Advertisement
  • Loading metrics

Neuronal SKN-1B modulates nutritional signalling pathways and mitochondrial networks to control satiety

Abstract

The feeling of hunger or satiety results from integration of the sensory nervous system with other physiological and metabolic cues. This regulates food intake, maintains homeostasis and prevents disease. In C. elegans, chemosensory neurons sense food and relay information to the rest of the animal via hormones to control food-related behaviour and physiology. Here we identify a new component of this system, SKN-1B which acts as a central food-responsive node, ultimately controlling satiety and metabolic homeostasis. SKN-1B, an ortholog of mammalian NF-E2 related transcription factors (Nrfs), has previously been implicated with metabolism, respiration and the increased lifespan incurred by dietary restriction. Here we show that SKN-1B acts in two hypothalamus-like ASI neurons to sense food, communicate nutritional status to the organism, and control satiety and exploratory behaviours. This is achieved by SKN-1B modulating endocrine signalling pathways (IIS and TGF-β), and by promoting a robust mitochondrial network. Our data suggest a food-sensing and satiety role for mammalian Nrf proteins.

Author summary

Deciding when and how much to eat is important for maintaining health and preventing disease. It requires an intricate molecular level of communication between our nervous, physiological, and metabolic systems. These signals stimulate food intake, and afterwards the feeling of satiety which makes us stop eating. We have studied these phenomena using the simple nematode worm C. elegans which has a fully mapped nervous system and quantifiable food-related behaviours. In C. elegans, chemosensory neurons sense food and communicate this to the rest of the animal via hormones to control food-related behaviour and associated physiological changes. Here we identify a new central node of this system, the C. elegans gene SKN-1B, which acts in two sensory neurons to sense food, communicate food-status to the rest of the worm, and control satiety and exploratory behaviours. It does this by altering hormonal signalling (Insulin and Transforming Growth Factor-β), and by promoting a strong mitochondrial network. The mammalian equivalents of SKN-1B are the NF-E2 related transcription factors (Nrfs), which have previously been implicated with metabolism and respiration. Our data suggest a new food-sensing and satiety role for mammalian Nrf proteins.

Introduction

It is necessary for animals to correctly sense and adapt to food. Information on food cues is obtained via the sensory nervous system, integrated in the hypothalamus, and influences decisions about development, growth and behaviour [1,2]. These signals dictate appropriate food intake and regulate metabolic homeostasis, but are not well understood. In the nematode worm C. elegans, chemosensory neurons detect nutritional status, and relay this information to other tissues via hormones [3]. These hormones activate downstream intracellular mechanisms including the insulin/IGF-1-like signalling (IIS) and transforming growth factor-β (TGF-β) pathways which act to switch behaviour between roaming (looking for and consuming food), dwelling (consuming food) and quiescence (a sleep-like state linked to satiety) depending on nutritional availability [47]. Adaptation to food cues also requires physiological changes, and mitochondrial networks are modulated to maximise energy output [8]. Combined, these appropriate behavioural and physiological changes mean that food levels are correctly perceived, nutrient intake is regulated, and metabolic balance is maintained.

In mammals the NF-E2 related transcription factors (Nrfs) regulate a variety of processes. Nrf2 is known as a key, inducible, oxidative stress response factor but along with other Nrfs has also been implicated in proteostasis and metabolism [9]. C. elegans, has only one sequence and functional Nrf orthologue, SKN-1, but its outputs are thought likely to be distributed between all the mammalian Nrfs [9]. There are three skn-1 isoforms (SKN-1A-C). SKN-1A and SKN-1C are expressed in the intestine and regulated, similarly to the Nrfs, at the level of cellular localisation [10,11]. In contrast, SKN-1B is expressed in two chemosensory neurons, the ASIs, which are thought to act as the worm’s hypothalamus, and is constitutively nuclear [3,10,12]. SKN-1B has been of particular interest with respect to metabolism and respiration, because its action in ASI can mediate the increased lifespan incurred by dietary restriction (DR) [12].

We further tested the role of SKN-1B in DR mediated longevity but found it to be non-essential. Instead, we identify SKN-1B to be deeply ingrained in food-detection and food-related behavioural responses. Specifically, we find that SKN-1B: regulates satiety in response to fasting and re-feeding; promotes exploration in fed conditions; and controls appropriate responses to fasting. Our data suggest that SKN-1B controls food-related behaviour both via modulating the key signalling pathways (TGF-β and insulin signalling), and physiologically through the control of mitochondrial networks. This places SKN-1B at the heart of food-responsive signalling pathways, where it acts to regulate satiety and control metabolic homeostasis. Our data suggest the possibility that Nrfs act to regulate food-sensing and satiety in humans.

Results

SKN-1B contributes to DR longevity, but is not necessarily essential

SKN-1 is a well characterised promoter of longevity: Mutants lacking all skn-1 isoforms are short lived and mild overexpression of SKN-1 extends lifespan [9,13]. In particular, expression of skn-1b in the ASI neurons can mediate the extension in lifespan incurred by a food dilution DR protocol, suggesting that SKN-1B might be a general and essential mediator of DR (Bishop and Guarente, 2007). Multiple C. elegans DR protocols exist, some of which have different underlying genetic requirements [14], so we explored the specific skn-1b requirement for these other forms of DR. The weaker, ~20% lifespan extension observed in eat-2 mutants required skn-1b (Fig 1A and S1 Table). However, an alternative food dilution protocol that extends WT lifespan more dramatically ~40–60%, and is dependent on skn-1 [15], proved independent of skn-1b (Fig 1B and S2 Table). We conclude that although skn-1b contributes to DR mediated longevity under some conditions, it is not necessarily essential (Fig 1A and 1B and S3 Table)[12]. Like DR, reduced IIS (rIIS) extends lifespan in many species and skn-1 is known to be an important mediator of this [10,16]. However, skn-1b was not required for the long life of daf-2 mutants, suggesting either redundancy among isoforms or a requirement for other isoforms in particular (S1A–S1F and S2 Figs and S4 and S5 Tables). Neither did we observe any requirement of skn-1b for WT lifespan (S1 and S2 Figs and S4 and S5 Tables). In summary, skn-1b does not contribute to longevity under normal or rIIS conditions, but does contribute to the lifespan incurred by specific DR conditions.

thumbnail
Fig 1. skn-1b is required for exploratory behaviour, but is not essential for DR longevity.

A) Effect of skn-1b on eat-2 lifespan. B) Survival of WT and skn-1b mutants in response to bacterial dilution as in [15]. For A and B: Representative experiments shown, individual trials summarised with Log-Rank analysis in S1 and S2 Tables. These DR protocols did not alter SKN-1B::GFP levels (S7B and S7C Fig). We use eat-2 as a DR longevity model as suggested [59], but recent work shows that eat-2 longevity also derives from reduced pathogenesis [60,61]. C. elegans derives nutrients from the bacteria and removing pathogenic components of bacteria will undoubtedly alter its nutritional profile but separating the two is challenging. C) Genetic locus of skn-1 with isoforms, mutants and SKN-B::GFP specific transgene. skn-1b mRNA is not detectable in tm4241 mutants but skn-1a and c mRNA levels are unchanged implying that this allele is skn-1b specific (S3A Fig). skn-1b mutants have normal brood sizes (S3B–S3E Fig). skn-1(zu67) and skn-1(zu135) encode point mutations leading to early stop codons and transcript degeneration via non-sense mediated decay. All skn-1 isoforms have the same binding site, and all Nrfs can bind the same sequence, suggesting the likelihood of overlapping targets. D) wuEx217 SKN-1B::GFP is expressed in ASI neurons. The SKN-1B::GFP translational reporter confirmed that SKN-1B::GFP can be expressed independently from other SKN-1 isoforms, that skn-1b is expressed solely in the ASIs. This expression pattern was confirmed with an endogenous Scarlet::SKN-1B reporter (S3F Fig). SKN-1B::GFP expression varies at different ages (S3G Fig). ASIs confirmed by DiI staining and SKN-1B::GFP was rarely observed in additional neurons (S3H Fig). E) Agar plates showing exploration of a single worm over 16hrs. Assay and controls shown (S4A and S4B Fig). F-H) Quantification of exploration. Mean plate coverage of n>11 worms per group ± st. dev. One representative experiment of 3 biological replicates shown. In F) SKN-1B was rescued using the ukcEx15 and ukcEx16 transgenes. In G) a 2hr period was used to allow quantification of hyperactive male exploration. I) Quantification of worms on different small bacterial lawns. Assay (S5A Fig). Each bar represents a mean of 3 biological replicates ± st. dev. For F-I) Two-tailed t-test *p<0.05, **p< 0.001, ***p<0.0001, NS not significant.

https://doi.org/10.1371/journal.pgen.1009358.g001

skn-1b acts to promote food-related exploratory behaviour

Sensory input via the ASIs affects C. elegans’ three main food-related locomotory behaviours (roaming, dwelling and quiescence) [3,17]. Given that SKN-1B is implicated in DR longevity we explored the role of skn-1b in behaviour using a skn-1b-specific allele (tm4241) (Figs 1C and S3A–S3E). To gain an overview of food-related behavioural patterns, we quantified the ability of skn-1b mutants to “explore” a continuous bacterial lawn during a 16hr period compared to WT, an assay shown to correlate with classical roaming and dwelling assays [18] (S4A Fig). During this period, WTs explored ~80% of the lawn, but skn-1b mutants only explored ~45% suggesting that skn-1b mutants’ exhibit reduced exploratory behaviour (Fig 1E and 1F). We observed similar behaviour in skn-1(zu135) mutants which lack all skn-1 isoforms, but not in skn-1(zu67) mutants which are thought to lack only skn-1a and c (Fig 1C–1F). Furthermore, rescuing skn-1b mutants with a SKN-1B::GFP specific transgene, which drives skn-1b expression from its own promoter specifically in the ASIs, fully restored exploratory behaviour to WT levels (Figs 1D, 1F and S3F).

As some skn-1 isoforms are important for normal embryogenesis [19], it is possible that the skn-1b requirement for normal exploration could be due to disrupted ASI development. However, skn-1 RNAi from the post-embryonic L1 or L4 stage was sufficient to decrease exploration, indicating that this phenotype is not due to a skn-1b-related embryonic development defect (S4C–S4E Fig). skn-1b mutants also performed as well as WT in an assay of thrashing behaviour indicating that their movement was not generally impaired (S4F Fig). We also explored behavioural differences in male C. elegans that have evolved to balance the competing needs of reproduction versus foraging. For instance, in the absence of hermaphrodites, males increase exploratory behaviour to search for mates [20,21]. However, we found that both WT and skn-1b males explored to the same hyperactive degree (Fig 1G). Thus, skn-1b promotion of motility appears to support foraging rather than mate location. Together, we conclude that adult expression of skn-1b in ASIs contributes to normal exploratory behaviour.

The ASI neurons consist of cell bodies that reside anterior to the large bulb of the pharynx, with projections reaching forward to the amphid openings (the worm’s nose) [3]. At the amphid openings, the ASIs express transmembrane receptor-type guanylate cyclases such as daf-11 that relay environmental cues to the cell body [22]. daf-11 mutants have sensory defects and fail to chemotax towards a number of attractants including NaCl and diacyl as well as being required for normal dauer entry and exit [22]. To explore the relationship between skn-1b and daf-11 we tested their epistatic relationship in relation to behaviour. Similarly to skn-1b mutants, we observed an exploratory defect in daf-11 mutants (Fig 1H) and notably, a skn-1b; daf-11 double mutant did not exhibit a greater reduction in exploration (Fig 1H). The lack of an additive effect of these two mutations suggests that daf-11 and skn-1b act in the same pathway to influence behaviour.

