and choline-deficient L-amino acid defined high fat diets (CDAA-HFD). Feeding Marc1 KO and WT mice with HFHFD for 35 weeks did not affect body weight gain, body composition, liver enzymes, and had no effect on serum and liver lipids (Fig 6A–6D and S5 Table). Similarly, there were no significant differences in liver inflammation or fibrosis gene markers between Marc1 KO and WT mice measured by selected gene expression in the liver by qRT-PCR (Fig 6E). Histological analysis of liver sections from HFHFD fed animals showed no differences between Marc1 KO and WT male mice in lipid droplet size and distribution (hematoxylin/eosin staining, Fig 7A and 7B). Similarly, we observed no differences between genotypes when quantified hepatic inflammation (CD45 stain) and fibrosis (Sirius red stain) (Fig 7A, 7C and 7D). Feeding Marc1 KO and WT male mice with the second NASH-causing diet, CDAA-HFD, for 18 weeks did not reveal any significant variation in body weight, body composition or liver lipid accumulation, hepatic inflammation, fibrosis, or any changes in serum lipid levels (S7A–S7E, S8A–S8D Figs and S5 Table). To expand our phenotyping to female mice we utilized the same diets (HFHFD and CDAA-HFD), however found similar lack of phenotype in Marc1 KO females: no differences in body weight gain, body composition, liver and serum lipids or liver enzymes between female KO and WT mice (S9 Fig and S6 Table).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. Marc1 gene deletion has no effect on circulating or liver lipids in male mice fed High fat high fructose diet (HFHFD).

Eight weeks old male mice (10 WT and 14 Marc1 KO) were fed with HFHFD for 34 weeks. (A) Body mass gain was measured every 2 weeks, (B) body composition (Micro CT) in mice were assessed at week 13 of the experiment. (C) Serum, (D) liver lipids, (E) selected liver gene expression (mRNA by qRT-PCR) were measured at the end of experiment. Each point represents individual mouse, mean ± s.e.m. are shown in all graphs. ****p<0.0001.

https://doi.org/10.1371/journal.pgen.1011179.g006

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 7. Marc1 gene deletion has no effect on liver lipid accumulation, inflammation or fibrosis in mice fed High fat high fructose diet (HFHFD).

(A) Liver samples were collected from mice described in Fig 6. at the end of the experiment. Fixed liver sections were stained with hematoxylin/eosin (HE), CD45 and Sirius Red staining. (B) Lipid droplet area, (C) CD45 positive cell area and (D) fibrosis area were measured from each animal liver section. Slides were scanned on Aperio AT2 scanners (Leica Biosystems) with 10X magnification. Each point represents individual mouse, mean ± s.e.m. are shown in all graphs.

https://doi.org/10.1371/journal.pgen.1011179.g007

Focusing only on the effect of Marc1 deletion on liver steatosis, we fed Marc1 KO and WT male mice with high sucrose diet (HSD, 9 weeks) or high fat diet (HFD, 11 weeks). However, although we observed significant reduction in ALT levels in Marc1 KO vs WT in both diets, we did not detect any significant difference in liver triglycerides between WT and Marc1 KO mice on these diets, consistent with the findings from HFHFD and CDAA-HFD studies described above (S5 Table).

Marc2 but not Marc1 is a main enzyme with N-hydroxylated amidine reduction properties in mouse liver

