Advertisement
  • Loading metrics

Genetic basis of thermal plasticity variation in Drosophila melanogaster body size

Genetic basis of thermal plasticity variation in Drosophila melanogaster body size

  • Elvira Lafuente, 
  • David Duneau, 
  • Patrícia Beldade
PLOS
x

Abstract

Body size is a quantitative trait that is closely associated to fitness and under the control of both genetic and environmental factors. While developmental plasticity for this and other traits is heritable and under selection, little is known about the genetic basis for variation in plasticity that can provide the raw material for its evolution. We quantified genetic variation for body size plasticity in Drosophila melanogaster by measuring thorax and abdomen length of females reared at two temperatures from a panel representing naturally segregating alleles, the Drosophila Genetic Reference Panel (DGRP). We found variation between genotypes for the levels and direction of thermal plasticity in size of both body parts. We then used a Genome-Wide Association Study (GWAS) approach to unravel the genetic basis of inter-genotype variation in body size plasticity, and used different approaches to validate selected QTLs and to explore potential pleiotropic effects. We found mostly “private QTLs”, with little overlap between the candidate loci underlying variation in plasticity for thorax versus abdomen size, for different properties of the plastic response, and for size versus size plasticity. We also found that the putative functions of plasticity QTLs were diverse and that alleles for higher plasticity were found at lower frequencies in the target population. Importantly, a number of our plasticity QTLs have been targets of selection in other populations. Our data sheds light onto the genetic basis of inter-genotype variation in size plasticity that is necessary for its evolution.

Author summary

Environmental conditions can influence development and lead to the production of phenotypes adjusted to the conditions adults will live in. This developmental plasticity, which can help organisms cope with environmental heterogeneity, is heritable and under selection. Its evolution will depend on available genetic variation. Using a panel of D. melanogaster flies representing naturally segregating alleles, we identified DNA sequence variants associated to variation in thermal plasticity for body size. We found that these variants correspond to a diverse set of functions and that their effects differ between body parts and properties of the thermal response. Our results shed new light onto the long discussed genes for plasticity.

Introduction

Body size has a great impact on the performance of individuals [1, 2], as well as that of species [3]. Diversity in this trait is shaped by the reciprocal interactions between the developmental processes that regulate growth, and the evolutionary forces that determine which phenotypes increase in frequency across generations [4]. Body size varies greatly within and between populations [2, 5] and is controlled by both genetic and environmental factors [69]. Studies in different animal models have provided insight about the selection agents that shape the evolution of body size (e.g. predators [10, 11], mates [12], thermal regimes [13, 14]), and about the molecular mechanisms that regulate body size and body proportions during development [1518].

Body size is also a prime example of the environmental regulation of development, or developmental plasticity [19, 20], and it is influenced by different factors, including nutrition and temperature. This plasticity can help organisms cope with environmental heterogeneity and, as such, can have major implications for population persistence and adaptation [2022]. Thermal plasticity in body size is ubiquitous among insects [2325], with development under colder temperatures typically resulting in larger bodies, which is presumably advantageous for thermal-regulation [1, 26]. The environmental dependency of body size, and other plastic traits, is often studied using reaction norms, in which phenotypic variation is plotted as a function of gradation in the environment [27]. The properties of these reaction norms, including their shapes and slopes, can differ between genotypes [2830], and the genes underlying such variation can fuel the evolution of plasticity. Little is known about what these genetic variants are and what types of functions they perform (e.g. perception of environmental cues, conveying external information to developing tissues, or executing actions in developing plastic organs). It is also unclear to what extent the loci contributing to variation in thermal plasticity in size are the same for different body parts, and whether the loci contributing to variation in size plasticity are the same that underlie inter-individual variation in body size at a given temperature.

Studies in D. melanogaster have provided much insight about the evolution and development of body size, body proportions, and body size plasticity [7, 3138]. Size differences among populations, including clinal [31, 39] and seasonal variation [40], and among individuals within a population, are due to the effects of genes, environment, as well as genotype-by-environment interactions [33, 4143]. While we have increasing detailed knowledge about the genetic basis of adaptation and of natural variation for many adaptive traits in D. melanogaster and other species [6, 4345], little is known about the genetic basis of variation in plasticity. Widely-accessible mapping panels [46, 47] allowed the dissection of the genetic architecture of various quantitative traits in D. melanogaster [4850], including body size [51]. However, with a few recent exceptions [5255], the genetic basis of phenotypic variation has been investigated under a single environmental condition, precluding assessment of differences between environments and of the genetic basis of plasticity itself. Series of isogenic lines from these mapping panels can be reared under different conditions to characterize reaction norms and ask about the genes that harbor allelic variation for their properties [53].

Here, we use a panel of D. melanogaster lines representing naturally segregating alleles from one natural population, the DGRP [46, 48], to characterize genetic variation for thermal plasticity in thorax and abdomen size, and to identify loci contributing to variation in the slopes of their thermal reaction norms. We document correlations between body size and body size plasticity, as well as correlations with other traits, using published data for the same panel. We also ask about the extent of overlap between QTLs for size and for size plasticity, and between QTLs for size plasticity of the different body parts. We then use different approaches to validate and further characterize the role of selected QTLs, and to ascertain their pleiotropic effects.

Results

We measured thorax and abdomen length in adult females from different genotypes reared at two temperatures. We quantified effects of genotype (G), environment (E), and genotype-by-environment (GxE) interactions on body size (Fig 1), and explored correlations between body parts and between temperatures (Fig 2). We then used a GWAS approach to identify DNA sequence polymorphisms associated with variation in body size plasticity (Fig 3). Ensuing functional analyses of candidate QTLs validated and clarified their role in body size variation at different temperatures (Fig 4).

thumbnail
Fig 1. Natural genetic variation in size and size plasticity.

A. Means and 95% confidence intervals (Y axis) for thorax (upper panel) and abdomen (lower panel) size in the DGRP lines (X axis) reared either at 17°C (blue) or at 28°C (red). DGRP lines are ranked by their mean size at 17°C. Dashed horizontal bar represents the mean value for all DGRP lines at a given temperature. Mean values (μ) and broad sense heritability (H2) estimates per body part and temperature can be found in Table 1. B. Reaction norms for thorax and abdomen sizes (Y axis) across temperatures (X axis) plotted as the regression fit for the model lm (Size ~ Temperature) for each DGRP line. Reaction norms are colored by in relation to slope: slopes significantly different from zero are orange when positive and brown when negative, while slopes that were not significantly different from zero are gray (alpha = 0.05). Counts of each are shown on the bottom of each graph. Broad sense heritability estimates were: H2 = 0.33 (thorax plasticity) and H2 = 0.48 (abdomen plasticity). C. Frequency distribution for the raw value of the slope of the reaction norm in the DGRP lines. The mean value for the raw slope of all DGRP reaction norms is indicated with a green arrowhead.

https://doi.org/10.1371/journal.pgen.1007686.g001

thumbnail
Fig 2. Phenotypic co-variation in size and size plasticity.