In exploration assays C. elegans are cultured on a continuous lawn of E. coli. As skn-1b mutants explore less, we reasoned that they may spend less time away from food than WTs. To test this, we provided the worms with a small lawn of OP50 bacteria in the centre of an otherwise empty plate, and counted the number of worms on and off the bacteria (S5A Fig). Whilst at any given time approximately 25% of WT worms are off a standard OP50 lawn, at the same point all skn-1b mutants remained on the lawn (Fig 1I). Similar mild avoidance of lawns in WT but not skn-1b mutants was seen for other bacteria, including another four E. coli strains (E. coli B, BL21G, HT115 and HB101), Comamonas aquatica (DA1877) and a Pseudomonas sp. (MyB11) (Fig 1I). However, when WT worms are fed B. subtilis (PY79) the proportion on the lawn increases compared to OP50 whereas that of skn-1b mutants remains the same (S5B Fig). Similarly, no differences in lawn avoidance were seen on E. coli W3110 or MG1655 (S5B Fig). As almost all skn-1b mutants are present on an OP50 lawn, it implies that they are behaving in a satiated manner. We also tested whether skn-1b might contribute to a pathogen avoidance response and examined food avoidance behaviour of WT and skn-1b mutants fed pathogenic Pseudomonas aeruginosa. However, both WT and skn-1b mutants avoided the pathogen to a similar extent indicating that skn-1b is not involved in pathogen avoidance behaviour (S5C Fig). Overall, this indicates that skn-1b acts to sense food types rather than pathogenicity and subsequently controls behaviour.

skn-1b regulates behaviour in response to fasting

Exploration allows worms to seek and locate food [4]. When re-fed after a period of fasting, exploration is reduced and worms ‘dwell’ to increase their food consumption and refuel their energy stores, they then enter satiety quiescence [4,5]. These responses are regulated by the ASIs and hormones, so we investigated the contribution of skn-1b. We fasted WT and skn-1b mutants for 1hr and quantified their behaviour upon re-feeding. Whilst WT worms exhibited the expected reduction in exploration under these conditions, skn-1b mutants did not (Fig 2A). We also fasted WT and skn-1b mutants for 16hrs, and examined their exploration following re-feeding. We found that while this more extreme fasting protocol caused a marked decrease in WT activity compared to 1hr fasting, it had no effect on skn-1b mutants (Fig 2A and 2B). This demonstrates that skn-1b is required for behavioural control in response to fasting and re-feeding.

thumbnail
Fig 2. SKN-1B regulates satiety quiescence.

A) Quantification of exploration in fed vs fasted/re-fed conditions, worms fasted for 1hr. Mean plate coverage of n>35 individual worms per group ± st. dev., 3 combined experiments shown. B) Quantification of exploration in fed vs fasted/re-fed conditions, worms fasted for 16hrs. Mean plate coverage of n>7 worms per group ± st. dev., one representative experiment of 3 trials shown. C and D) Time spent in quiescence after fasting/re-feeding. Each bar represents a mean of 3 biological replicates ± SEM, n>40 worms per group. E) Worm volume. Each bar represents a mean of 3 biological replicates, ± st. dev., n>63 worms per group. F) Pharyngeal pumping rate. Each bar represents a mean of 3 biological replicates, ± st. dev., n = 7 worms per group. G) Effect of skn-1b on intake of fluorescently labelled OP50. Each bar represents a mean of 3 biological replicates, ± st. dev., n>42 worms per group. H) Automated measure of movement on a continuous lawn of OP50. Each bar represents a mean of 3 biological replicates, ± st. dev., n>54 worms per group. For A-H) Two-tailed t-test *p<0.05, **p< 0.001, ***p<0.0001, NS not significant.

https://doi.org/10.1371/journal.pgen.1009358.g002

As daf-11 mutants also exhibit decreased exploration, (Figs 1H and 2A), we tested whether daf-11 was required for skn-1b mediated behavioural changes in response to fasting and re-feeding. We found that daf-11 worms, like skn-1b mutants, do not respond to fasting and re-feeding, and that the combined effect of daf-11; skn-1b mutation was non-additive (Fig 2A). That both DAF-11 and SKN-1B are required for worms to modulate their exploratory behaviour in response to fasting and re-feeding provides further evidence that these two proteins act in concert.

The decreased exploration observed in response to fasting and re-feeding can be attributed either to increased time spent dwelling, or in quiescence [4,5]. When dwelling, pharyngeal pumping is normal and C. elegans makes minimal back and forward sinusoidal movement [3]. In contrast, quiescent worms do not pump or move at all [5,6]. As skn-1b mutant’s exhibit reduced exploration we asked whether they also differ in these other behaviours. After fasting, WT worms are quiescent for a longer period during the 3-6hrs after re-feeding, making this the best time to measure satiety quiescence [5,6]. We found that at both 3 and 6hrs after re-feeding, skn-1b mutants spent longer in a quiescent state than WT worms (Fig 2C). Similar numbers of WT and skn-1b mutants quiesce under these conditions (S6A Fig). Together, this suggests that SKN-1B acts to suppress satiety-induced quiescence promoting exit from, but not entry into quiescence.

One factor controlling satiety induced quiescence is daf-11, and daf-11 mutants cannot quiesce [5]. To test the relationship between skn-1b and daf-11 in this regard we measured quiescence in daf-11; skn-1b double mutants. Although daf-11 mutation did slightly reduce the % of skn-1b mutants entering quiescence by ~20%, we found that daf-11 completely suppressed the long quiescence duration of skn-1b mutants (Figs 2D and S6B). This suggests that SKN-1B and DAF-11 have opposing roles in controlling satiety induced quiescence, but that SKN-1B requires functional DAF-11 to act as a molecular switch.

Quiescence is linked to satiety in mammals, and quiescent C. elegans do not pump food into their gut, so these data could imply that skn-1b mutants eat less compared to WT. We observed that skn-1b mutants are approximately 10% larger than WT (Fig 2E). In addition to the time spent on food, the amount of food that a worm eats can be determined by the efficiency and rate of pharyngeal pumping and the amount of time that it spends pumping [5]. To test this, we compared pumping rate in fed WT and skn-1b mutants and observed a modest but statistically significant increase in the latter (Fig 2F). This suggested that skn-1b mutants might ingest more E. coli than WT animals. To explore this further we examined food intake by quantifying uptake of fluorescently labelled OP50. If worms were fed mcherry labelled OP50 continuously (fed conditions), the guts of WT and skn-1b mutants contained similar amounts of bacteria (Fig 2G). However, in response to fasting and re-feeding skn-1b mutants accumulated more OP50 than WT, corresponding to a further increase in pumping rate under these conditions (Fig 2F and 2G). Together this suggests that skn-1b mutation alters feeding and quiescence associated parameters.

As skn-1b mutants exhibit increased satiety induced quiescence, it was possible that they also quiesce more in the presence of food. To test this we measured quiescence in fed conditions using an automated tracking system that detects the time C. elegans spends stationary vs moving. We assumed that stationary worms are quiescing as both roaming and dwelling involve movement. We found that in fed conditions, skn-1b mutants spent less time stationary than WTs, indicating that they quiesce less in fed conditions (Fig 2H). This contrasts with our data in fasted and re-fed conditions, and indicates that skn-1b is specifically required for satiety induced quiescence.

Neuronal SKN-1B expression responds to specific food cues

ASI neurons detect the worm’s environment, including food cues [3]. As skn-1b mediates food-related behaviours (Figs 1 and 2), and can contribute to DR lifespan extension (Fig 1A and S3 Table) [12] we examined SKN-1B expression levels in response to dietary changes. Laboratory C. elegans are fed a homogeneous diet of E. coli OP50, but can thrive on other bacterial lawns [23]. To test whether SKN-1B levels also respond to changes in food type we measured SKN-1B::GFP levels in the ASIs in C. elegans grown on different bacterial strains compared to OP50. SKN-1B::GFP levels were not altered when worms were cultured on E. coli HT115 or HB101, but increased in response to Bacillus subtilis (PY79) or P. aeruginosa (PA14) (Figs 3A, 3B and S7A). This induction of expression was rapid, e.g. occurring after 16hrs on B. subtilis (Fig 3B) and suggests that neuronal SKN-1B::GFP expression increases specifically and rapidly in response to different bacterial diets.

thumbnail
Fig 3. SKN-1B::GFP levels respond to nutritional cues and require daf-11.

A-D) Quantitative fluorescence microscopy of SKN-1B::GFP in response to: A) different bacterial strains, B) being switched to PY79 at the L4 stage, C) 24hrs bacterial dilution [12], or C) 16hrs fasting. For D) a combination of daf-11 mutation and fasting was used. Similar results to those in C) had previously been observed using a SKN-1B/C::GFP transgene [12]. A-D) Imaged at 1 day adults, each bar is the mean of 3 biological replicates ± st. dev. Two-tailed t-test *p<0.05, ***p<0.0001, NS not significant.

https://doi.org/10.1371/journal.pgen.1009358.g003

As skn-1b contributes to DR longevity we also examined the effect of DR on SKN-1B::GFP levels. We found that diluting bacteria in liquid culture increased ASI expression of SKN-1B::GFP (Fig 3C) [12], and that a similar increase was also observed when worms were fasted for 24hrs (Fig 3C). However, the alternative bacterial dilution DR protocol [15] nor the eat-2 mutation had any effect on SKN-1B::GFP levels (S7B and S7C Fig). These data suggest that neuronal SKN-1B levels respond selectively to the amount of food available.

As behavioural effects of skn-1b and daf-11 showed an interaction, we examined their relationship in respect to SKN-1B levels. Interestingly, without functional daf-11, SKN-1B::GFP levels were both significantly reduced, and could no longer increase in response to a 24hr fast (Fig 3D). Thus, SKN-1B requires functional daf-11 to respond to the environment. Together with our behavioural analysis, and given the ASI expression patterns of DAF-11 (amphid opening) and SKN-1B (nucleus), this implies an epistatic relationship for these molecules, linking the external environment to SKN-1B levels and subsequent behaviours.