To assess Marc1 and 2 enzymatic activities for reduction of N-hydroxyl substrates, we adapted an in vitro system utilizing a commonly used synthetic substrate, benzamidoxime (BAO), to evaluate its reduction to benzamidine (BA) [28]. Our initial attempts to use human hepatic or other cell lines (HepG2, ZR-75-1 and HEK293) with knockout or overexpression of human MARC1 gene described earlier [21,27,28,31] did not show any reliable and consistent measurable BAO reduction and BA production. Thus, we decided to utilize freshly prepared primary mouse hepatocytes to assess N-hydroxyl substrate reduction activity by Marc1 and Marc2 enzymes directly. Our early experiments with plated wild type mouse primary hepatocytes showed BAO reduction was detectable in 2–4 hours’ time period, reaching up to 30% conversion of BAO to BA in the media. However, no difference was observed in BAO reduction rates between primary hepatocytes isolated from Marc1 KO or WT mice. Thus, we hypothesized that the conversion of BAO to BA observed in primary hepatocytes may be driven by Marc1 paralogue, Marc2, which is present in both Marc1 KO and WT hepatocytes. To evaluate this hypothesis, we partially deleted Marc1, Marc2 or both Marc1/2 from primary hepatocytes using CRISPR/Cas9 method. The deletion efficiency was evaluated by the respective Western Blot protein analysis (Fig 8A). Consistent with previous data, we observed that deletion of Marc1 gene alone did not affect BAO N-hydroxyl reduction compared with control (anti RFP gRNA) treated hepatocytes. Remarkably, Marc2 deletion decreased BAO N-hydroxyl reduction by more than 58% and double deletion of Marc1/2 abolished BAO reduction to BA activity by 72%, compared with control-treated hepatocytes (Fig 8B). Residual N-hydroxyl reduction activity (28%) in Marc1/2 double gene deletion group can be explain with partial Marc1/2 gene editing (inactivation) as CRISPR/Cas9 editing happens independently in each hepatocyte; we cannot also exclude that mouse hepatocytes may possess other enzymes with low affinity for BAO reduction. It is worth noting that CRISPR/Cas9 editing could have off-target effect even after careful gRNA selection [32].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 8. Marc2 is the main benzamidoxime (BAO) reducing enzyme in mouse hepatocytes.

12 weeks old male Cas9 transgenic mice were injected in tail vein with 3x10¹⁰ genome copies (GC) of AAV8 containing Cas9 gRNA against Marc1, Marc2, Marc1/2 (edit both genes), and control (red fluorescent protein (RGF)). (A) 3 weeks after virus injection mice were sacrificed and primary hepatocytes isolated, counted and plated on poly-D-lysine pre-coated plates, then cells were left in incubator to attach to plate for 4 hours. After attachment, cells were washed with PBS once and incubated in serum free media with 0.5 mM benzamidoxime for 2 hours, then cell media were collected and protein from all primary cell plates was extracted, size fractioned on 4–20% SDS-PAGE gel and blotted with corresponding antibodies. Densitometry was used to evaluate protein reduction after Marc1 or Marc2 gene editing and normalized against house-keeping gene (calnexin). (B) BAO and its metabolite benzamidine (BA) were extracted from the collected cell media and measured by UV-HPLC. Controls: no cells–no primary hepatocytes plated for incubation of 0.5 mM BAO in serum free media for 2 hours (control for spontaneous conversion from BAO to BA); no BAO–no benzamidoxime added to RFP gRNA treated cells with serum free media (control for BAO/BA in media or cells). Experiment repeated once with comparable results. Red arrows–% reduction of BAO conversion.

https://doi.org/10.1371/journal.pgen.1011179.g008

Marc2 knockout mouse develop neurological defects

Marc1 and Marc2 proteins are highly similar (59%) and share the same substrate preference as mentioned earlier. While our human genetic analysis did not suggest MARC2 plays a role in liver disease in humans (S3 Fig), we decided to generate Marc2 KO mice in the attempt to utilize Marc2 deletion as a surrogate that can help to shed light on the role of molybdenum-containing enzymes on liver disease-relevant conditions in mice. Marc2 KO mice were generated on 100% C57BL/6 genetic background, using the same technique of gene editing as was used for Marc1 KO mouse. Unexpectedly, at the age of 7–10 weeks 100% of both sexes of homozygous Marc2 knockout mice showed rapidly progressing hind limb paralysis. Movement disabilities significantly affected the possibility of the future phenotyping of these mice on NAFLD/NASH-causing diets. Limited characterization of the young mice on chow diet showed reduced body weights and decreased fat mass in Marc2 KO female mice compared to wild-type (S10 Fig), consistent with the previously reported findings [30]. Marc2 KO mouse liver RNAseq profiling showed a very significant increase of xenobiotic-metabolizing enzymes (such as Fmo3, Cyb2b9, and others), which is consistent with its reported role in detoxification pathways [33]; this signature was not present in Marc1 KO mouse (S8 Table). The cause of Marc2 KO neurological phenotype is unknown at present as our human genetics analysis did not reveal any association between human MARC2 pLOFs alleles carriers and neurological defects.