A. Thoracic (X axis) and abdominal (Y axis) mean size per DGRP line at 17°C (blue) and at 28°C (red). Pearson correlation, r = 0.18 (p-value = 0.01) and partial Pearson correlation, r = 0.34 (p-value = 1.02e-06) for 17°C, Pearson correlation r = 0.29 (p-value < 2e-16) and partial Pearson correlation r = 0.34 (p-value < 2e-16) for 28°C. B. Heat map of Pearson’s correlation coefficients between our measurements in thoraxes and abdomens: mean sizes and coefficients of variation (CV) at each temperature and raw and absolute slopes of the reactions norms. Non-significant correlations (p-value < 0.01) are indicated with an ‘X’.

https://doi.org/10.1371/journal.pgen.1007686.g002

thumbnail
Fig 3. Genetic variants influencing size and size plasticity.

A-B. Manhattan plots corresponding to the eight GWAS analyses performed. Horizontal lines are p-value < 10e-5 (blue) and p-value < 10e-8 (red). Gene names are shown for a subsample of significant SNPs/Indels, which were selected based on p-value, putative variant effect and associated genes (S3 and S4 Tables). A. GWAS for variation in size plasticity in thoraxes (upper panels) and abdomens (lower panels) and for either the raw (left) or the absolute (right) slopes of the reaction norms. B. GWAS for variation in size in thoraxes (upper panels) and abdomens (lower panels) at 17°C (left panels) or 28°C (right panels). C. Venn diagrams showing the number of candidate SNPs/Indels (number outside the brackets) and candidate genes (number within brackets) harboring those polymorphisms identified in the different GWAS. D. Mean and 95% confidence interval of the absolute slope of the reaction norms for thorax size (Y axis) per allele (major allele in gray, minor allele in magenta) for each candidate plasticity QTL along the chromosomal arms (X axis). The position and identity of the polymorphisms in this figure is given by their annotation with Genome Release v.5.

https://doi.org/10.1371/journal.pgen.1007686.g003

thumbnail
Fig 4. Functional validation of selected QTLs from GWAS analyses.

The name of the candidate gene and the method—mutant (KO), RNAi (KD), or Mendelian Randomization (MR)—to test the different candidate QTLs is shown above each plot. For validations via mutant or RNAi, genotypes with impaired gene function are shown in magenta and control genotypes are shown in black. Similarly, for validations via Mendelian Randomization, the two populations fixed for the minor allele are shown in magenta and the two populations for the major allele are shown in black. A. Reaction norms in mutant Hsp60A/+ and controls Canton-S (filled circles, solid line) and Fm7a/Canton-S (empty circles, dashed line). B. Reaction norms in btv-RNAi/bab-Gal4 and control lines KK (filled circles, solid line) and mCherry-RNAi/bab-Gal4 (empty circles, dashed line). C. Reaction norms in the four MR populations for SNP X:10192303 within gene CG43902. D. Reaction norms in the four MR populations for SNP 2R:7983239 within gene ACC. E. Reaction norms in Men mutants MenEx3/+ (filled circles, solid line) and MenEx55/+ (empty circles, dashed line) and control line w1118. F. Reaction norms in Eip75B-RNAi/bab-Gal4 and control lines KK (filled circles, solid line) and mCherry-RNAi/bab-Gal4 (empty circles, dashed line). G. Size at 28°C in Nmdmc-RNAi/tub-Gal4 and control lines GD (filled circles) and mCherry-RNAi/tub-Gal4 (empty circles). H. Size at 28°C in the four MR populations for SNP 3R:10678848 within gene CG14688. I. Size at 17°C in Optix-RNAi/bab-Gal4 and control lines KK (filled circles) and mCherry-RNAi/bab-Gal4 (filled circles). For the validations of plasticity QTLs, we tested the model lm (Size ~ Genotype*Temperature) and for the validations of within-environment QTLs we tested the model lm (Trait ~ Genotype). Results from the statistical models are shown above each plot and, when significant, indicated by asterisks in the plot (where p-values < 0.001 and < 0.01 are denoted by '***' and '**', respectively). Differences for more than two groups were estimated by post hoc comparisons (Tukey’s honest significant differences) and are indicated by different letters in each plot (p-value < 0.01). For all tested SNPs/genes, the phenotype of the DGRP lines carrying the minor versus the major allele at the target QTL can be found in S7 Fig.

https://doi.org/10.1371/journal.pgen.1007686.g004

Partitioning variation in body size

To assess the contribution of genotype and temperature to body size variation, we quantified length of abdomens and thoraxes (Fig 1A, S1A Fig) of adult females from ~196 isogenic lines reared at either 17°C or 28°C (S1 Dataset, S2 Table). We found significant differences between DGRP genotypes and between developmental temperatures, as well as significant GxE interaction effects (thermal plasticity) for the size of both body parts (Fig 1A, S1C Fig). We also found variation between individuals of (presumably) the same genotype and same rearing temperature; the coefficients of variation (CV) varied between 0.6 and 15 for thorax measurements and between 0.3 and 23.8 for abdomen measurements (Table 1). Broad-sense heritabilities for body size (at 17°C and 28°C) and body size plasticity (between-environment variation) varied between 33 and 52% (Table 1).

thumbnail
Table 1. Measurement summary and broad-sense heritability estimates for size and size plasticity.

https://doi.org/10.1371/journal.pgen.1007686.t001

We computed a correlation matrix to assess relationships between the different components of variation in body size (Fig 2). We found a significant positive correlation between thorax and abdomen size within each rearing temperature (Fig 2A and 2B). We also found significant positive correlations between our measurements of thorax (both temperatures), but not abdomen size, and the size of several body parts measured in other studies [51] for the same genotypes reared at 25°C (S2A Fig). To address the question of association between body size and fitness, we measured correlations between our measurements of body size and a series of fitness related traits quantified in other studies of the DGRPs [46, 49, 50, 56]. We found significant correlations with chill coma recovery (thorax size at both temperatures and abdomen size at 28°C) and with survival upon infection with Metarhizium anisopliae fungi (abdomen size at 17°C), but not with longevity, starvation resistance, and other immune-defense traits (S2B Fig). To address the question of what might explain the extent of inter-individual variation within genotype and temperature, we calculated correlations between our measurements of CV and of size. We found the CV to be: 1) positively correlated between body parts for flies reared at 28°C, but not for those reared at 17°C, and 2) negatively correlated with mean size for thoraxes, but not for abdomens (Fig 2B).