SKN-1B requires TGF-β signalling to specify satiety-induced quiescence

Our data show that skn-1b is required in the ASIs to regulate food-related behaviours (Figs 1D–1I and 2A–2C). One way that ASIs act is by relaying chemosensory information to the rest of the worm via secretion of neuropeptides [3]. One of these, DAF-7, is the ligand of the canonical TGF-β signalling pathway, but its upstream regulators are not known [24]. ASIs secrete DAF-7 under environmental conditions favourable for growth and reproduction, and DAF-7 expression is highest when worms show high levels of quiescence [24,25]. In addition, expression of daf-7 in ASI has been shown to promote quiescence, whilst daf-7 mutants do not undergo satiety quiescence [5,26]. As skn-1b mutants’ exhibit enhanced quiescence we reasoned that daf-7 might be a contributing factor. To test this, we generated daf-7; skn-1b mutants and measured their ability to undergo quiescence in response to fasting and re-feeding. In agreement with published work, WT animals showed increased quiescence following re-feeding, but daf-7 mutants did not (Fig 4A [5,26]). As before, skn-1b mutants spent longer than WT in quiescence (Figs 2C and 4A), but this effect proved to be completely daf-7 dependent (Figs 4A and S6C). In parallel we examined the expression of a Pdaf-7::Venus reporter in WT and skn-1b mutants. Similarly to skn-1b, daf-7 is only expressed in ASI neurons but its expression increases in response to fasting and remains high for at least 6hrs, presumably supporting entrance into quiescence (Fig 4B and 4C). However, skn-1b mutants showed strongly elevated Pdaf-7::Venus expression in fed conditions, which barely altered in response to fasting or re-feeding (Fig 4B and 4C). Taken together, these data imply that SKN-1B inhibits satiety quiescence in response to fasting and re-feeding by suppressing daf-7 expression and subsequently TGF-β signalling. daf-7 mutants explore less than WT in fed conditions, and in this respect resemble skn-1b mutants (Fig 4D) [4,26]. To further investigate the behavioural epistasis relationship between daf-7 and skn-1b, we examined the exploration of daf-7; skn-1b double mutants, but found that daf-7 and skn-1b effects were non-additive (Figs 4D and S8).

thumbnail
Fig 4. SKN-1B modulates TGF-β signalling and controls satiety.

A) Time spent in quiescence after fasting and re-feeding. Each bar represents a mean of 3 biological replicates, ± SEM, n>9 worms per group. B and C) Fluorescence expression pattern, 20x magnification (B), and levels (C), of Pdaf-7::GFP in ASIs responds to skn-1b mutation and food cues. In (C) each bar represents a mean of 3 biological replicates ± st. dev., n>230 worms per group. NS difference was found between WT samples in fasted vs re-fed conditions and NS difference was found between skn-1b samples at any point. This regulation of daf-7 is unlikely to be direct as there is no SKN-1 binding site within 3Kb of its transcriptional start site. D) Quantification of exploration. Each bar is a mean of 5 biological replicates, n>44 worms per group ± st. dev. All trials shown in S8A–S8F Fig. E) Time spent in quiescence after fasting and re-feeding. Each bar represents a mean of 3 biological replicates, ± SEM, n>10 worms per group. For A, C, D and E: Two-tailed t-test *p<0.05, **p< 0.001, ***p<0.0001, NS not significant.

https://doi.org/10.1371/journal.pgen.1009358.g004

SKN-1B modulates IIS to alter food-responsive behaviour

C. elegans express and secrete ~40 insulin-like peptides (ILPs), at least some of which bind to the DAF-2 insulin/IGF-1-like receptor in multiple tissues [27]. rIIS leads to the de-phosphorylation and nuclear localisation of its downstream target the FOXO transcription factor DAF-16 [28,29]. Activation of DAF-16 has been implicated in a variety of phenotypes including behaviour, longevity, immunity and others–many of which are mediated by DAF-16 activity in the gut [4,6,7,30,31]. To test the impact of skn-1b on this pathway, we examined the cellular localisation of a gut-specific DAF-16a::GFP reporter in both WT and skn-1b mutants. In fed conditions, skn-1b did not affect DAF-16 nuclear localisation (Fig 5A), but fasting for 16hrs led to DAF-16a::GFP accumulation in both WT and skn-1b gut nuclei (Figs 5A and S9A–S9C). Strikingly worms lacking skn-1b could not maintain DAF-16::GFP in their gut nuclei after re-feeding, as WT worms do, reverting to WT levels of nuclear DAF-16::GFP within 3hrs of being returned to food (Figs 5A and S9A–S9C) [32,33]). Thus, skn-1b is required to maintain DAF-16 in the nucleus in response to fasting and re-feeding.

thumbnail
Fig 5. SKN-1B regulates IIS to control behaviour.

A) Quantification of nuclear localisation, WT and skn-1b worms expressing ges-1p::GFP::daf-16 [62], average grading shown. Grading system and total % of worms in each grade (S9 Fig). Combined data from 3 biological replicates shown ± SEM, n>48 worms per group. B) Quantification of exploration. One representative of 3 biological replicates shown ± st. dev., n>10 worms per group. C) Quantification of exploration in fed vs fasted and re-fed conditions. Worms fasted for 1hr. One representative of 3 biological replicates shown ± st. dev., n>35 worms per group. B and C) Similar findings were obtained using daf-2(e1368) (S11A and S11B Fig). D and E) Time spent in quiescence after fasting and re-feeding. Each bar represents a mean of 3 biological replicates ± SEM, total of n>36 worms per group. For C-E) Similar numbers of worms from each group were observed in quiescence (S6D–S6F Fig). For A-E: Two-tailed t-test *p<0.05, **p< 0.001, ***p<0.0001, NS = not significant.

https://doi.org/10.1371/journal.pgen.1009358.g005

Some ILPs, have skn-1 binding sites in their promoters, making direct regulation by SKN-1B possible. One of these is ins-7 which is expressed in several neurons, including ASIs, and the gut [34,35]. We observed an increase in a Pins-7::GFP transcriptional reporter in both the neurons and gut of skn-1b mutant worms (S10A and S10B Fig). INS-7 is reported to be an agonist of DAF-2 in the gut while itself being transcribed downstream of rIIS, resulting a positive feedback loop which propagates and amplifies a downregulation of IIS in this tissue [34]. Increased expression of ins-7 in the gut might therefore explain the reduced DAF-16 nuclear localisation we observe in skn-1b mutants in response to fasting and re-feeding (Fig 5A).

IIS is also implicated in food-related behaviour, and daf-2(e1370) mutants exhibit reduced exploration, similar to skn-1b mutants, dependent on daf-16 (Fig 5B; [4,36]). To try to clarify the regulatory relationship between SKN-1B and IIS we examined the relationship between skn-1b and daf-16 in our behavioural assays by knocking down daf-16 mRNA using RNAi in WT, daf-2(e1370), skn-1b, and double daf-2(e1370); skn-1b mutants. Knockdown of daf-16 had no effect on the exploration of either WT or skn-1b mutants alone, but rescued the exploration deficiency of daf-2 mutants back to WT levels (Fig 5B [4,6,7]). Surprisingly however, daf-16 RNAi had no effect on the exploration of daf-2; skn-1b mutants (Fig 5B). We also examined the relationship between daf-2 and skn-1b in response to food. With food, the reduced exploration of daf-2 and skn-1b mutants was non-additive suggesting that they act in the same pathway (Fig 5B). However, skn-1b and daf-2 mutants respond differently to fasting and re-feeding: skn-1b mutant behaviour is completely unresponsive; but daf-2 mutants respond like WT, reducing their exploration upon re-feeding, a phenotype that seems independent of skn-1b (Figs 2B and 5C) [47]. As the class 1 allele daf-2(e1370) already exhibits very low exploratory behaviour it may be difficult to suppress further, so we also tested a ‘weaker’ class 2 allele daf-2(e1368) which exhibits a milder exploratory defect (S11A and S11B Fig) [37]. Similarly to our e1370 results however, daf-2(e1368) and skn-1b exploratory defects were non-additive in both fed, and fasted and re-fed conditions (S11A and S11B Fig). These data could imply either that skn-1b acts upstream of daf-2 to control exploration in response to fasting and re-feeding, or that daf-2 acts independently of skn-1b to control this behaviour. Overall, our data suggest that for rIIS conditions DAF-16 acts to reduce exploration and SKN-1B acts to promote it.

Our data show that skn-1b impacts on DAF-16 regulation in response to fasting and re-feeding, and skn-1b mutants cannot maintain DAF-16 in gut nuclei under these conditions (Fig 5A). rIIS increases time spent in satiety quiescence dependent on DAF-16 [6,7]. Thus, we decided to explore whether daf-16 contributes to the high levels of quiescence in our skn-1b mutants under rIIS conditions. We found that whilst daf-16 RNAi had no effect on either WT or skn-1b mutant quiescence, daf-2 mutation enhanced quiescence compared to WT, an effect suppressed by daf-16 RNAi (Figs 5D, 5E, S6D and S6E). This supports the fact that daf-16 is required for quiescence in the absence of IIS (Fig 5E) [6,7]. Addition of skn-1b mutation however, further increased daf-2 quiescence, and this was not suppressed by daf-16 RNAi (Figs 5E and S6E). Indeed, the quiescence of daf-2; skn-1b; daf-16 RNAi treated animals was even higher than daf-2; daf-16 RNAi (Fig 5E). That daf-16 RNAi did not affect either WT or skn-1b mutant satiety, indicates that IIS must be reduced for this interaction to occur (Fig 5D and 5E). Overall, these data suggest that SKN-1B acts to maintain nuclear DAF-16, and in doing so allows DAF-16 to promote quiescence in response to rIIS. Together with our other data, these results imply that SKN-1B acts to modulate both TGF-β and IIS in response to food, allowing the outputs of these pathways to control behaviour, placing it as a new central node in ASI behavioural response pathways.

TGF-β and Insulin signalling also interact and increased nuclear localisation of DAF-16 is observed in daf-7 mutants (Shaw et al 2007). Although daf-7 mutants do not quiesce (Gallagher et al., 2013; You et al., 2008; Fig 4A), and daf-7 fully suppresses skn-1b mutant quiescence (Fig 4A), we wondered if removal of DAF-16 had the potential to alter this relationship. To test whether IIS and TGF-β interact to control quiescence downstream of skn-1b we measured satiety induced quiescence in daf-7 and daf-7; skn-1b mutants with and without daf-16 RNAi. However, daf-16 RNAi did not cause any changes in quiescence for either daf-7 or daf-7; skn-1b mutants (Figs 4E and S6F). We conclude that IIS and TGF-β do not interact to control quiescence downstream of SKN-1B.

SKN-1B controls behaviour by maintaining mitochondrial networks in muscle

Our data suggest that SKN-1B acts cell-non-autonomously to regulate behaviour. As food sensing and consumption is closely linked to physiological and metabolic homeostasis [8,38,39], this suggests that skn-1b dysregulation could cause physiological and metabolic disruption to the organism. skn-1b is required for normal behavioural responses to fasting (Figs 1E, 1F and 2A–2C), but skn-1b mutants are not actually starved (Fig 2D and 2E). Despite this, we noted that whilst a population of WT worms evenly distributes over a bacterial lawn, skn-1b mutants display a strong preference for the thicker outer edge “bordering” (S12A and S12B Fig). The edge of the lawn is considered to have reduced levels of O2 (~8%), and bordering has been associated with social behaviours, memory, temperature and starvation [40]. This suggests that skn-1b mutants exhibit signs of starvation despite being well fed. Given that skn-1b mutants are unable to appropriately perceive and respond to food cues, we explored whether the physiological state of skn-1b mutants differs from WT.

Mitochondria are dynamic organelles that change their network morphology, balancing their fission with fusion to maximise energy production [8,39,41]. In worms their morphology has been shown to change in response to starvation [42] as well as various DR protocols [39,43], and can be used to provide clues about an animal’s physiological state. In addition skn-1 has previously been implicated in the maintenance of muscle mitochondrial networks, and anoxia-induced mitochondrial dynamics, raising the question of whether these phenomena might be mediated by skn-1b [44,45]. To explore the possibility that skn-1b impacts mitochondria we examined the mitochondrial networks of WT and skn-1b mutants expressing an outer mitochondrial membrane marker in muscle, myo-3::GFP(mit). We found the networks in skn-1b mutants to have a disorganised appearance, covering significantly less surface area than that of the WT (Figs 6A–6C and S12C). This is similar to the situation observed in fasted WT animals, implying that skn-1b mutants are, at least as far as their mitochondria are concerned, starved (Fig 6A–6C). Fasting skn-1b mutants exacerbated these effects on the mitochondrial organisation, indicating that there are also other factors contributing to this mitochondrial morphology phenotype (Fig 6A–6C). A similar pattern was also observed with a second mitochondrial reporter tomm20::GFP [39] (S12D and S12E Fig). Our data suggest that skn-1b contributes to maintaining muscle mitochondrial networks.

thumbnail
Fig 6. skn-1b contributes to mitochondrial network integrity.