Ethics statement

Ethical approval for UK Biobank (UKB) was provided by the North West Multi-center Research Ethics Committee (MREC; 11/NW/0382), which covers the UK. The GHS MyCode study (GHS) is a health system-based cohort of patients from Central and Eastern Pennsylvania (USA) recruited in 2007–2019. GHS was approved by the Geisinger Institutional Review Board (2006–0258). All used cohorts patients/participants provided their written informed consent to participate in this study.

DNA sequencing and genotyping data

High-coverage whole-exome sequencing was performed using NimbleGen VCRome probes or a modified version of the xGen design from IDT. Sequencing was done using Illumina v4 HiSeq 2500 or NovaSeq instruments, achieving over 20x coverage for 96% of VCRome samples and 99% of IDT samples. Variants were annotated using snpEff and Ensembl v85 gene definitions, prioritizing protein-coding transcripts based on functional impact. pLOF and missense variants were classified for functional impact according to in silico prediction algorithms. Common variant genotyping was performed on one of four SNP array types: Illumina OmniExpress Exome array (OMNI; 59345 samples from GHS), Illumina Global Screening Array (GSA; UPENN-PMBB, BioMe and 82,527 samples from GHS), Applied Biosystems UK BiLEVE Axiom Array (49,950 samples from UK Biobank (UKB)) or Applied Biosystems UK Biobank Axiom Array (438,427 samples from UKB). We retained variants with a minor allele frequency (MAF) >1%, <10% missingness, Hardy-Weinberg equilibrium test P-value>10⁻¹⁵. We imputed the genotyped variants using the TOPMed reference panel [42] using the TOPMed imputation server [43]. In GHS, imputation was performed separately by genotyping platform. Further details are provided elsewhere [10].

Genetic analyses were stratified by ancestry and adjusted for age, age2, sex, age-by-sex and age2-by-sex interaction terms, experimental batch-related covariates, the first 10 common variant-derived principal components, the first 20 rare variant-derived principal components using REGENIE. Results were combined across subsets by fixed-effect inverse variance-weighted meta-analysis [10].

Human phenotype definitions

The data cleaning process for continuous traits involved removing non-physiologic lab values and results stemming from invalid or contaminated specimens. The median transaminase values for each individual were extracted from electronic health records at Geisinger Health System (GHS). In the UK Biobank (UKB), transaminases were measured using a Beckman Coulter AU5800 at the baseline study visit. Cases of binary diseases were defined based on one or more of the following criteria: self-reported disease obtained from digital questionnaire or interview with a trained nurse, in-patient hospitalization for the disease, or clinical-problem list entries of the disease, according to International classification of Diseases, Ninth (ICD-9) or Tenth (ICD-10) Revision diagnosis code, medical procedures, or surgery due to the disease, death due to the disease, and a disease diagnosis code entered for two or more outpatient visits in separate calendar days. Controls were defined as individuals who did not meet any of the criteria for case status. To minimize misclassification, the liver disease control group was excluded from analysis if (i) non-cases were diagnosed with any type of liver disease (not restricted to the type of liver disease in question), (ii) non-cases with only one out-patient encounter related to the type of liver disease in question, (iii) non-cases diagnosed with ascites presumably related to liver failure, and (iv) non-cases with elevated alanine aminotransferase (ALT) levels (>33 IU/L for men, >25 IU/L for women). For more details on the specific entries and population characteristics, please refer to [10].