Thermal reaction norms for body size

Using reaction norms, we studied the extent and properties of thermal plasticity for body size in the DGRP lines (Fig 1B). We calculated the slope of the regression lines for size across temperatures for each body part and DGRP genotype, and found genetic variation for both the intercept and slope of the reaction norms (Fig 1B, S2 Table). From each reaction norm, we extracted two properties of the thermal plasticity in body size: i) the absolute value of the slope, describing only the magnitude of the response to temperature, and ii) the raw value of the slope, which describes magnitude and direction of the response (Fig 1C, S1D Fig). Using the reaction norms for 191 DGRP lines, we identified plastic and non-plastic genotypes. Slopes of the thermal reaction norm were significantly different from zero for 55% and 57% of the lines for the size of thoraxes and abdomens, respectively, with most of the plastic genotypes having smaller sizes when reared at higher temperatures (Fig 1B). However, we also found plasticity in the opposite direction (i.e. genotypes with smaller flies at lower temperatures), corresponding to a positive significant slope for the thermal reaction norms: 8% of the DGRP reaction norms for the thorax and 22% for the abdomen (Fig 1B).

Even though the levels of thermal plasticity for thorax and abdomen size were significantly positively correlated (Fig 2B), lines having the highest levels of plasticity for one body part were not necessarily the most plastic for the other body part (S1B Fig). Furthermore, for thorax, but not abdomen, we found that genotypes with larger CVs had steeper negative reaction norms. Finally, we also found no correlation between our size plasticity measurements and various fitness-related traits measured in the DGRPs (S2B Fig), including longevity [49], starvation resistance, chill coma recovery [46], and immune-defense traits [50, 56].

Genetic basis of variation in body size plasticity

We used a GWAS approach to identify DNA sequence polymorphisms associated with variation in thermal plasticity for thorax and abdomen size in the DGRP. Because the loci carrying allelic variation for the direction and extent of environmental responsiveness are not necessarily the same, we used both the raw and absolute values of the slopes of the DGRP reaction norms as quantitative traits (Fig 3A, S3 Fig). The candidate QTLs significantly associated with variation in plasticity were typically only so in relation to a single property of the reaction norm (raw or absolute slope) or body part (thorax or abdomen; Fig 3C, S3 Table). We also found that these allelic variants fell within different genomic regions (e.g. UTR, intronic, coding) within or nearby 192 different putative genes (Table 2, S3 Table). Gene ontology enrichment analysis of the candidate QTLs showed an over-representation of vesicle-mediated processes (e.g. phagocytosis and endocytosis; S6A Fig), while network enrichment analyses (protein-protein interaction network followed by a KEGG pathways enrichment analysis) revealed an over-representation for SNARE interactions and Notch pathways (S6B Fig), both of which have been implicated in diverse biological functions [5760]. We also found that in the vast majority of cases, alleles associated to increased environmental responsiveness were at lower frequencies in the DGRP (Fig 3D, S5 Fig).

thumbnail
Table 2. Details of candidate QTLs selected for functional validation.

https://doi.org/10.1371/journal.pgen.1007686.t002

To explore to what extent loci that contribute to variation in size plasticity also contribute to variation in body size within environments, we also performed GWAS analyses using body size at 17°C and 28°C as quantitative traits (Fig 3B, S4 Fig, S4 Table). This analysis revealed QTLs that were mostly environment- and body part-specific (Fig 3C, S4 Table), including no overlap between our candidate QTLs associated with variation in thorax and abdomen size and those reportedly associated with head size at 25°C [51]. Moreover, we found little overlap between candidate QTLs contributing to variation in size plasticity and those contributing to within-environment size variation (Fig 3C), but some overlap in terms of network enrichment (S6 Fig). None of our size traits or plasticity therein was affected by chromosomal inversions (p-value > 0.01), or by the genetic relatedness among DGRP lines (low and non-significant coefficients of phylogenetic signal Blomberg’s K and Pagel’s λ; S2C Fig).

Validation of selected GWAS hits

We selected a number of significant QTLs for validation via different approaches (Fig 4, Table 2, S2 Dataset). To test selected candidate genes, we used available null mutants and inducible gene knock-downs (with RNA interference using the Gal4/UAS system). If a candidate gene affects plasticity, we expected to see a difference in the slope of thermal reaction norms between genotypes with abolished (mutant) or reduced (knock-down) gene function in relation to the corresponding control genotypes (with “wildtype” gene function). To test specific significant SNPs/Indels, we used a SNP-based validation approach, hereafter called Mendelian Randomization (see Materials and methods), that allowed comparisons between genotypes fixed for the candidate SNP (minor versus major alleles) but not for any other significant SNP for the same trait. If a candidate SNP affects plasticity, we expected a difference in slope of the reaction norms between newly-established genotypes carrying the minor versus the major allele at the target SNP.

Using these methods, we confirmed a role in thermal plasticity for six out of seven candidate QTLs (Fig 4, S7 Fig, Table 2). For genes Hsp60 (Fig 4A), btv (Fig 4B), Men (Fig 4E), and Eip75B (Fig 4F), plasticity was different between genotypes with impaired gene function (knock-out or knock-down) versus controls. For SNPs in genes CG43902 (Fig 4C) and ACC (Fig 4D), plasticity was different between new genotypes with minor versus major allele. We did not find a difference in abdomen size plasticity between genotypes for candidate QTL CG43117 (S7G Fig, Table 2, S2 Dataset). For all the confirmed candidates for plasticity, the genotypes with impaired gene function were more plastic than their respective controls, and the DGRP genotypes harboring the minor allele were more plastic than those harboring the major allele (S7 Fig). We also validated three out of four candidate QTLs for within-temperature variation in body size (Fig 4, S7 Fig, Table 2, S2 Dataset). Genes Nmdmc (Fig 4G) and Optix (Fig 4I) affected thorax size at 28°C and at 17°C, respectively, while a SNP in gene CG14688 (Fig 4H) affected thorax size at 28°C. We did not find a difference in abdomen size at 28°C between genotypes for candidate QTL Wapl (S7K Fig, Table 2, S2 Dataset).