A-C) Expression and quantification of WT and skn-1b mutant worms expressing myo-3::GFP(mit). This muscle specific reporter expresses an outer mitochondrial membrane protein and hence marks all mitochondria, delineating their shape. In B and C) Each bar represents a mean of 3 biological replicates ± SEM, n>62 day 1 adults worms per group. The qualitative scoring system used in C) is shown in S12C Fig. D) Longitudinal sections imaged by Transmission Electron Microscopy (TEM). M = mitochondria, S = sarcomere. Scale bar = 500nm. E) Quantification of TEM: Mitochondrial area compared to WT control. Each bar represents a mean of 2 biological replicates, n>47 images per group ± SEM. F-G) Effect of mitochondrial fission and fusion on mitochondrial networks and behaviour in WT and skn-1b mutants. Controls for effectiveness of RNAi (S14A and S14B Fig). For all graphs: Two-tailed t-tests *p<0.05, **p< 0.001, ***p<0.0001, NS not significant.

https://doi.org/10.1371/journal.pgen.1009358.g006

We then used transmission electron microscopy to examine mitochondrial morphology more closely. Muscle wall mitochondria from WT and skn-1b mutants were compared using sections taken from whole worms. Whist the mitochondria of fed WT animals were rounded, those in the skn-1b mutants, were longer and irregular, exhibiting a fused-like state (Figs 6D, 6E and S13). This phenotype could be rescued by re-introducing SKN-1B::GFP into skn-1b mutants (Fig 6D). This fused state was also observed in sections from WT fasted animals, supporting the idea that skn-1b mutant mitochondria think they are starved (Figs 6D, 6E and S13). However, fasting skn-1b mutants caused further deterioration of mitochondrial networks implying that additional factors also contribute to this phenotype (Figs 6D, 6E and S13). In our hands, although the fluorescent images provided evidence of mitochondrial disruption in each case, it was the electron microscopy that showed the precise nature of the disruption (Figs 6A–6E, S14A and S14B). These data together support a model whereby skn-1b acts to directly control mitochondrial homeostasis in response to food levels, balancing their fission and fusion.

Mitochondrial membrane proteins are required for mitochondrial fusion and fission: eat-3/Opa1 and fzo-1/Mfn1 promote fusion and drp-1/Drp1 promotes fission [46]. We examined muscle mitochondrial networks, in C. elegans fed either eat-3, fzo-1 or drp-1 RNAi using both fluorescent (myo-3::GFP(mit) and electron microscopy. Mitochondria in animals fed eat-3 or fzo-1 RNAi are smaller and more disjointed (as the mitochondria are unable to fuse), whereas those in drp-1 RNAi fed animals are more elongated (as they cannot fission) (S14A and S14B Fig). Mitochondrial dynamics have previously been implicated in behavioural responses [41]. So, given the behavioural role of skn-1b and its importance for maintaining mitochondrial networks, we tested whether the two were linked. Strikingly, we found that whilst neither eat-3 or fzo-1 RNAi had any effect on WT exploratory behaviour, both completely rescued skn-1b mutant exploration to normal levels (Fig 6F and 6G). drp-1 RNAi however, had no effect on either WT or skn-1b behavioural patterns (Fig 6F and 6G). Together, this supports a model whereby SKN-1B acts to regulate mitochondrial networks, particularly mitochondrial fission, and that this in turn controls food related behaviour.

Discussion

Ability to correctly identify a feeling of satiety impacts directly on health. For example, perception of hunger when food is plentiful, can make individuals overeat and gain excess weight, having catastrophic implications for their metabolic status and long-term health [47]. Here we show that in C. elegans, the transcription factor SKN-1B, regulates satiety behaviour. SKN-1B acts in two hypothalamus-like chemosensory neurons to sense and communicate nutritional status to the rest of the organism. It then controls the animal’s behavioural responses by modulating key nutritional signalling pathways, and maintaining mitochondrial networks (Fig 7).

thumbnail
Fig 7. SKN-1B integrates with key nutritional signalling pathways, and regulates mitochondrial networks to control satiety-related behaviour.

Food-related behaviour is controlled by interactions between food cues, SKN-1B, downstream signalling pathways (cGMP, TGF-β and IIS), and mitochondria. SKN-1B receives food cues via cGMP signalling (DAF-11). In response to fasting and re-feeding SKN-1B controls satiety quiescence: SKN-1B suppresses daf-7 expression in the ASIs, downregulating TGF-β signalling and suppressing quiescence (Fig 4A–4C). Fasting also induces DAF-16 nuclear localisation which is maintained after re-feeding to promote quiescence: SKN-1B is required for this response, possibly by acting upstream of both pathways (Fig 5A–5E) [6,7]. In parallel, SKN-1B is also acts to control food-related behaviour by maintaining mitochondrial networks. Overall, this study identifies neuronal SKN-1B as a novel factor in controlling satiety behaviour in response to dietary signals.

https://doi.org/10.1371/journal.pgen.1009358.g007

Neuronal SKN-1/Nrf mediates the perception of food and satiety

Animals, including C. elegans, modulate their behaviour by integrating information about their external environment with internal cues. Our data identify SKN-1B as a novel, major regulator of food-related behaviour. SKN-1B levels respond to food availability and memories of fasting events to promote exploration in fed conditions, and suppress quiescence in response to fasting and re-feeding. We propose that SKN-1B acts as a molecular switch, allowing fine-tuning of behaviour in response to environmental change.

It is intriguing that the response of SKN-1B::GFP expression to diet and associated behavioural responses are not always consistent i.e. similar SKN-1B::GFP increases in expression with B. Subtilis (PY79) and Pseudomonas (PA14) leads to opposite behavioural responses (Figs 3A, 3B and S5C). The transcriptional outputs of other SKN-1 isoforms are known to differ depending on the stimulus [35] and it is possible that this is also the case for SKN-1B. Alternatively, in the case of the pathogen response, perhaps additional immune signals are sufficient to override any satiety behaviour in the skn-1b mutants.

The constitutively nuclear expression of SKN-1B in ASI neurons (Figs 1D, S3F and S3J) means that it requires the receptor type guanylate cyclase daf-11 expressed at the amphid opening of the ASI to sense the environment. The expression pattern of daf-11 and skn-1b in the ASI, the requirement of daf-11 for SKN-1B::GFP expression, and the non-additive behavioural effects of daf-11 and skn-1b strongly imply that these molecules act in the same pathway (Figs 1H, 2A and 3D). daf-11 has previously been mapped to act upstream of both IIS and TGF-β pathways [5,48,49], and our data identifies a new mode of daf-11 action (Fig 7). Although daf-11 and skn-1b both act to control quiescence, daf-11 mutants exhibit decreased quiescence whilst skn-1b mutants have increased quiescence compared to WT [5] (Fig 2C and 2D). Therefore, although daf-11 plays an important role in relation to skn-1b’s ties to the environment, it is likely that their behavioural responses to fasting and re-feeding are independent (Fig 7). Complete ablation of the ASIs however actually has the opposite effect to skn-1b mutation, reducing satiety-induced quiescence [26]. Thus, genetic removal of SKN-1B does not “break” the neuron. Instead, we propose that specific and rapid changes in SKN-1B levels (Fig 3A–3D) provide sensitivity for modulating behaviour and physiology.

We found that SKN-1B acts specifically to suppress satiety induced quiescence (Fig 2H). In fact, our movement data in fed conditions suggests that skn-1b mutants may move slightly more than WT (Fig 2H). As fed skn-1b mutants explore less than WT, we could extrapolate that in fed conditions, they spend more time dwelling. Therefore, SKN-1B acts to control different behaviours depending on food status.

Neuronal SKN-1B modulates TGF-β and IIS to control food-related behaviour

IIS and TGF-β hormone signalling are nutritionally regulated and integral to many processes in worms and mammals. They are regulated by ILPs and NLPs, including the TGF-β ligand DAF-7. In worms they are known to control development, growth, immunity, lifespan and age-related decline [50,51]. Our data suggest that SKN-1B is a sensory switch in the ASIs, acting upstream to modulate both IIS and TGF-β signalling and allowing accurate environmental perception and behavioural control. By regulating DAF-7 in ASIs and DAF-16 in the gut SKN-1B bridges the gap between the external environment and the rest of the worm (Figs 4B, 4C, 5A and 7).

IIS is a conserved pathway for detecting food [52] and reducing IIS using daf-2 mutants induces quiescence dependent on DAF-16 [53]. Without skn-1b however, the contribution of daf-16 to quiescence is abolished (Fig 5E). Thus, under normal circumstances skn-1b allows the worm to achieve appropriate levels of quiescence for its environment (Fig 7). This interaction between skn-1b and IIS/daf-16 was only revealed in the context of rIIS, and under normal conditions the two do not interact genetically to control behaviour (Fig 5B–5E). This suggests to us that in WT C. elegans ILP signalling originating in the ASIs has to be “programmed” to downregulate IIS for this relationship to be important. Several ILPs could do this, but our data suggest that the insulin receptor agonist INS-7 may be important (S10A and S10B Fig). However, ILPs like INS-7 are differentially expressed in multiple tissues (S10A Fig), and have tissue specific functions making it likely that a complex intercellular network of ILP signalling will be required.

One mechanism via which DAF-16 can regulate quiescence is via food consumption. Worms carrying daf-2 mutation eat less, and daf-2; daf-16 double mutants consume more food [54]. Our skn-1b mutants have reduced levels of nuclear DAF-16::GFP in their gut, which could simulate a situation comparable to daf-16 knockdown. However, when fasted and re-fed i.e. conditions that stimulate satiety quiescence, skn-1b mutants exhibit higher pharyngeal pumping rates, accumulate more E. coli in their guts, and are slightly larger than WTs indicating that under these conditions they might be eating more (Fig 2E–2G). In addition, DAF-7 levels are also higher in well fed conditions [26]. Thus, it is possible that altered feeding parameters in skn-1b mutants contribute to the increase in daf-7 reporter expression and satiety induced quiescence behaviour.

SKN-1B maintains mitochondrial networks to control food-related behaviour

We show SKN-1B acting cell non-autonomously in the gut to alter IIS, and in muscle to alter mitochondrial physiology (Figs 5A, 6A–6E, S12D, S12E, S13 and S14). SKN-1B supports an organised mitochondrial network, balancing fission and fusion to support energy homeostasis in both fed and fasted, re-fed conditions (Figs 6A–6C, S12D and S12E). Mitochondrial homeostasis is implicated in a number of processes including ageing and behaviour. A delicate balance between fission and fusion is necessary for DR to extend lifespan [39]. The fused mitochondria visible in skn-1b mutants suggests that SKN-1B acts to control mitochondrial states (Figs 6C–6E and S13). The mitochondrial network observed in skn-1b mutants resembles that of fasted or DR worms [39], but it is unlikely that skn-1b mutants are physically starved (Fig 2E–2G). We suggest instead, that this occurs via endocrine factors from the ASI leading to a perceived state of malnourishment, with knock-on effects for mitochondrial physiology.