Mice and procedures

Marc1^-/- mice (ID #20561) were generated using Regeneron’s VelociGene technology [44,45]. All mice were maintained in the Regeneron Animal Facility during the entire study period. Wild-type (Marc1+/+) and heterozygous (Marc1+/-) littermates were used as controls. All experiments were performed on mixed background mice (75% C57BL/6NTac 25% 129S6/SvEvTac), except RNAseq profiling where mice on 100% C57BL/6NTac background were used.

Marc2 knockout mice (ID #20646) were generated similarly as Marc1 KO mouse using Regeneron VelociGene technology, where second exon of Marc2 gene was replaced with LacZ reporter. Marc2 mice were bred on 100% C57BL/6NTac background.

Cas9-Ready (ver. 2.5, ID #2673) mice, expressing Cas9 transgene under CAG promoter, were generated as previously described [44]. Liver-specific Marc1, Marc2 or Marc1/2 gene ablation was achieved by hepatic Adeno-associated virus serotype 8 (AAV8) delivery (3x10¹⁰ genome copies (GC) per mouse i/v in tail vein) of CAS9 guide RNA (gRNA) against mouse Marc1 or Marc2 gene exons–for Marc1 only (5′-CTGGCCCGGGACCCGAAACG-3′), for Marc2 only (5′- CCCGATCAAGTCCTGCAAGG-3′) and for Marc1/Marc2 double ablation (5′-ACGCCGAGCCAGGTGGACCG-3′). Cas9 gRNA against red fluorescent protein (RGF) was used as a control. Three weeks after AAV8 injection—ablation of hepatic gene was confirmed by qRT-PCR, next generation sequencing and Western Blot.

Male and female mice (one to five per cage) were maintained on a 12 h light/dark cycle at 22 ± 1°C and were fed ad libitum chow (LabDiet, Cat. No 5053). In some experiments, mice were fed high fat high fructose diet (Research Diets, Cat. No D09100310), choline-deficient L-amino-defined (CDAA) diet (Research Diets, Cat. No A16092201i), high fat diet (Research Diets, Cat. No D12492; 60% fat by calories) or high sucrose diet (Research Diets Cat. No D19022101), as indicated in figure legends. Mouse experiments were performed on age-, sex- and strain-matched littermates. All animal procedures were conducted in compliance with protocols approved by the Regeneron Pharmaceuticals Institutional Animal Care and Use Committee.

Mice and human genotyping

DNA from mouse and human livers were extracted by DNeasy Blood & Tissue Kit (Qiagen). DNA area including mouse Marc1 Exon 2 and 3 regions was amplified using Platinum SuperFi II DNA Polymerase (Thermo Fisher) using primers 5′-aattgctgctacctggtgct-3′ and 5′-tggttcatgagggttgtcgg-3′. PCR product was digested by EcoRV restriction enzyme (New England Biolabs) and separated on 0.8% Agarose gel by electrophoresis. Pair of primers 5′-gctaggagcagcttttctga-3′ and 5′-caacagagccgaggtcatca-3′ were used to amplify whole human MARC1 gene exon 3 by PCR reaction, and ExoSAP-IT Express PCR Product Cleanup Kit (Thermo Scientific) was used to remove both primers before sequencing. Human MARC1 165A/T and 187M/K genetic variants were detected by Sanger sequencing.

Human samples

Fresh frozen human liver samples were acquired from various vendors (LifeNet Health, BioIVT and QPS Medicals). Samples were selected by shortest time period between patient deceased and when liver samples were collected, no RNA degradation (RNA integrity number (RIN) score), absence of hepatitis B and C, liver oncology, severe liver inflammation/fibrosis and minimal or no alcohol use history (all reported by vendor).