To explore the pleiotropic effect of validated plasticity QTLs, we investigated whether the plastic response was also seen in the body part for which the SNP/gene had not been significantly associated to in the GWAS analysis (S7 Fig, Table 2). Out of the six validated plasticity QTLs, we only found cross-body part effects for gene btv; initially implicated in variation in plasticity of thorax size, this gene was also found to influence variation in plasticity of abdomen size (S7B Fig, Table 2).

Discussion

Body size and body size proportions are traits closely associated to fitness [1, 2, 5], which vary greatly between species and populations, as well as between sexes and between same-sex individuals [11, 39, 62]. Environmental conditions, such as temperature or food availability, can work both as inter-generational selective agents impacting body size evolution, and as intra-generational instructive agents that affect body size during development [7, 9, 33, 63]. Studies in various species have explored what shapes inter- and intra-specific differences in size, including the physiological basis of body size regulation [16, 36, 38, 64] and the genetic basis of variation in body size [6, 65, 66].

Components of variance in body size

Studying a panel of populations representing naturally-segregating alleles, the DGRP, we quantified effects of G, E, and GxE interactions on the size of two body parts (thorax and abdomen). As is well documented for various species of insects [32, 67, 68], most D. melanogaster genotypes we analyzed showed larger bodies when flies were reared at our lower temperature. However, we also documented cases of genotypes showing no plasticity (robustness) or showing size plasticity in the opposite direction. We also found a positive correlation in the levels of plasticity for the two body parts. The strong associations between the sizes of different body parts and plasticity therein is likely to reflect the tight regulation of body proportions, which is key for organismal performance [7, 69].

It is unclear to what extent a genotype’s responsiveness to environmental conditions (i.e. its plasticity) is associated with inter-individual differences found within a given environment for that same genotype (quantified with the coefficient of variation). While the latter is presumably un-accountable for by the effects of G, E, or GxE, it could reflect small genetic differences between individuals (e.g. derived from somatic mutation), micro-environmental variation (e.g. differences within a vial), or stochasticity in phenotype expression (e.g. developmental noise). We found that genotypes that were more plastic for thorax size (but not abdomen) also had higher levels of intra-genotype, intra-environment variation (i.e. higher coefficient of variation). Whether this component of phenotypic variance is assignable to micro-environmental variation and whether it has its own genetic basis has started to be investigated [53, 70, 71] and will, undoubtedly, be a topic of targeted future research.

QTL for size and size plasticity of different body parts

By using the raw and absolute values of the slopes of reaction norms as quantitative traits, we identified loci associated with variation in size plasticity. Genetic variation for environmental responsiveness could, in principle, involve different types of molecular players and could affect multiple traits in a similar or different manner. We described QTLs influencing size plasticity corresponding to different functions in terms of putative SNP effects (e.g. missense, regulatory, or synonymous mutations; Table 2, S3 Table), and described molecular function and biological process for corresponding genes. These genes could potentially be mediating environmental effects at different levels, from the perception of the environmental cue (e.g. gene btv, which has been implicated in sensory perception [72]), to the transmission of that information to developing tissues (e.g. gene Eip75B, coding for an ecdysone receptor [73]), or the execution of the information on those tissues (e.g. genes Men, ACC, and Hsp60A, coding for two metabolic enzymes and a chaperone [73], respectively).

Presumably, genes higher up in the process of responding to the environment (e.g. those involved in the perception of external conditions versus those responding in specific tissues) would be more likely to affect multiple plastic traits in a concerted manner. With the exception of btv, none of our validated plasticity QTLs affected plasticity for other than the body part they had been identified as QTL for. Even for the complete set of candidate loci, we found very little overlap between QTLs for plasticity of different body parts (thorax versus abdomen), as well as for different properties of the reaction norms (raw versus absolute value of slopes). Furthermore, we also documented mostly private QTLs influencing variation in size at any given environment (i.e. body part and temperature-specific). Sex-, body part-, and environment-specific QTL effects had been previously documented for various traits in different models [51, 7476]. In D. melanogaster, for example, different loci have been associated to variation in bristle number in different body parts [76], and to variation in size in different environments [77]. Such private QTLs can potentially facilitate independent evolution of the traits.

Previous works exploring the genetic basis of environmentally sensitive variation have mostly focused on investigating QTLs whose effect vary across environments (QTL-by-environment interactions) for a variety of traits in different species [66, 7880]. Much less attention has been paid to unraveling the allelic variants contributing to differences in plasticity itself. Exceptions include mapping of the genetic basis of thermal plasticity in life-history traits in Caenorhabditis elegans [81], of photoperiodic plasticity in multiple traits in Arabidopsis thaliana [82] and, more recently, of thermal plasticity in cold tolerance in D. melanogaster [53]. Our results revealed little overlap between the QTLs that contribute to variation in trait within environments and the QTLs that contribute to variation in trait plasticity, assessed from the slope of reaction norms. We documented loci underlying variation in size plasticity (i.e. properties of reaction norms) that are different from those underlying variation in size at any temperature (i.e. at 17°C and at 28°C). These results shed light onto a long-standing discussion about the genetic underpinnings of plasticity, which argue that either the genetic control of phenotypic plasticity happens via specific loci determining plastic responses or via the same loci that control trait values at a given environment [8386]. Our data show that the genetic basis for trait plasticity, to a large extent, differs from the genetic basis for phenotypic variation in the trait itself.

Evolution of size and size plasticity

Plasticity can be adaptive in that it helps populations cope with environmental heterogeneity, and it has even been argued that it can promote phenotypic and taxonomic diversification [2022, 27]. Theoretical models highlight the ecological conditions that should influence the evolution of plasticity, such as the predictability of environmental fluctuations [87] and costs of plasticity [88, 89]. Plasticity is generally presumed to be costly and only selected for in predictably heterogeneous environments, such as seasons [90]. The absence of a correlation between our thermal plasticity measurements and various fitness-related traits measured for the same genotypes could not identify any such cost. These potential costs might involve traits that have not been considered here, or these same traits but under (environmental) conditions that were not those assayed.