Our data also shows that breaking the fused mitochondrial networks of skn-1b mutants using eat-3 or fzo-1 RNAi is sufficient to rescue their exploratory behaviour defect (Figs 6F–6H, S14A and S14B). This strongly suggests that SKN-1B mediated control of mitochondrial networks is required for correct behavioural responses to food.

Our work also shows that whilst some DR protocols require skn-1 to extend lifespan [15], ASI specific skn-1b is not essential (Fig 1A and 1B and S1S3 Tables) [12]. Our results indicate either that the requirement for its expression varies among DR conditions or that there is redundancy for other SKN-1 isoforms in this regard. The role of SKN-1B in regulating mitochondrial networks may also influence the involvement of skn-1b in DR longevity [12]. Mitochondrial networks are optimised for ATP production and as such generate increased levels of Reactive Oxygen Species (ROS). Fasting and DR cause mitochondrial fusion and maximise ATP production [8]. Mitochondrial homeostasis is required for DR to extend worm lifespan [39] and, there is also evidence that small increases in ROS increase neuronal SKN-1 expression and promotes longevity [38]. It is possible that skn-1b mediated behaviours, influence the impact of DR on lifespan. Different DR protocols cause varying degrees of life extension, and skn-1b was required where the increases were modest. As SKN-1B subtly affects feeding this might account for these differences, potentially via changes in skn-1b dependent mitochondrial homeostasis.

Potential for conservation

In mammals, linking food-status to behaviour is controlled by the neuroendocrine system, primarily the hypothalamus: Firstly by the quantity or quality of available food; and secondly by the organism’s internal state i.e. satiety signalling by gut peptides [47]. Our data identifies SKN-1B as a key regulator of satiety quiescence, thought to mimic satiety in mammals [5].

Food levels also alter behaviour in fruit flies, and foraging strategies have been observed that allow adaptation to different food concentrations [55,56]. This suggests that these processes are conserved. Nrfs have been detected in the hypothalamus [57] and some Nrfs also have short isoforms for which functions are not known, suggesting possible conservation. Central Nervous System-specific Nrf1 knockout mice also show neuro-dysfunction phenotypes suggesting that Nrf1 plays an important role here [58]. Our data suggest the interesting possibility that mammalian Nrf proteins might act in the brain to regulate satiety, offering a novel pharmacological target for controlling food-related pathology.

Methods

Strains and cloning

Worms were cultured according as previously described [63], and maintained at 20°C unless otherwise indicated. The following strains were used: N2 CGC hermaphrodite stock, GA1058 skn-1b(tm4241), EU1 skn-1(zu67), EU31 skn-1(zu135), JMT31 daf-2(e1370), DR1572 daf-2(e1368), DR1574 daf-2(m1391), JMT32 daf-2(e1370); skn-1b(tm4241), GA1060 daf-2(e1368); skn-1b(tm4241), JMT5 daf-2(e1391); skn-1b(tm4241), GA1017 N2 wuEx217[Pskn-1b::skn-1b::GFP; rol-6] (was used for all microscopy and expression analysis), GA1030 daf-2 wuEx217, GA1045 daf-2; daf-16 wuEx217, GA1034 N2 wuEx253[Pskn-1b::GFP], GA1040 daf-2 wuEx253, GA1042 daf-2; daf-16 wuEx253, DA1116 eat-2(ad1116), JMT7 eat-2(ad1116); skn-1b(tm4241), DR47 daf-11(m47ts), CB1372 daf-7(e1372), JMT68 daf-7(e1372); skn-1b(tm4241), JMT70 daf-11(m47); skn-1b(tm4241), PR678 tax-4(p678), MT1072 egl-4(n477), JMT66 skn-1b(tm4241) ukcEx15 [Pskn-1b::skn-1b::GFP; myo-3::mcherry], JMT67 ukcEx16 [Pskn-1b::skn-1b::GFP; myo-3::mcherry]. JMT66 and JMT67 were used for the behavioural rescue experiment as they do not have the roller phenotype. Their expression pattern is identical to that in Fig 1D. COP1836 knu733[wrmScarlet::skn-1b] (created using CrispR by Knudra Biotech), GA1064 muEx227[ges-1p::GFP::daf-16a], SJ4103 zIs[myo-3::GFP(mit)], JMT90 skn-1b(tm4241) zIs[myo-3::GFP(mit)], WBM671 wbmEx289[myo-3p::tomm20(aa1-49)::GFP::unc54 3’UTR], JMT76 skn-1b(tm4241) wbmEx289[myo-3p::tomm20(aa1-49)::GFP::unc54 3’UTR], JMT82 skn-1b(tm4241) muEx227[ges-1p::GFP::daf-16a]; JMT50 drcSI7[unc-119;Pdaf-7::Venus], JMT75 skn-1b(tm4241) drcSI7[unc-119;Pdaf-7::Venus]. JMT51 skn-1b(tm4241) wwEx66 [Pins-7::GFP + unc- 119(+)] was made by crossing HT1702 wwEx66 [Pins-7::GFP + unc- 119(+)] [64] with GA1058 skn-1b(tm4241). Note JMT7 was genotyped used a PCR for skn-1b(tm4241) and a pumping rate assay for eat-2. eat-2 pumping was ~90pumps/min (compared to ~250pumps/min for WT) but no difference in pumping rate (p = 0.66) was detected between eat-2 and eat-2; skn-1b. The reporter SKN-1B::GFP reporter was made by cloning a genomic DNA fragment including 2KB directly upstream of the skn-1b translational start site, the skn-1b genomic region in front of GFP and the endogenous 3’UTR (Fig 1C). It also includes SKN-1D, but as this isoform has not been confirmed in vivo, we refer to it as SKN-1B::GFP. However, as intestinal expression of SKN-1B::GFP was not observed in either of our translational reporters under any conditions tested here we conclude that SKN-1B is post translationally modified in the intestine to suppress its expression there. To examine SKN-1C specific expression we also generated a neongreen::SKN-1C CrispR strain (SUNY Biotech). wuEx217 is used for all SKN-1B::GFP fluorescence microscopy and ukcEx15 and ukcEx16 were used for rescue experiments.

Worm husbandry and lifespan assays

Prior to experiments animals were maintained at the permissive temperature and grown for at least three generations with ample E. coli food source to assure full viability. Lifespan assays were performed essentially as described [65]. Survival plots and statistical comparisons (Log Rank test) were performed using OASIS2 software [66]. For lifespan assays using RNAi, worms were grown on bacteria expressing the appropriate RNAi clone from the L4 stage. E. coli HT115 bearing the empty pL4440 vector was used as a control. A summary of the different DR protocols is shown in S3 Table. In some food assays worms were fed different bacterial strains. OP50 and BL21G are E. coli B strains, HT115,+ W3110 and MG1655 are E. coli K-12 strains, and HB101 is a B/K-12 hybrid. DA1877 is Comamonas aquatica and MyB11 is a Pseudomonas sp. encountered in the wild Bacterial isolates from [6769].

Microscopy

Fluorescence microscopy: For each slide, 30–40 1 day adult worms were mounted in M9 + 0.06% tetramisole hydrochloride on a 2% agarose pad and imaged within 15 min. Imaging was conducted using a Leica DMR microscope recorded with a Leica-DFC9000GT camera Images are shown at 20x magnification. A 525/50 GFP filter was used and post-processing and quantification was performed using the Fiji distro of ImageJ. For analysing muscle fibres, ImageJ was used to apply a binary threshold to individual muscle fibres and the percentage coverage of GFP-tagged mitochondria across whole fibres calculated as in [39].

Confocal microscopy: day 1 adults were mounted on slides in CyGel (Biostatus) spiked with 0.6% tetramisole hydrochloride to immobilise. Imaging was performed using a Zeiss LSM880/Elyra/Axio Observer.Z1 confocal microscope with the airyscan acquisition mode with the 60x lens. Images were processed with ZenBlue software.

Electron microscopy: 100 L4 worms were picked into M9 buffer. M9 was then aspirated off and replaced by ~2mL 2.5% glutaraldehyde fixative in 100mM sodium cacodylate (CAB) buffer (pH7.2). Worm heads and tails were removed with a scalpel, and the bodies left overnight in fixative at 4°C. Worms were washed twice with CAB and suspended in 2% low melting-point agarose in CAB. Worms were identified in agarose suspension by dissecting scope, excised and transferred to 7mL glass vials, where they were post-fixed in 1% osmium tetroxide in CAB for 1hr at room temperature. These were washed twice in Milli-Q (10 mins each wash), and dehydrated in an ethanol series (50%, 70%, 90% for 10 mins each) followed by 100% dry ethanol (3 times, 10 mins each). Finally samples were washed 2 times (10 mins each) in propylene oxide. Agar scientific low viscosity (LV) resin was prepared fresh and mixed 1:1 with propylene oxide and added to the samples (30 mins RT). Samples were then incubated in fresh LV resin 2 times (2hrs each), embedded in LV resin by polymerising at 60°C for 24hrs. Polymerised samples were identified under a dissecting scope and individual worms were cut out and orientated on a resin block for optimal sectioning. 70nm sections were cut on a Leica EM UC7 ultramicrotome, using a Diatome diamond knife and collected onto 400-mesh copper grids (Agar Scientific). Sections were counterstained with 4.5% uranyl acetate (45 mins) and Reynolds lead citrate (7 mins). Sections were imaged on a Jeol 1230 transmission electron microscope operated at an accelerating voltage of 80kV; images acquired using a Gatan One View 4x4K digital camera.

Behavioural assays

C. elegans are genetically tractable, with a characterised nervous system making them an excellent tool to study behaviour. To measure exploration, assays were performed as described [18] (S4A Fig). 35 mm NGM plates were uniformly seeded with 200μL of saturated OP50 culture and allowed to dry overnight at room temperature. Worms were grown in uncrowded conditions to the L4 stage at permissive temperature. Individual L4 animals were placed in the centre of assay plates and transferred to 25°C. After 16 hrs, the animals were tested to see if they were alive by gently touching them, and plates were photographed. Plates were superimposed on a grid of 3.5 mm squares and the number of squares entered by worm tracks counted. Tracks could enter a maximum of 109 squares. At least 15 (one day adult) animals per genotype were tested on three separate days using different offspring generation. Each experiment compared controls and mutants in parallel.

Food/pathogen avoidance assays were performed as described [70]. NGM plates were seeded with 100μL of bacteria culture in the centre of the plate and allowed to dry overnight. Only plates with an evenly and defined circular bacteria lawn were used for the assays. 3 well-developed adult worms from uncrowded plates were transferred to each plate. Animals were allowed to lay eggs for 4hrs at 25°C before being removed from the plates. When animals reached the L4/one day adult stage (48hrs at 25°C) plates were photographed and the numbers of worms on and off the lawn counted (S6A Fig). To measure bordering activity, these images were further analysed to stablish the % of animals on the thicker (outer ~0.5cm) part of the lawn.