RNA preparation and RNA-sequencing read mapping

Total RNA was purified from Wild type and heterozygous/homozygous Marc1 or Marc2 knockout mice tissues using MagMAX-96 for Microarrays Total RNA Isolation kit (Life Technologies), according to manufacturer’s specifications. Genomic DNA was removed using MagMAX Turbo DNase buffer and TURBO DNase from the MagMAX kit listed above. Messenger RNA was purified from total RNA using Dynabeads mRNA purification kit (Invitrogen). Strand-specific RNA sequencing (RNA-seq) libraries were prepared using KAPA mRNA-Seq Library Preparation kit (Kapa Biosystems). After mRNA quality control analysis, RNA-seq libraries were prepared and long read sequencing (75bp, single end, 15M reads) was used for all samples. Sequencing was performed on Illumina HiSeq 2500 by a multiplexed single-read run with 33 cycles. Raw sequence data (BCL files) were converted to FASTQ format via Illumina bcl2fastq v2.17. Reads were decoded based on their barcodes and read quality was evaluated with FastQC (www.bioinformatics.babraham.ac.uk/projects/fastqc/). Reads were mapped to the mouse genome (NCBI GRCm38) using ArrayStudio software (OmicSoft Corp.) allowing two mismatches. Differential expression analysis was performed using DESeq2 (v1.38.2) with default parameters.

qRT-PCR (Taqman)

Liver and white adipose tissue (~50 mg) or cell line (HuH-7) pellet were homogenized in Trizol (Thermo Fisher), and chloroform was used for phase separation. The aqueous phase, containing total RNA, was purified using MagMAX-96 for Microarrays Total RNA Isolation Kit (Life Technologies), according to manufacturer’s instructions. Genomic DNA was removed using RNase-Free DNase Set. SuperScript VILO Master Mix (Thermo Fisher) was then used to reverse-transcribe mRNA into cDNA. The resultant cDNA was amplified with SensiFAST Probe Lo-ROX using the 12K Flex System (BioCat.). Data are presented as a change in gene expression relative to the housekeeping gene, mouse beta-actin (Actb) or human 36B4 (RPLP0), determined using the delta-delta-Ct method [46]. RT-PCR (Taqman) primer sequences for mouse Marc1 mRNA detection: probe sequence CCTCCAGTGCAGAGTGCATGGC, forward primer: GCCTGCCACAAACCCACT and reverse primer GAGCTGCATCCTCTCCACAATC, targeting mouse Marc1 mRNA exon 2 and 3 of open reading frame.

Expression of MARC1 in cultured hepatocytes

The cDNA for human MARC1 (NCBI NM_022746.4) was cloned downstream of the constitutive HSV thymidine kinase (pTK) [47] or CMV promoter in pcDNA 3.1+ plasmid backbone. Single or triple FLAG tags (DYKDDDDK) with GGGGS linker were placed at the C-terminus of each plasmid construct. In some initial studies pCMV-XL6 (C- terminal 1x FLAG/MYC tag, CMV promoter) plasmids (Origene) were used [5]. Single nucleotide changes were introduced using the QuikChange site-directed mutagenesis kit (Stratagene) and confirmed by Sanger sequencing.

Human hepatoma (HuH-7) cells, which tested negative for mycoplasma, were obtained from the Creative Bioarray (Cat. No CSC-C9441L), transfected with plasmids expressing wild-type or variant human MARC1 using TransIT-LT1 Transfection Reagent (Mirus). HuH-7 cells were grown to 90% confluence in high glucose DMEM with 10% full calf serum (FCS) plus 100 IU/ml penicillin and 100 μg/ml streptomycin, cells cultivated in 37°C 5% CO₂ incubator.