The ability to respond or resist environmental perturbation, and the balance between both processes, can be crucial for fitness in variable environments. In the DGRP, even though some degree of environmental responsiveness is maintained, we found that the alleles contributing to increased levels of plasticity occur nearly always at lower frequencies (i.e. the genotypes with the minor allelic variant having steeper reaction norms than those with the major allele). It is unclear to what extent this is the result of natural selection by the thermal regime that the natural population from which the DGRP was derived was exposed to, and/or the result of the process of deriving the mapping panel in the laboratory. It is also unclear to what extent QTLs for size plasticity in the DGRPs are those under selection in other populations. While it is conceivable, if not likely, that different QTLs contribute to variation in plasticity (or other quantitative traits) in different populations, we did find that a number of our plasticity QTLs have been targets of selection in other populations. Specifically, some of our candidate genes for size plasticity appear to have been selected in experimental populations of D. melanogaster evolving under different fluctuating thermal regimes [91]. Among our 192 candidate QTLs for thermal plasticity, eight genes (including the validated btv) had changes in the populations evolving under hot and cold temperatures fluctuations [91], nine genes (including Men) had changes in populations evolving under hot fluctuations, and 25 genes had changes in the populations evolving under cold temperatures fluctuations (see all overlaps in S3 Table). Gene Eip75B has also been previously implicated in the response to artificial selection for body size [92] and in differentiation between clinal populations [93, 94], which typically represent different thermal environments.

Altogether, our results shed light onto the nature of inter-genotype variation in plasticity, necessary for the evolution of plasticity under heterogeneous environments. We showed that QTLs for size plasticity: 1) bear alleles for increased plasticity at low frequencies, 2) correspond to polymorphisms in different genomic regions and within genes of a multitude of functional classes, and 3) are mostly “private QTLs”, with little overlap between our various GWAS analysis. The latter underscores the potential for independent evolution of trait and trait plasticity (different QTLs for size plasticity and for within-environment size variation), plasticity of different body parts (different QTLs for size plasticity of thorax and of abdomen), and even properties of the environmental response (different QTLs for raw and absolute slopes of thermal reaction norms).

Materials and methods

Fly stocks and rearing conditions

Data for the GWAS was collected from adult female flies of the Drosophila Genetic Reference Panel (DGRP) obtained from the Bloomington Stock Center. The DGRP is a set of fully sequenced inbred lines collected from a single population in Raleigh, NC, USA [46, 48]. The number and the details of the lines included in the GWAS for each trait can be found in S2 Table. Mutant stocks for the functional validations were: Hsp60A (stock 4689 from Bloomington), MenEx3 and MenEx55 (obtained from the T. Merritt lab). Control genetic backgrounds were w1118 (stock 5905, from Bloomington) and Canton-S (obtained from C. Mirth lab). UAS-Gal4 and UAS-RNAi lines used for validations were: stocks 6803 for bab-Gal4, 5138 for tub-Gal4, 28737 for btv-RNAi, and 35785 for mCherry-RNAi (all obtained from the Bloomington stock center), and stocks v108399 and v110813 for Eip75B and Optix-RNAi, respectively (obtained from the VDRC stock center).

Fly stocks were maintained in molasses food (45 gr. molasses, 75gr sugar, 70gr cornmeal, 20 gr. Yeast extract, 10 gr. Agar, 1100 ml water and 25 ml of Niapagin 10%) in incubators at 25°C, 12:12 light cycles and 65% humidity until used in this study. For the experiments, we performed over-night egg laying from ~20 females of each stock in vials with ad libitum molasses food. Eggs were then placed at either 17°C or 28°C throughout development. We controlled population density by keeping between 20 and 40 eggs per vial. We reared 200 DGRP lines and quantified thorax and abdomen size of 5 to 20 females per line, temperature and replicate. For 135 DGRP lines, we ran two replicates and for 33 lines we ran three replicates. The total number of flies used varied among DGRP lines due to differences in mortality at one or both of the temperatures. For some specimens, we could only quantify size of one body part if, for example, the individual was not properly positioned in the image or was damaged. Full details on the stocks used and the number of flies used per stock and temperature can be found in S1 Dataset and S2 Table. Rearing conditions for the validations of candidate QTLs were similar to those used for the DGRP lines.

Phenotyping body size and plasticity

Adult female flies (8–10 days after eclosion) were placed in 2ml Eppendorf and killed in liquid nitrogen followed by manual shaking to remove wings, legs and bristles. Bodies were mounted on Petri dishes with 3% Agarose, dorsal side up, and covered with water to avoid light reflections. Images containing 10 to 20 flies were collected with a LeicaDMLB2 stereoscope and a Nikon E400 color camera under controlled imaging conditions of light and white-balance. Images were later processed with a customized Mathematica macro to extract size measurements. For this purpose, we drew two transects per fly, one in the thorax and one in the abdomen, using body landmarks (as shown in S1A Fig). Size of each body part was initially quantified as the number of pixels in the transect and later converted to millimeters. For abdominal transects, when necessary, we performed an additional step that involved the removal of pixels corresponding to the membranous tissue that is sometimes visible between segments.

Genome-Wide association study

For each body part (thorax and abdomen), we performed four independent Genome-Wide Analyses (GWAS): two for thermal plasticity (raw and absolute values of the slopes of the reaction norms), and two for within-environment variation (length at 17°C and length at 28°C). Slopes of the reaction norm were calculated as the slope of the linear model lm (Size ~ Temperature) for each body part and DGRP line. We used linear mixed-effects models (lmer) in lme4 R package to test which polymorphisms explained variation in size plasticity or in size. The GWAS analyses for variation in thermal plasticity tested for effects of fixed factor Alelle (corresponding to each polymorphic site), and random factors Wolb (corresponding to Wolbachia status (0 or 1) of each DGRP line [7,8]) and DGRP (i.e. genetic background) to variation in the dependent variable Slope (i.e. raw or absolute values of the reaction norms). This corresponds to notation lmer (Slope ~ Allele + (1|Wolb/DGRP)) in lme4 R package [95]. The GWAS analyses for within-environment variation tested the model lmer (Size ~ Allele + (1|Wolb/DGRP), where Size is the dependent variable (thorax or abdomen length from flies reared at 17°C or at 28°C) and all the other terms are the same as described above for the plasticity GWAS. All the GWAS were performed by using polymorphisms where we had information for at least ten DGRP lines per allele. We did not find an effect of Wolbachia in any of our GWAS analyses.

For each of the GWAS, we annotated the SNPs with an arbitrary and commonly used p-value < 10e-5 using the FlyBase annotation (FlyBase release FB2017_05; [73]). For the same SNPs, we performed first, a gene ontology enrichment analysis using the publicly available GOrilla Software [96, 97] and second, a network enrichment analysis using gene-enrichment and pathway-enrichment analyses were done using the publicly available NetworkAnalyst Software [98, 99]; using all nodes from first order network generated with IrefIndex Interactome settings.