Some of these assays required fasting. This was performed as described [5,26] with some modifications. Briefly, animals were maintained either on HB101 or OP50 bacteria at 20°C in non-crowed, non-starved conditions. L4 stage animals were selected and transferred either on HB101 or OP50 seeded plates for 9-12hrs until they have reached young adulthood. Then the animals were transferred with a platinum pick to 60mm NGM plates without food for 16hrs. After 16 hr of fasting, animals were transferred either on HB101 or OP50 bacteria for re-feeding. To measure satiety quiescence animals were fasted for 16hrs and then individuals were transferred to 35mm NGM plates seeded with HB101. Worms were allowed to re-feed for 3 or 6hrs before measuring quiescence. Worms found to be quiescent (cessation of movement/pharyngeal pumping) the duration of this state was measured i.e. until feeding and locomotion resumed. Pumping was measured in individual animals, videoed on food for 1 minute and the pumping rate quantified as in [26].

To assess worm movement with automated technology we worked with Magnitude Biosciences (UK). 60 mm petri dishes containing NGM were seeded with OP50 across the whole area of the dish and a single L4 worm was placed in the centre. Each dish was imaged by 1 of 40 Raspberry Pi Version 2 cameras at a distance of 60 mm from the plate using white transmission illumination from a generic LED light panel. The cameras were located inside a temperature controlled laboratory set to 24°C. For each dish, a sequence of 200 images were taken over a 160secs, with sequences taken every 250secs over 18.3hrs. Each sequence of images was examined for intensity changes corresponding to worm motion, with motion above a threshold level being used to indicate that motion occurred in that burst. The duration of blocks in which movement was not detected were compared with the duration of all blocks recorded to calculate proportion of time in which movement was below the detection threshold and thus the worm was potentially in a quiescent state. A scale factor of 250/160 was applied to extrapolate results to the full length of the experiment. Fiducial markers beyond the plates were imaged to detect global motion caused by external events, and sequences with such global motion were censored from the analysis. Images were processed using version 2.7 of Python programming language and the NumPy library [71].

Food intake protocol

NGM plates (3.5cm) were seeded with an overnight culture of E.coli OP50 expressing mCherry. Plates were stored at room temperature for two days. L4 worms were selected and either maintained on OP50 or fasted for 16hrs at 20°C. Fed or fasted worms were then placed on the fluorescent OP50 for 5 minutes and allowed to feed. Worms were imaged and the fluorescence intensity within the gut quantified.

QPCR

RNA was isolated from adult worms after transfer of the worms to an unseeded NGM plate to remove E. coli. 50–100 worms were used for each assay. RNA was extracted using Trizol (Sigma) and cDNA synthesized using SuperScript II reverse transcriptase with oligo dT (PCR Biosystems). qRT-PCR was carried out using Fast SYBR Green Master Mix (PCR Biosystems) and the 7900 HT Fast PCR system (PCR Biosystems). Normalization of transcript quantity was carried out using the geometric mean of three stably expressed reference genes Y45F10D.4, pmp-3, and cdc-42 in order to control for cDNA input, as previously described [72]. Primer sequences to detect skn-1 isoforms, by qPCR were designed by Primerdesign as follows: skn-1b F: aacaggtggatcaacacggc, skn-1b R: ttttgcattccaatgtaggc, skn-1a F: agtgcttctcttcggtagcc, skn-1a R: gaggtgtggacgatggtgaa, skn-a/c F: gagagaaggggcacacgacaa, skn-1a/c R: tcgagcattctcttcggcag. Statistical analysis was preformed using a student t-test.

Supporting information

S1 Table. Data of lifespan trials using DR protocol shown in Fig 1A.

Trial 3 is the representative experiment shown in Fig 1A. eat-2 mutants were long lived in 3 out of 5 trials carried out across 20 and 25°C.

https://doi.org/10.1371/journal.pgen.1009358.s001

(DOCX)

S2 Table. Data of lifespan trials using DR protocol shown in Fig 1B.

Trial 1 is the representative experiment shown in Fig 1B.

https://doi.org/10.1371/journal.pgen.1009358.s002

(DOCX)

S3 Table. Summary of the different DR protocols and the involvement of SKN-1.

https://doi.org/10.1371/journal.pgen.1009358.s003

(DOCX)

S4 Table. Data of lifespan trials shown in S1 Fig: S1A Fig corresponds to Trial 2 in S1 Table.

For S1B–S1F Fig Trial 1 is the representative experiment in each case.

https://doi.org/10.1371/journal.pgen.1009358.s004

(DOCX)

S5 Table. Data of lifespan trials using daf-2 RNAi shown in S2A and S2B Fig.

The experiment was carried out once at each temperature and the data supported the findings of the genetic experiments shown in S1 Table and S1 Fig.

https://doi.org/10.1371/journal.pgen.1009358.s005

(DOCX)

S1 Fig. skn-1b is not required for WT or daf-2 longevity A-F) Survival of WT and skn-1b mutants in the absence and presence of daf-2 mutation.

Lower permissive temperatures were used for some daf-2 alleles as previous work showed that skn-1c had a stronger suppressive effect on daf-2 at these compared to higher temperatures [10, 16]. Representative experiments shown, individual trials are summarised with Log-Rank analysis in S4 Table. NB: In a total of 13 lifespan trials, we observed that skn-1b mutation partially suppressed daf-2 longevity in only 4 trials (S4 Table). An additional two trials using daf-2 RNAi did not require skn-1b (S2A and S2B Fig and S5 Table). We conclude that skn-1b does not contribute to daf-2 longevity. In a total of 15 trials (13 on OP50, 2 on HT115) bacteria we observed a slight decrease in skn-1b longevity compared to WT in 4 trials (S4 and S5 Tables). We conclude that skn-1b does not contribute to normal lifespan. skn-1b(tm4241) allele details (S5 Fig).

https://doi.org/10.1371/journal.pgen.1009358.s006

(TIF)

S2 Fig. skn-1b is not required for daf-2 RNAi incurred longevity.

A-B) Survival of WT and skn-1b mutants in the absence and presence of daf-2 RNAi. Full data for each trial are summarised together with Log-Rank analysis in S5 Table.

https://doi.org/10.1371/journal.pgen.1009358.s007

(TIF)

S3 Fig. Characterisation of skn-1b(tm4241) and SKN-1B:GFP.

A) Expression levels of skn-1 isoforms in WT and skn-1b(tm4241) determined by Q-PCR. Combined data from 6 biological replicates shown. Error bars show st. dev. Two-tailed t-test compared to WT control *p<0.05, **p< 0.001, ***p<0.0001, NS not significant. B-D) Brood size of WT and skn-1b mutants at three different temperatures. skn-1b mutants are fully fertile, so can be maintained as homozygotes. Combined data from 3 biological replicates shown, n>30 worms per group. Error bars show st. dev. Two-tailed t-test *p<0.05, **p< 0.001, ***p<0.0001, NS not significant. E) Age-specific fecundity in WT and skn-1b mutants. F) Expression pattern of the Scarlet::SKN-1B reporter in day 1 adults under fed conditions shows SKN-1B in ASI neurons. Our lab also generated an endogenous NeonGreen::SKN-1C reporter but cannot detect expression of SKN-1C in neurons (available on request). No significant differences were observed using a two-tailed t-test on any day between genotypes. G-J) SKN-1B::GFP is expressed differentially during growth and in additional neurons in response to bacterial deprivation. H) SKN-1B::GFP observed in additional neurons in response to fasting. I) Quantification of the number of visible neurons in SKN-1B::GFP expressing worms in response to fasting. A total of 52 fed and 64 fasted worms were examined. J) DiI staining confirms SKN-1B::GFP in the ASI neurons and identified two of these additional neurons (counted in S3I Fig) as being the ADLs. Recently, others have identified SKN-1B in AIY neurons as a regulator of chemosensory processes and behaviour, showing that animals lacking the skn-1a, c and b do not chemotax towards NaCl, butanone or temperature, or move towards thicker bacterial lawns (as a WT worms would) [57]. We tested our skn-1b specific mutant in a NaCl chemotaxis assay and got similar results but have no evidence that SKN-1B is endogenously expressed in the AIYs in fed conditions. It is possible that SKN-1B signals from the ASI—AIY neurons to mediate this response or that some SKN-1B::GFP expressing neurons in fasted conditions are AIYs. As the no-food conditions in NaCl chemotaxis assays is sufficient to induce SKN-1B expression in these cells, this could mediate the effects.

https://doi.org/10.1371/journal.pgen.1009358.s008

(TIF)

S4 Fig. Role of skn-1b in regulating exploratory behaviour.

A) Cartoon showing setup of exploration assay as in [18]. Extended dwelling or roaming compared to WT behaviour can be quantified by counting the number of squares that a worm traverses over 16hrs. Food is spread evenly and continuously on the plate. B) Control experiments for exploration assay. Time spent in roaming and dwelling states depends on integrating internal neuro-modulatory cues with external sensory cues. The absence of such sensory transduction leads to extended dwelling as observed in the tax-4 mutant. tax-4 encodes a cyclic nucleotide-gated channel subunit, in contrast, mutants with constitutive sensory input, such as the egl-4, which encodes a molecule with cGMP protein kinase activity, exhibit extended roaming [73]. Representative experiment of 3 biological replicates shown, n<15 worms per group ± st. dev. C and D) Quantification of exploratory behaviour in response to skn-1 RNAi fed at either the L1 (C) or L4 stage (D). Mean plate coverage of n>23 individual worms per group ± st. dev., one representative experiment of 3 biological replicates shown. For B-D) Two-tailed t-test NS non-significant. Two-tailed t-test *p<0.05, **p<0.001, ***p<0.0001, NS not significant. E) Neurons are relatively resistant to RNAi (Timmons et al., 2001), but quantitative fluorescence microscopy shows that skn-1 RNAi from the L1 stage reduces SKN-1B::GFP in ASIs by ~30%. The smaller difference between exploration in WT and skn-1b mutants in (D) likely reflects the RNAi knock-down from L4 being less complete. The skn-1 RNAi clone used in C-E targets all skn-1 isoforms [16]. Pooled data from 3 biological replicates shown, n>100 individual worms per group. Two-tailed t-test ***p<0.0001. F) skn-1b mutants display normal thrashing activity in liquid. Average of 3 biological replicates shown, n>33 individual worms per group.

https://doi.org/10.1371/journal.pgen.1009358.s009

(TIF)

S5 Fig. Effect of skn-1b mutation on food avoidance behaviour.

A) Cartoon showing setup of food avoidance assay as in [70]. The percentage of worms on a lawn of bacteria is determined in conditions where worms have a choice whether to be on or off the lawn. B-C) Quantification of worms on different bacterial lawns (if given a choice to leave). Other strains tested are shown in Fig 1I. Each bar represents a mean of 3 biological replicates with ~100 worms per trial ± st. dev. Two-tailed t-test *p<0.05, **p< 0.001, ***p<0.0001, NS not significant. For B-C) bacteria were allowed to proliferate in each case, and no antibiotics or FUDR were present (see Methods). NB: Our assay measures satiety quiescence following fasting, as this offers an easily quantifiable behaviour. However, satiety quiescence also occurs cyclically between foraging and dwelling when worms are fully fed. During our studies we observed that while skn-1b mutants always preferred the bacterial lawn regardless of the food type, WT worms could be tempted to spend more time on certain bacteria (Fig 1I). A similar defect in food sensing behaviour was also observed for skn-1 mutants [57].

https://doi.org/10.1371/journal.pgen.1009358.s010

(TIF)

S6 Fig. Role of skn-1b in mediating entry to quiescence.