Assessment of MARC1 protein degradation

Plasmids encoding empty vector (EV), wild-type (WT) and common variants (165T) of human MARC1 (with C terminal 1x FLAG tag, pcDNA 3.1+ plasmid backbone) were transfected in HuH-7 cells using TransIT-LT1 Transfection Reagent (Mirus, Cat. No MIR 2300) according to manufacture protocol. Cells were grown 48 hours in full media (high glucose DMEM with 10% full calf serum (FCS) plus 100 IU/ml penicillin and 100 μg/ml streptomycin), then DMSO only (vehicle) or 10 uM MG-132 in DMSO (proteasomal inhibitor) or 10ug/ml chloroquine in water (lysosomal inhibitor) plus DMSO separately in the same dish were added in cell media, cell incubated for additional 8 hours. Later, cells were collected by scraping, solubilized in 1x RIPA buffer (Millipore) with protease inhibitors, proteins measured, denatured/reduced, and separated on SDS-PAGE (4–20%) gels and blotted with corresponding antibodies Flag tag (MARC1-Flag), LC3I/II, Ubiquitin and Calnexin antibodies. Ubiquitin was used as proteasomal inhibitor control, LC3B-I/II as lysosomal inhibitor control [48]. In the cycloheximide (CHX) chase assay, CHX (Sigma-Aldrich, Cat. No C7698; 300 μg/ml in DMSO) was added dropwise to the full media of HuH-7 cells. The degradation of the MARC1 protein was then assessed at 0, 3, 6, and 9 hour intervals. In addition, a combination treatment of CHX (300 μg/ml) plus MG-132 (10 uM) or CHX (300 μg/ml) plus chloroquine (10ug/ml) was utilized. DMSO was used for the control group treatment and was added to each well with the combinational treatments.

Western blot

Tissues or hepatic cell line pellets were resuspended in 1x RIPA buffer (EMD Millipore) supplemented with protease inhibitors (Sigma Aldrich) and disrupted by 10 passages through a 25-gauge needle (for cell lines), but tissues were disrupted with FastPrep-24 5G homogenizer with ceramic beads (MP Biomedicals, Cat No 116005500/6913-500)). The homogenates were centrifuged at 12,000 × g for 15 min at 4°C to collect postnuclear fraction. Proteins from white adipose tissues were extracted by commercial kit (Invent Biotechnologies, Cat. No AT-022). Post-nuclear supernatant protein concentrations were determined by BCA Protein Assay (Thermo Scientific, Cat. No 23227). Identical amounts (10–60 μg) of protein were size-fractionated on 4–15 or 4–20% gradient SDS-PAGE gels (Bio-Rad) under reducing conditions, transferred to PVDF membranes (Immobilon P, Millipore, Cat. No IPVH00010). The membranes were blocked with 5% milk in 0.1% Tween-20 and probed with the indicated primary antibodies, signal detected using an enhanced chemiluminescent detection system (Pierce Biotechnology, Cat. No ECL 37069) and imaged with Amersham Imager 600 (GE Healthcare Life Sciences). Amersham Imager 600 built-in software was used to detect intensities of blot signals. Primary antibodies used in studies: Calnexin (Enzo Life, Cat. No ADI-SPA-860-J; 1:3000), Flag tag (Sigma Aldrich, Cat. No F1804; 1:1000), mouse CYB5B (Proteintech, Cat. No 15469-1-AP; 1:1000), mouse CYB5R3 (Proteintech, Cat. No 10894-1-AP; 1:1000), human MARC1 (Abcepta, Cat. No AP9754c 1:1000), human MARC2 (Proteintech, Cat. No 24782-1-AP 1:1000), mouse Marc2 (Sigma Aldrich, Cat. No HPA015085; 1:1000), Ubiquitin (Cell Signaling, Cat. 3936; 1:1000), LC3-I/II (Cell Signaling, Cat. No 3868, 1:1000).

Marc1 antibody production and validation

Polyclonal anti-mouse Marc1 antibodies were produced by immunization of rabbits with fragment of mouse Marc1 protein (NCBI NP_001277202.1, aa191-340) produced in E. coli. After the last immunization of rabbits, serum antibodies were affinity purified using mouse Marc1 specific peptide CSEQALYGKLPIFGQYFALENPGTI (aa 306–329; GenScript). Generated antibodies were validated on wild type and Marc1 KO mouse liver samples using Western Blot. In most experiments purified rabbit anti mouse Marc1 IgG (batch DB0161 (1ug/mL)) was used.