Analyses of the overlap in significant QTLs (p-value < 10e-5) from different GWAS analyses was done for individual polymorphic sites (considered to be the same based on genomic position and type) and for the genes those sites were annotated to (using FlyBase release FB2017_05; [73]).

We tested for the effect of the chromosomal inversions (In_3R_K, In_3R_P, In_2L_t, In_2R_NS and In_3R_Mo) on our thorax and abdomen traits by using linear models (lm (Mean Size ~ Inversion) for within-environment size variation and lm (Slope ~ Inversion) for size plasticity variation).

Genetic distance matrix for the DGRPs was obtained from http://dgrp2.gnets.ncsu.edu/data.html and was used to perform a cluster hierarchical dendogram using ape and phylobase R packages. We estimated the phylogenetic signal and statistical significance for each of our traits using Blomberg’s K [100] and Pagel’s λ [101] metrics with the phylosig function in the phytools R package [102].

Functional validations

The subsample of significant QTLs to be validated was taken from a first list of candidates (S3 and S4 Figs) selected based on p-value and corresponding peaks in the Manhattan plots (clear peaks prioritized), putative effect (missense and regulatory variants prioritized over intergenic variants), associated genes (annotated and known function prioritized). We used three methods for validation, depending on QTL properties: null mutants and RNAi (Gal4/UAS system) for genes containing several significant SNPs and/or containing SNPs corresponding to missense variants, and Mendelian Randomization (MR) for SNPs in genes with little or no information available. Mutant and RNAi test that no or low levels of peptide affect variation in the quantitative trait for which the gene was identified as a candidate QTL while MR tests for sufficiency and independence from genetic background of the specific allele. Following these criteria we tested a total of 11 candidate SNPs/genes.

Validations by null mutants were done by comparing the phenotype in the heterozygous mutant stock with its respective genetic background. Validations by RNAi were done by comparing, for each Gal4 driver line, the phenotype of the gene of interest knockdown with the corresponding control cross using UAS-mCherryRNAi as well as with the corresponding control genetic background for the UAS line. We always used two different driver lines for our validations by RNAi: tub-Gal4 and bab-Gal4. Gene tub is ubiquitously expressed throughout development and gene bab is expressed in multiple tissues during different stages of development. Both genes include expression in developing thoraxes and abdomens (see FlyBase reports FBgn0003884 and FBgn0004870, respectively). However, for all candidate genes selected for RNAi validation, except Nmdmc, the crosses between RNAi line and tub-Gal4 were lethal.

The identity of the SNPs tested by MR is given by their annotation with Genome Release v6. For each candidate SNP, we first selected 10 DGRP lines to make a population with the minor allele fixed and 10 others to make a population with the major allele fixed. The 10 DGRP lines used to create each population were checked for having only one of the significant QTLs (p-value < 10e-5) fixed and not the others. These lines were used to generate four populations, two fixed for the major allele and two for the minor allele (S2 Table). Each population was established by crossing 8 virgin females from each of 5 of the same-allele lines to 8 males of the other 5 lines. Reciprocal crosses were used to set two independent populations per allele. These populations were allowed to cross for eight generations to randomize genetic backgrounds. We confirmed by Sanger sequencing that those populations had our candidate allele fixed. Primer sequences used to confirm the allele in each population were:

  1. Gene CG43902—forward primer: ACCACCAACATCAGCGTTTC; reverse primer: TGGTTTCGGCGTAGTTGTTG.
  2. Gene ACC–forward primer: TGGGAAAAACCGGCCTAAGA; reverse primer: ATTTGTGGCTGTGGATTGCG.
  3. Gene CG43117 –forward primer: TAAGCAAAATGTGGCGTGCA; reverse primer: TTAACATGGATCCTGCGCAC
  4. Gene CG14688 –forward primer: CATACTTTGACAGACGGCCG; reverse primer: CGGCTACATTGTCATCGAGG

Statistical analyses

All statistical analyses were performed with R Statistical Package version 3.3.1 [103]. For each body part and temperature, we used linear mixed-effects model (lmer) in lme4 R package [95] to test for the effect of replicate on size (model lmer (Size ~ Replicate + (1|DGRP/Replicate))), that were found to be non-significant (p-value > 0.05). Individuals from different replicates were pooled for all other analyses. We then used linear models (lm) to test for the within-environment effect of genotype (DGRP) on size (model lm (Size ~ DGRP)). We also used linear models to test for plasticity in size (i.e. the interaction between genotype (DGRP) and temperature (model lm (Size ~ DGRP*Temperature))). Reaction norms for each DGRP line were calculated by using the linear model lm (Size ~ Temperature). We extracted two properties of the reaction norms per DGRP line and body part: the absolute value of the slope as a measurement of thermal sensitivity, describing only the magnitude of the response to temperature, and the raw value of the slope as a measurement which describes also the direction of that response. We defined plastic genotypes as those DGRP lines whose reaction norm slope was significantly different from zero (p-value < 0.05).

We used the total number of phenotyped individuals for each DGRP and temperature to perform the calculations of the summary statistics in S2 Table. We used Pearson correlations (alpha = 0.99) to test for linear correlation in size between body parts, controlling for DGRP lines. We also used Pearson correlations to test for linear correlations among our measured traits and between those and other available datasets for the DGRPs. For this, we used the mean value per DGRP line for each trait and the corrplot R package [104]. We report both correlation coefficient and significance levels. Available DGRP phenotypes that were used to correlate with our traits were: size measurements at 25°C [51], longevity [49], starvation resistance, chill coma recovery [46], tolerance to infection with Providencia rettgeri bacteria [56] and resistance to infection with Metarhizium anisopliae fungi or with Pseudomonas aeruginosa bacteria [50].

Broad sense heritability for size at each temperature was estimated as H2 = σ2A/(σ2A + σ2W) where σ2A and σ2W are the among-line and within-line variance components, respectively. Heritability of plasticity was calculated as H2 = σ2G*E/σ2TOTAL where σ2G*E and σ2TOTAL are the variance associated with the genotype by environment interaction and total variance components, respectively, as proposed in Scheider and Lyman (1989). Variance components were extracted using varcomp R package.

For the functional validations of within-environment SNPs and genes we used the linear models lm (Size ~ Allele) and lm (Size ~ Genotype), respectively. For the validations of plasticity SNPs and genes we used the models lm (Size ~ Genotype*Temperature) and lm (Size ~ Allele*Temperature), respectively. In all cases, significant differences among groups were estimated by post hoc comparisons (Tukey’s honest significant differences).