A-F) % worms spending time in quiescence 3 or 6hrs after fasting and re-feeding. Each bar represents a mean of 3 biological replicates ± SEM with n>36 worms per group. Due to the nature of the assay, satiety quiescence is not observable in every worm in an experiment, particularly in mutant strains that exhibit low levels of quiescence such as daf-7 and daf-11. Similar numbers of worms from WT and mutants were observed in quiescence (S6C Fig) but fewer daf-7 and daf-7;skn-1b mutants entered quiescence (S6C Fig). Thus, the daf-7 data in Fig 4A is likely to be an over-representation of the actual level of satiety quiescence within the population.

https://doi.org/10.1371/journal.pgen.1009358.s011

(TIF)

S7 Fig. SKN-1B expression and response to environmental change.

A-C) Quantitative fluorescence microscopy of SKN-1B::GFP expression in response to pathogenic bacteria (A), an alternative DR protocol (Moroz et al 2014) (B), or eat-2 mutation (C). For (A and C) bacteria were allowed to proliferate in each case, in B) antibiotics were present (see Methods). For A-C) Error bars show st. dev. Two-tailed t-test compared to day 1 expression levels *p<0.05, **p< 0.001, ***p<0.0001, NS not significant.

https://doi.org/10.1371/journal.pgen.1009358.s012

(TIF)

S8 Fig. Epistasis of daf-7 and skn-1b in regulating exploration.

A-E) Individual exploration assays combined in Fig 4D. We reasoned that if each of the two genes regulate different behaviours independently, then the effects of daf-7 and skn-1b on behaviour should be additive. However, the exploration of daf-7 and daf-7; skn-1b worms was not significantly changed in 4 out of 5 trials i.e. not additive effect. In each experiment the mean plate coverage of n>8 individual worms per group is shown ± standard deviation. Two-tailed t-test *p<0.05, **p< 0.001, ***p<0.0001, NS not significant. F) Statistical analysis of each individual and combined trial(s). Comparisons highlighted in green are significant (two-tailed t-test p<0.05), and those in orange are NS.

https://doi.org/10.1371/journal.pgen.1009358.s013

(TIF)

S9 Fig. skn-1b alters DAF-16::GFP nuclear localisation in response to diet changes.

A) Scoring system for DAF-16a::GFP nuclear localisation in the gut nuclei. Nuclear localisation was graded by a four-point system; 0 = none, 1 = low, 2 = intermediate, 3 = high. Nuclear grading was carried out by a combination of the quantity of punctate gut nuclei as well as the fluorescence intensity of these nuclei. B) Quantification of the grading of the DAF-16a::GFP nuclear localisation in both WT and skn-1b mutants under fed, fasted, fasted/re-fed for 3hrs or 6hrs. C) Full statistical analysis using two tailed t-test for the average grading of DAF-16a::GFP nuclear localisation shown in Fig 5A. D) Full statistical analysis determined by chi-squared test of DAF-16 nuclear localisation data shown in S9B Fig.

https://doi.org/10.1371/journal.pgen.1009358.s014

(TIF)

S10 Fig. Pins-7::GFP levels are altered in skn-1b mutants.

A) Representative images showing Pins-7::GFP expression in WT and skn-1b mutants. Expression was visible in various neurons and the gut. 20x magnification. B) Quantitative fluorescence microscopy of Pins-7::GFP in the gut. Neuronal Pins-7::GFP levels were not quantified as its expression in multiple neurons made their individual identification difficult. skn-1 has also been shown to repress ins-7 expression [35], consistent with the increase in ins-7::GFP observed in skn-1b animals.

https://doi.org/10.1371/journal.pgen.1009358.s015

(TIF)

S11 Fig. Interaction of skn-1b and IIS for exploratory behaviour.

A and B) Quantification of exploration. One representative experiment of 3 similar biological replicates shown ± st. dev., n>10 worms per group. Two-tailed t-test *p<0.05, **p< 0.001, ***p<0.0001, NS not significant. daf-2(e1368) caused a milder exploratory defect than daf-2(e1370) (Fig 5B). Fasting also reduced exploration in daf-2(e1368) animals but this was not further reduced by skn-1b mutation (Fig 5C). Therefore, despite this milder daf-2(e1368) exploratory phenotype, skn-1b mutation was not able to further suppress exploration in either fed, or fasted and re-fed conditions.

https://doi.org/10.1371/journal.pgen.1009358.s016

(TIF)

S12 Fig. Comparing mitochondria in WT and skn-1b mutants—supporting data.

A and B) Images and quantification of bordering behaviour. Each bar represents a mean of 3 biological replicates ± st. dev. C) Scoring system of the expression of myo-3::mitoGFP in C. elegans. D and E) Expression and quantification of WT and skn-1b mutant C. elegans expressing tomm20:GFP. This reporter expresses a peptide of tomm20, an outer mitochondrial membrane protein and hence marks all mitochondria, delineating their shape [39]. In E) Each bar represents a mean of 3 biological replicates ± SEM, n>49 day 1 adults worms per group. Note that although fluorescence microscopy demonstrates an alteration in the organisation of the mitochondrial networks and suggests a level of disruption, it is comparison with TEM (Figs 6D, S12, S13 and S14) that allowed us to define the nature of the disruption.

https://doi.org/10.1371/journal.pgen.1009358.s017

(TIF)

S13 Fig. TEM of WT and skn-1b mutants in Fed and fasted conditions.

A) Longitudinal sections and B) Transverse sections. All scale bars = 500nm, M = mitochondria, S = sarcomere. Fasting disrupts mitochondrial networks in response to fasting in WT animals. skn-1b mutants also have disrupted mitochondrial networks, exhibiting increased fusion of mitochondria. In response to fasting skn-1b mutant mitochondria appear much worse than WT, with disrupted membranes and cristae structures.

https://doi.org/10.1371/journal.pgen.1009358.s018

(TIF)

S14 Fig. Comparing mitochondrial networks in WT and skn-1b mutants using fluorescent and Electron microscopy.

Images of myo-3::mitoGFP (A) and TEM images (B) in WT and skn-1b mutant C. elegans fed control, eat-3, fzo-1 or drp-1 RNAi. TEM shows Longitudinal sections 200nm. Note that although the fluorescent images in A clearly show signs of mitochondrial network disruption, it is only when examining the TEM images that the precise network structures can be seen e.g. both eat-3 and drp-1 RNAi show a “spotty” pattern on the fluorescent images but this translates to a very different TEM image with eat-3 RNAi causing fission and drp-1 RNAi fusion (as expected).

https://doi.org/10.1371/journal.pgen.1009358.s019

(TIF)

Acknowledgments

We thank: Queelim Ch’ng for strains and advice, Rachel McMullan for advice on food leaving assays, Simon Harvey for use of the MicroWorm tracker, David Gems for excellent support at the start of this project, and Dr Tobias Von der Haar for critical reading of the manuscript. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD01044).