Liver histology

Liver tissues were collected from isoflurane-anesthetized/cervical dislocated mouse, fixed in 4% paraformaldehyde (PFA) for 24 hours. The fixed tissues were embedded in paraffin, sectioned, and stained with hematoxylin and eosin (Histoserv, Inc.).

Picro-Sirius Red staining was done on PFA fixed, unstained paraffin embedded liver sample slides. After heating, the slides were deparaffinized with xylene, ethanol, and distilled water, then stained in Bouin’s solution (Sigma Aldrich Cat. No HT10132) and 0.1% Picro-Sirius Red solution (Sigma Aldrich Cat. No 365548), fixed with 0.5% acetic acid solution. Finally, slides were washed and mounted using Cytoseal (Epredia, Cat. No 831016).

For CD45 immunohistochemistry staining, automated staining was performed on Leica Bond RX autostainer (Leica Biosystems). Slides were deparaffinized with Bond Dewax solution (Leica Biosystems, Cat. No AR9222) followed by antigen retrieval with ER2 (EDTA-based) buffer (Leica Biosystems, Cat. No AR9640) at 100°C for 30 minutes. Anti-CD45 antibody (Cell Signaling, Cat. No 70257) was added at 0.1 ug/ml followed by 1 hour incubation at room temperature, followed by chromogenic detection with Bond Polymer Refine Detection kit (Leica Biosystems, Cat. No DS9800) that includes anti-rabbit HRP polymer, DAB and hematoxylin counterstain. Slides were washed between steps with Bond wash solution (Leica Biosystems, Cat. No AR9590). After staining, slides were dehydrated in increasing concentrations of ethyl alcohol and xylenes and mounted with Surgipath Micromount mounting medium (Leica Biosystems, Cat. No 3801731), dried and scanned on Aperio AT2 scanners (Leica Biosystems).

To measure area of cytosolic lipid droplets, fibrosis or CD45 positive cells, stained slides were scanned with Leica Aperio AT-2 Scanner and whole tissue area, non-stained area, and the area of vessels were qualified by HALO Classifiers software. The area of lipid droplets/fibrosis/CD45 (%) was calculated by subtracting the area of vessels from non-stained area and then divided by the whole tissue area.

Imaging of MARC1 intracellular localization

HuH-7 cells (Creative Bioarray, Cat. No CSC-C9441L) were cultured in complete medium (high glucose Dulbecco’s modified Eagle’s medium with 10% fetal calf serum (FCS) plus 100 IU/ mL penicillin and 100 mg/mL streptomycin. On day 0, cells were transfected with pcDNA 3.1+ (CMV promoter) containing plasmids with no gene (empty vector) or human MARC1 wild type and common variants with C terminal FLAG/MYC tags. Transfection was done with Neon Transfection System (Thermo Fisher, Cat. No MPK5000/MPK1025) with pre-validated settings (pulse– 1230 V; pulse width– 20 ms; pulse numbers: 3) according to producer instructions. Cells were plated on μ-Slide dishes covered with ibiTreat (Ibidi, Cat. No 80826) in full media for 48 hours, after cell media was changed to pre-warmed serum-free media with 200nM Mitotracker Orange CMTMRos staining solution (Thermo Fisher, Cat. No M7510) and incubated for 20 minutes in 37°C 5% CO₂ in the dark. Cells were washed, fixed and permeabilized with Triton X100 and blocked with 5% donkey serum supplemented by 2% BSA. After the final wash, cells were incubated with Flag antibody (Sigma Aldrich, Cat. No F1804; 1:1000) for 1h RT, washed and incubated with secondary antibody (Alexa Fluor 647 AffiniPure Donkey Anti-Mouse IgG (Jackson ImmunoResearch Inc., Cat. No 715-605-151) RT for 1 hour. After the final wash, cells were incubated in Mounting Medium with DAPI (Ibidi, Cat. No 50011) and imaged with Leica confocal microscope.