Supporting information

S1 Fig. Variation in size plasticity in the DGRP lines.

A. Image of an adult female D. melanogaster fly showing the thoracic and abdominal transects. B. Slope and confidence interval of the reaction norms in the DGRP lines, calculated as the regression model lm (Size ~ Temperature) in the thoraxes (grey) and abdomens (green) of each DGRP line (Y axis). Slopes are ranked by their value in the thorax. Horizontal bars represent the mean of all DGRP lines for the raw slope of the reaction norm (dashed bar) and the absolute slope of the reaction norm (solid bar) per body part. C. Histograms showing the frequency of the size measurements in thoraxes and abdomens of all DGRP lines reared at 17°C (blue) and 28°C (red). Dashed line represents the mean value for all DGRP lines at a given temperature. D. Histograms for the absolute slope of the reaction norms (calculated as the absolute value for the slope of the regression lm (Size ~ Temperature) in thoraxes and abdomens. Mean value for the absolute slope of all DGRP lines is indicated with a green arrowhead.

https://doi.org/10.1371/journal.pgen.1007686.s001

(PDF)

S2 Fig. Phenotypic co-variation in size and size plasticity with fitness and genetic distance.

A. Heat map of Pearson’s correlation coefficients between our within-environment size measurements (17°C and at 28°C) and size measurements at 25°C. Non-significant correlations (p-value > 0.01) are indicated with an ‘X’. B. Heat map of Pearson’s correlation coefficients between our traits (mean size at each temperature and raw and absolute slopes of the reaction norms) and fitness-related traits. Non-significant correlations (p-value > 0.01) are indicated with an ‘X’. C. Dendogram of the genetic distance between DGRP lines. Corresponding trait values are shown as a heat map and scaled for each trait independently. Coefficients of Blomberg’s K phylogenetic signal were: K = 0.24; p-value = 0.17 (thorax at 17°C), K = 0.23; p-value = 0.37 (thorax at 28°C), K = 0.22; p-value = 0.78 (thorax raw slope), K = 0.24; p-value = 0.20 (thorax absolute slope), K = 0.24; p-value = 0.24 (abdomen at 17°C), K = 0.22; p-value = 0.67 (abdomen at 28°C), K = 0.23; p-value = 0.55 (abdomen raw slope) and K = 0.21; p-value = 0.89 (abdomen absolute slope). Pagel’s λ coefficient of phylogenetic signal was λ = 6.88e-05; p-value = 1, for all the traits in both body parts.

https://doi.org/10.1371/journal.pgen.1007686.s002

(PDF)

S3 Fig. GWAS for variation in size plasticity per chromosomal arm.

Manhattan plots corresponding to the four GWAS performed for variation in size plasticity: raw slopes of the reaction norms (grey dots) and absolute slope of the reaction norms (black dots) for thorax (left side) and abdomen (right side) size. For each trait and body part, the GWAS was done testing the model lm (Slope ~ Allele + (1|Wolb/DGRP)). The significance level for each SNP along the chromosomal arms is shown as the log10 p-value. Some of the genes associated to SNPs/Indels with a p-value < 10e-5 and that we consider as particularly interesting are shown. The position and identity of the polymorphisms in this figure is given by their annotation with Genome Release v.5.

https://doi.org/10.1371/journal.pgen.1007686.s003

(PDF)

S4 Fig. GWAS for variation in size per chromosomal arm.

Manhattan plots corresponding to the four GWAS performed for within-environment variation in size: at 17°C (blue dots) and at 28°C (red dots) for thorax (left side) and abdomen (right side) size. For each trait and body part, the GWAS was done testing the model lm (Size ~ Allele + (1|Wolb/DGRP)). The significance level for each SNP along the chromosomal arms is shown as the log10 p-value. Some of the genes associated to SNPs/Indels with a p-value < 10e-5 and that we consider as particularly interesting are shown. The position and identity of the polymorphisms in this figure is given by their annotation with Genome Release v.5.

https://doi.org/10.1371/journal.pgen.1007686.s004

(PDF)

S5 Fig. Effect and frequency of candidate SNPs/Indels for variation in size plasticity.

A. Mean and confidence interval of the absolute slope of the reaction norms for abdomen size (Y axis) per allele (minor allele in grey, minor allele in magenta) at each candidate plasticity SNP/Indel (p-value < 10e-5) along the chromosomal arms (X axis). B. Mean and confidence interval of the raw slope of the reaction norms for size (Y axis) per allele (minor in grey, minor in magenta) at each candidate plasticity QTL (p-value < 10e-5) along the chromosomal arms (X axis) per body part. The position and identity of the polymorphisms in this figure is given by their annotation with Genome Release v.5.

https://doi.org/10.1371/journal.pgen.1007686.s005

(PDF)

S6 Fig. Functional relationships between candidate genes influencing size and size plasticity.

A-B. Gene ontology and network enrichment analyses for genes harboring allelic variants significantly associated with variation in size plasticity. All SNPs/Indels with a p-value < 10e-5 from the GWAS for the raw and absolute slopes of the reaction norms of thoraxes and abdomen were pooled to perform these analyses. A. Results of the gene-ontology enrichment analysis for genes harboring allelic variants significantly associated with variation in size reaction norms. B. Network enrichment analyses (KEGG gene enrichment analyses of the protein-protein interactions) for genes harboring allelic variants significantly associated with variation in size reaction norms. All our candidate QTLs for variation in size plasticity were pooled for this analysis. This corresponds to the QTLs from four independent GWAS: raw and absolute values of the slopes of the reaction norms for thoracic and abdominal size. C. Network enrichment analyses (KEGG gene enrichment analyses of the protein-protein interactions) for genes harboring allelic variants significantly associated with variation in size reaction norms. SNPs with p-value < 10e-5 from the GWAS for variation at 17°C and for variation at 28°C were pooled to perform this analysis. Note that for allelic variants associated with variation in size plasticity, the gene-ontology enrichment analyses showed no enriched GO terms. All our candidate QTLs for variation in size were pooled for this analysis. This corresponds to the QTLs from four independent GWAS: thoracic and abdominal size for flies reared at 17°C and at 28°C.

https://doi.org/10.1371/journal.pgen.1007686.s006

(PDF)

S7 Fig. Allele effect in the DGRP and pleiotropy effect for the QTLs selected for validation.