References

  1. 1. McFarland DJ. Decision making by animals. Nature. 1977. citeulike-article-id:3179069
  2. 2. Bouret SG. Development of hypothalamic circuits that control food intake and energy balance. Appetite and Food Intake: Central Control, Second Edition. 2017. pmid:28880512
  3. 3. Bargmann C. Chemosensation in C. elegans. WormBook. 2006. https://doi.org/10.1895/wormbook.1.123.1 pmid:18050433
  4. 4. Ben Arous J, Laffont S, Chatenay D. Molecular and sensory basis of a food related two-state behavior in C. elegans. PLoS One. 2009. pmid:19851507
  5. 5. You Y jai, Kim J, Raizen DM, Avery L. Insulin, cGMP, and TGF-β Signals Regulate Food Intake and Quiescence in C. elegans: A Model for Satiety. Cell Metab. 2008. pmid:18316030
  6. 6. McCloskey RJ, Fouad AD, Churgin MA, Fang-Yen C. Food responsiveness regulates episodic behavioral states in Caenorhabditis elegans. J Neurophysiol. 2017. pmid:28228583
  7. 7. Skora S, Mende F, Zimmer M. Energy Scarcity Promotes a Brain-wide Sleep State Modulated by Insulin Signaling in C. elegans. Cell Rep. 2018. pmid:29386137
  8. 8. Sebastián D, Palacín M, Zorzano A. Mitochondrial Dynamics: Coupling Mitochondrial Fitness with Healthy Aging. Trends in Molecular Medicine. 2017. pmid:28188102
  9. 9. Blackwell TK, Steinbaugh MJ, Hourihan JM, Ewald CY, Isik M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radic Biol Med. 2015; 1–12. pmid:26232625
  10. 10. Tullet JMA, Hertweck M, An JH, Baker J, Hwang JY, Liu S, et al. Direct Inhibition of the Longevity-Promoting Factor SKN-1 by Insulin-like Signaling in C. elegans. Cell. 2008. pmid:18358814
  11. 11. Lehrbach NJ, Ruvkun G. Proteasome dysfunction triggers activation of SKN-1A/Nrf1 by the aspartic protease DDI-1. Elife. 2016;5. pmid:27528192
  12. 12. Bishop N a, Guarente L. Two neurons mediate diet-restriction-induced longevity in C. elegans. Nature. 2007;447: 545–549. pmid:17538612
  13. 13. Lehrbach NJ, Ruvkun G. Endoplasmic reticulum-associated SKN-1A/Nrf1 mediates a cytoplasmic unfolded protein response and promotes longevity. Elife. 2019. pmid:30973820
  14. 14. Kapahi P, Kaeberlein M, Hansen M. Dietary restriction and lifespan: Lessons from invertebrate models. Ageing Research Reviews. 2017. pmid:28007498
  15. 15. Moroz N, Carmona JJ, Anderson E, Hart AC, Sinclair D a., Blackwell TK. Dietary restriction involves NAD + -dependent mechanisms and a shift toward oxidative metabolism. Aging Cell. 2014;13: 1075–1085. pmid:25257342
  16. 16. Ewald CY, Landis JN, Abate JP, Murphy CT, Blackwell TK. Dauer-independent insulin/IGF-1-signalling implicates collagen remodelling in longevity. Nature. 2014;519: 97–101. pmid:25517099
  17. 17. Trojanowski NF, Raizen DM. Call it Worm Sleep. Trends in Neurosciences. 2016. pmid:26747654
  18. 18. Flavell SW, Pokala N, Macosko EZ, Albrecht DR, Larsch J, Bargmann CI. Serotonin and the neuropeptide PDF initiate and extend opposing behavioral states in C. Elegans. Cell. 2013;154: 1023–1035. pmid:23972393
  19. 19. Bowerman B, Draper BW, Mello CC, Priess JR. The maternal gene skn-1 encodes a protein that is distributed unequally in early C. elegans embryos. Cell. 1993;74: 443–452. Available: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=8348611 pmid:8348611
  20. 20. Lipton J. Mate Searching in Caenorhabditis elegans: A Genetic Model for Sex Drive in a Simple Invertebrate. J Neurosci. 2004. pmid:15329389
  21. 21. Barrios A, Nurrish S, Emmons SW. Sensory Regulation of C. elegans Male Mate-Searching Behavior. Curr Biol. 2008. pmid:19062284
  22. 22. Birnby DA, Link EM, Vowels JJ, Tian H, Colacurcio PL, Thomas JH. A transmembrane guanylyl cyclase (DAF-11) and Hsp90 (DAF-21) regulate a common set of chemosensory behaviors in Caenorhabditis elegans. Genetics. 2000. pmid:10790386
  23. 23. Clark LC, Hodgkin J. Commensals, probiotics and pathogens in the Caenorhabditis elegans model. Cell Microbiol. 2014. pmid:24168639
  24. 24. Patterson GI, Padgett RW. TGFβ-related pathways: Roles in Caenorhabditis elegans development. Trends in Genetics. 2000.
  25. 25. Wang J. Global analysis of dauer gene expression in Caenorhabditis elegans. Development. 2003. pmid:12620986
  26. 26. Gallagher T, Kim J, Oldenbroek M, Kerr R, You Y-J. ASI Regulates Satiety Quiescence in C. elegans. J Neurosci. 2013. pmid:23739968
  27. 27. Pierce SB, Costa M, Wisotzkey R, Devadhar S, Homburger S a, Buchman a R, et al. Regulation of DAF-2 receptor signaling by human insulin and ins-1, a member of the unusually large and diverse C-elegans insulin gene family. Genes Dev. 2001;15: 672–686. pmid:11274053
  28. 28. Antebi A. Genetics of aging in Caenorhabditis elegans. PLoS Genet. 2007;3: 1565–1571. 10.1371/journal.pgen.0030129 pmid:17907808
  29. 29. Kenyon CJ. The genetics of ageing. Nature. 2010/03/26. 2010;464: 504–512. pmid:20336132
  30. 30. Libina N, Berman JR, Kenyon C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 2003;115: 489–502. Available: 10.1016/s0092-8674(03)00889-4 pmid:14622602
  31. 31. Chávez V, Mohri-Shiomi A, Maadani A, Vega LA, Garsin DA. Oxidative stress enzymes are required for DAF-16-mediated immunity due to generation of reactive oxygen species by Caenorhabditis elegans. Genetics. 2007. pmid:17483415
  32. 32. Fletcher M, Kim DH. Age-Dependent Neuroendocrine Signaling from Sensory Neurons Modulates the Effect of Dietary Restriction on Longevity of Caenorhabditis elegans. PLoS Genet. 2017. pmid:28107363
  33. 33. Shaw WM, Luo S, Landis J, Ashraf J, Murphy CT. The C. elegans TGF-beta Dauer pathway regulates longevity via insulin signaling. Curr Biol. 2007;17: 1635–1645. pmid:17900898
  34. 34. Murphy CT, Lee SJ, Kenyon C. Tissue entrainment by feedback regulation of insulin gene expression in the endoderm of Caenorhabditis elegans. Proc Natl Acad Sci U S A. 2007/11/21. 2007;104: 19046–19050. pmid:18025456
  35. 35. Oliveira RP, Abate JP, Dilks K, Landis J, Ashraf J, Murphy CT, et al. Condition-adapted stress and longevity gene regulation by Caenorhabditis elegans SKN-1/Nrf. Aging Cell. 2009;8: 524–541. pmid:19575768
  36. 36. Podshivalova K, Kerr RA, Kenyon C. How a Mutation that Slows Aging Can Also Disproportionately Extend End-of-Life Decrepitude. Cell Rep. 2017. pmid:28423308
  37. 37. Gems D, Sutton AJ, Sundermeyer ML, Albert PS, King K V., Edgley ML, et al. Two pleiotropic classes of daf-2 mutation affect larval arrest, adult behavior, reproduction and longevity in Caenorhabditis elegans. Genetics. 1998. pmid:9725835
  38. 38. Schmeisser S, Priebe S, Groth M, Monajembashi S, Hemmerich P, Guthke R, et al. Neuronal ROS signaling rather than AMPK/sirtuin-mediated energy sensing links dietary restriction to lifespan extension. Mol Metab. 2013;2: 92–102. pmid:24199155
  39. 39. Weir HJ, Yao P, Huynh FK, Escoubas CC, Goncalves RL, Burkewitz K, et al. Dietary Restriction and AMPK Increase Lifespan via Mitochondrial Network and Peroxisome Remodeling. Cell Metab. 2017. pmid:29107506
  40. 40. Fenk LA, de Bono M. Memory of recent oxygen experience switches pheromone valence in Caenorhabditis elegans. Proc Natl Acad Sci. 2017. pmid:28373553
  41. 41. Byrne JJ, Soh MS, Chandhok G, Vijayaraghavan T, Teoh JS, Crawford S, et al. Disruption of mitochondrial dynamics affects behaviour and lifespan in Caenorhabditis elegans. Cell Mol Life Sci. 2019. pmid:30840087
  42. 42. Hibshman JD, Leuthner TC, Shoben C, Mello DF, Sherwood DR, Meyer JN, et al. Nonselective autophagy reduces mitochondrial content during starvation in Caenorhabditis elegans. Am J Physiol Cell Physiol. 2018. pmid:30133321
  43. 43. Chaudhari SN, Kipreos ET. Increased mitochondrial fusion allows the survival of older animals in diverse C. Elegans longevity pathways. Nat Commun. 2017. pmid:28769038
  44. 44. Palikaras K, Lionaki E, Tavernarakis N. Coordination of mitophagy and mitochondrial biogenesis during ageing in C. elegans. Nature. 2015. pmid:25896323
  45. 45. Ghose P, Park EC, Tabakin A, Salazar-Vasquez N, Rongo C. Anoxia-Reoxygenation Regulates Mitochondrial Dynamics through the Hypoxia Response Pathway, SKN-1/Nrf, and Stomatin-Like Protein STL-1/SLP-2. PLoS Genet. 2013. pmid:24385935
  46. 46. Spurlock B, Tullet JMA, Hartman JL, Mitra K. Interplay of mitochondrial fission-fusion with cell cycle regulation: Possible impacts on stem cell and organismal aging. Experimental Gerontology. 2020. pmid:32220593
  47. 47. Van Der Klaauw AA, Farooqi IS. The hunger genes: Pathways to obesity. Cell. 2015. pmid:25815990
  48. 48. Hahm JH, Kim S, Paik YK. Endogenous cGMP regulates adult longevity via the insulin signaling pathway in Caenorhabditis elegans. Aging Cell. 2009. pmid:19489741
  49. 49. Murakami M, Koga M, Ohshima Y. DAF-7/TGF-β expression required for the normal larval development in C. elegans is controlled by a presumed guanylyl cyclase DAF-11. Mech Dev. 2001.
  50. 50. Lapierre LR, Hansen M. Lessons from C. elegans: Signaling pathways for longevity. Trends in Endocrinology and Metabolism. 2012. pmid:22939742
  51. 51. Gumienny TL. TGF-β signaling in C. elegans. WormBook. 2013. https://doi.org/10.1895/wormbook.1.22.2 pmid:23908056
  52. 52. Kimura KD, Riddle DL, Ruvkun G. The C. Elegans DAF-2 insulin-like receptor is abundantly expressed in the nervous system and regulated by nutritional status. Cold Spring Harb Symp Quant Biol. 2011. pmid:22123849
  53. 53. Gaglia MM, Kenyon C. Stimulation of Movement in a Quiescent, Hibernation-Like Form of Caenorhabditis elegans by Dopamine Signaling. J Neurosci. 2009. pmid:19494152
  54. 54. Wu Z, Isik M, Moroz N, Steinbaugh MJ, Zhang P, Blackwell TK. Dietary Restriction Extends Lifespan through Metabolic Regulation of Innate Immunity. Cell Metab. 2019. pmid:30905669
  55. 55. Bräcker LB, Siju KP, Arela N, So Y, Hang M, Hein I, et al. Essential role of the mushroom body in context-dependent CO2 avoidance in drosophila. Curr Biol. 2013. pmid:23770186
  56. 56. Wong R, Piper MDW, Wertheim B, Partridge L. Quantification of food intake in Drosophila. PLoS One. 2009. pmid:19557170
  57. 57. Wilson MA, Iser WB, Son TG, Logie A, Cabral-Costa J V., Mattson MP, et al. Skn-1 is required for interneuron sensory integration and foraging behavior in Caenorhabditis elegans. PLoS One. 2017. pmid:28459841
  58. 58. Kobayashi A, Tsukide T, Miyasaka T, Morita T, Mizoroki T, Saito Y, et al. Central nervous system-specific deletion of transcription factor Nrf1 causes progressive motor neuronal dysfunction. Genes to Cells. 2011. pmid:21554501
  59. 59. Lakowski B, Hekimi S. The genetics of caloric restriction in Caenorhabditis elegans. Proc Natl Acad Sci U S A. 1998;95: 13091–13096. pmid:9789046
  60. 60. Kumar S, Egan BM, Kocsisova Z, Schneider DL, Murphy JT, Diwan A, et al. Lifespan Extension in C. elegans Caused by Bacterial Colonization of the Intestine and Subsequent Activation of an Innate Immune Response. Dev Cell. 2019. pmid:30965033
  61. 61. Zhao Y, Gilliat AF, Ziehm M, Turmaine M, Wang H, Ezcurra M, et al. Two forms of death in ageing Caenorhabditis elegans. Nat Commun. 2017. pmid:28534519
  62. 62. Alic N, Tullet JM, Niccoli T, Broughton S, Hoddinott MP, Slack C, et al. Cell-Nonautonomous Effects of dFOXO/DAF-16 in Aging. Cell Rep. 2014. pmid:24508462
  63. 63. Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;77: 71–94. pmid:4366476
  64. 64. Ritter AD, Shen Y, Bass JF, Jeyaraj S, Deplancke B, Mukhopadhyay A, et al. Complex expression dynamics and robustness in C. elegans insulin networks. Genome Res. 2013. pmid:23539137
  65. 65. Hsin H, Kenyon C. Signals from the reproductive system regulate the lifespan of C. elegans. Nature. 1999;399: 362–366. pmid:10360574
  66. 66. Yang JS, Nam HJ, Seo M, Han SK, Choi Y, Nam HG, et al. OASIS: Online application for the survival analysis of lifespan assays performed in aging research. PLoS One. 2011;6. pmid:21858155
  67. 67. Zhang F, Berg M, Dierking K, Félix MA, Shapira M, Samuel BS, et al. Caenorhabditis elegans as a model for microbiome research. Front Microbiol. 2017;8. pmid:28386252
  68. 68. Samuel BS, Rowedder H, Braendle C, Félix M-A, Ruvkun G. Caenorhabditis elegans responses to bacteria from its natural habitats. Proc Natl Acad Sci. 2016. pmid:27317746
  69. 69. Zhang J, Holdorf AD, Walhout AJ. C. elegans and its bacterial diet as a model for systems-level understanding of host–microbiota interactions. Current Opinion in Biotechnology. 2017. pmid:28189107
  70. 70. McMullan R, Anderson A, Nurrish S. Behavioral and immune responses to infection require Gαq- RhoA signaling in C. elegans. PLoS Pathog. 2012. pmid:22359503
  71. 71. Harris CR, Millman KJ, van der Walt SJ, Gommers R, Virtanen P, Cournapeau D, et al. Array programming with NumPy. Nature. 2020. pmid:32939066
  72. 72. Hoogewijs D, Houthoofd K, Matthijssens F, Vandesompele J, Vanfleteren JR. Selection and validation of a set of reliable reference genes for quantitative sod gene expression analysis in C. elegans. BMC Mol Biol. 2008/01/24. 2008;9: 9. pmid:18211699
  73. 73. Fujiwara M, Sengupta P, McIntire SL. Regulation of body size and behavioral state of C. elegans by sensory perception and the egl-4 cGMP-dependent protein kinase. Neuron. 2002.