Marc1/Marc2 benzamidoxime (BAO) reduction assay in mouse primary hepatocytes

10–12 week old male Cas9 transgenic mice (Cas9-Ready V2.5) were injected in tail vein with 3x10¹⁰ genome copies (GC) of AAV8 containing Cas9 gRNA against Marc1, Marc2, Marc1/2 (one gRNA targeting both genes) or control gRNA (anti red fluorescent protein (RGF)). 2–4 weeks after virus injection, mice were sacrificed by lethal isoflurane inhalation and cervical dislocation, and primary hepatocytes isolated, counted and plated on poly-D-lysine pre-coated plates [49]. Cells were kept in incubator (37°C, 5% CO₂) in full media (Williams E media with 10% full calf serum (FCS) plus 100 IU/ml penicillin, 100 μg/ml streptomycin and 2 mM L-glutamine) to attach to the plate (4h). After attachment, cells were washed with PBS once and incubated in serum-free media (low glucose DMEM plus 100 IU/ml penicillin, 100 μg/ml streptomycin and 2 mM L-glutamine, 10 μM sodium molybdate dihydrate) with 0.5 mM benzamidoxime for 2 hours. After reaction, cell media was collected, spun 1000 x G for 5 min at 4°C, supernatant collected, reaction stopped by adding ultra-pure methanol (1:1, vol/vol), spun 21000 x G 5 min 4°C, supernatant collected and diluted in 20 mM ammonium bicarbonate 1:5 (vol/vol). After media collection, protein from all primary cell plates were extracted by 1x RIPA buffer with protease inhibitors, total protein amount measured by BCA assay. Reduced protein lysates in Laemmli SDS sample buffer were size-fractionated on 4–20% SDS-PAGE gel and blotted with corresponding antibodies.

Benzamidoxime (BAO) and its metabolite benzamidine (BA) were measured in cell media by HPLC-UV. All HPLC analyses were performed using a Waters ACQUITY I-Class UPLC system Separation Module with a Waters ACQUITY UPLC Photodiode Array Detector. Waters Empower 3 Build 3471 integration software was used for data analysis. Benzamidoxime and benzamidine were separated on a Waters Viridis CSH Fluoro-Phenyl Column with a particle size of 1.7 μm, a diameter of 2.1 mm, and a length of 50 mm. The mobile phase was composed of 20 mM ammonium bicarbonate at pH 8.5–8.6 and 30% acetonitrile (vol/vol) under isocratic conditions with a flow rate of 0.2 mL/min and a sample injection volume of 2 μL. The total run time was 5 minutes (retention time of benzamidoxime: 1.1 ± 0.2 minute, benzamidine: 1.7±0.2 minute), and the detection wavelength was set at 229 nm. The column temperature was maintained at 40°C, while the sample storage temperature was kept at 5°C. To quantify Benzamidoxime depletion and Benzamidine conversion, calibration curves were used with concentration ranges of 0.1–2 mM and 0.00832–1.04 mM, respectively. In addition, a diluted cell media blank was injected to check for any potential interference in both benzamidoxime and benzamidine measurements. All standards were prepared in experiment used cell media to closely mimic the sample matrix.

Lipid analysis

Circulating triglycerides (TG), total cholesterol (TC), LDL-C, non-esterified fatty acids (NEFA), alanine aminotransferase (ALT), aspartate aminotransferase (AST), urea nitrogen, creatinine, glucose, inorganic phosphate and alkaline phosphatase (ALK) levels were determined in serum using ADVIA Chemistry XPT blood chemistry analyzer (Bayer). Non-HDL-C levels were calculated by subtracting HDL-C from TC values. Liver lipid levels were evaluated as previously described [39,50].

Statistical analysis

Statistical and graphical data analyses were performed using Microsoft Excel and Prism 9 (GraphPad Software, Inc.). Mean values were compared using unpaired two-tailed t-tests or one-way ANOVA. Data shown as mean values with standard error. In box and whisker plots, the middle line is plotted at the median, the upper and lower hinges correspond to the first and third quartiles, and the upper and lower whiskers display the full range of variation (minimum to maximum). Grubbs’ test was used to determine and remove significant outliers.