For each candidate QTLs, the effect of the minor and major alleles in the DGRPs are shown in the left panels and the pleitropic effect is shown in the right panels. For validations via mutant or RNAi, genotypes with impaired gene function are shown in magenta and control genotypes are shown in black. Similarly, for validations via Mendelian Randomization (MR), the two populations fixed for the minor allele are shown in magenta and the two populations for the major allele are shown in black. The identity of the SNP/Indels is given by their annotation with Genome Release v.6. as Chromosome:Position. Size measurements are given as length in mm. A. Left panel: slope of the reaction norms in the DGRP lines with the major and the minor alleles for insertion in position X:11108613, within gene Hsp60. Right panel: reaction norms in mutant Hsp60A/+ and controls Canton-S (filled circles, solid line) and Fm7a/Canton-S (empty circles, dashed line). B. Left panel: slope of the reaction norms in the DGRP lines with the major and the minor alleles for SNP in position 2L:17961008, within gene btv. Right panel: reaction norms for size in btv-RNAi/bab-Gal4 and control lines KK (filled circles, solid line) and mCherry-RNAi/bab-Gal4 (empty circles, dashed line). C. Left panel: slope of the reaction norms in the DGRP lines with the major and the minor alleles for SNP in position X:10192303, within gene CG43902. Right panel: reaction norms in the four MR populations corresponding to SNP in position X:10192303, within gene CG43902. D. Left panel: slope of the reaction norms in the DGRP lines with the major and the minor alleles for SNP in position 2R:7983239, within gene ACC. Right panel: reaction norms in the four MR populations for SNP in position 2R:7983239 within gene ACC. E. Left panel: slope of the reaction norms in the DGRP lines with the major and the minor alleles for SNP in position 3R:12720159 within gene Men. Right panel: reaction norms in Men mutants MenEx3/+ (filled circles, solid line) and MenEx55/+ (empty circles, dashed line) and control line w1118. F. Left panel: slope of the reaction norms in the DGRP lines with the major and the minor alleles for SNP in position 3L:17999272, within gene Eip75B. Right panel: reaction norms in Eip75B-RNAi/bab-Gal4 and control lines KK (filled circles, solid line) and mCherry-RNAi/bab-Gal4 (empty circles, dashed line). G. Left panel: slope of the reaction norm in the DGRP lines with the major and the minor alleles for SNP in position 3R:26454823, within gene CG43117. Right panel: reaction norms in the four MR populations for SNP 3R:26454823 within gene CG43117. H. Left panel: size at 28°C in the DGRP lines with the major and the minor alleles for SNP in position 3R:9049187, within gene Nmdmc. Right panel: size at 28°C in Nmdmc-RNAi/tub-Gal4 and control lines GD (filled circles) and mCherry-RNAi/tub-Gal4 (filled circles). I. Left panel: size at 28°C in the DGRP lines with the major and the minor alleles for SNP in position 3R:10678848, within gene CG14688. Right panel: size at 28°C in the four MR populations for SNP in position 3R:10678848, within gene CG14688. J. Left panel: size at 17°C in the DGRP lines with the major and the minor alleles for SNP in position 2R:8032561, within gene Optix. Right panel: size at 17°C in Optix-RNAi/bab-Gal4 and control lines KK (filled circles) and mCherry-RNAi/bab-Gal4 (filled circles). K. Left panel: size at 28°C in the DGRP lines with the major and the minor alleles for SNP in position X:2152985, within gene Wapl. Right panel: size at 28°C in Wapl-RNAi/bab-Gal4 and control lines KK (filled circles, solid line) and mCherry-RNAi/bab-Gal4 (empty circles, dashed line). For the validations of plasticity QTLs (genes Hsp60, CG43902, Men, ACC, btv, Eip75, and CG43117), we tested the model lm (Trait ~ Genotype*Temperature). For the validations of within-environment QTLs (genes Nmdmc, CG14688, Optix and Wapl), we tested the model lm (Trait ~ Genotype). Results from the statistical models are shown above each plot and, when significant, indicated by asterisks in the plot (where p-values < 0.001 and < 0.01 are denoted by '***' and '**', respectively). Differences for more than two groups were estimated by post hoc comparisons (Tukey’s honest significant differences) and are indicated by different letters in each plot (p-value < 0.01).

https://doi.org/10.1371/journal.pgen.1007686.s007

(PDF)

S2 Table. Summary of phenotypic measurements for size and size plasticity in the DGRP.

https://doi.org/10.1371/journal.pgen.1007686.s009

(DOCX)

S3 Table. GWAS results for variation in size plasticity.

https://doi.org/10.1371/journal.pgen.1007686.s010

(DOCX)

S4 Table. GWAS results for variation in size.

https://doi.org/10.1371/journal.pgen.1007686.s011

(DOCX)

S1 Dataset. Phenotypic variation in size in the DGRP.

Raw individual data for size measurements (length in mm) in thoraxes and abdomens of females adult flies from the DGRP lines reared at 17°C and at 28°C.

https://doi.org/10.1371/journal.pgen.1007686.s012

(XLSX)

S2 Dataset. Functional validations of selected GWAS candidates.

Raw data for size measurements (length in mm) in thoraxes and abdomens of flies reared at 17°C and at 28°C from the different genetic backgrounds used for functional validations.

https://doi.org/10.1371/journal.pgen.1007686.s013

(XLSX)

Acknowledgments

We are grateful to Thomas Merritt for sharing the Men mutants, and to Daniel Sobral and IGC’s Bioinformatics Unit and Fly Unit for technical support. We also thank Erik van Bergen for comments on the manuscript. Computations were performed on the EDB-Calc Cluster, which uses a software developed by the Rocks(r) Cluster Group (San Diego Supercomputer Center, University of California, San Diego and its contributors), and is hosted by the laboratory "Evolution et Diversité Biologique" (EDB) and supported by Pierre Solbes.

References

  1. 1. Kingsolver JG, Huey RB. Size, temperature, and fitness: three rules. Evol Ecol Res. 2008;10:251–268.
  2. 2. Peters RH. The ecological implications of body size. Cambridge: Cambridge University Press; 1986. 329 p.
  3. 3. Ripple WJ, Wolf C, Newsome TM, Hoffmann M, Wirsing AJ, McCauley DJ. Extinction risk is most acute for the world’s largest and smallest vertebrates. Proc Natl Acad Sci U S A. 2017 Sep 18;114(40):10678–83. pmid:28923917
  4. 4. Smith FA, Lyons SK. Animal body size: linking pattern and process across space, time, and taxonomic group. University of Chicago Press; 2013. 267 p.
  5. 5. Woodward G, Ebenman B, Emmerson M, Montoya J, Olesen J, Valido A, et al. Body size in ecological networks. Trends Ecol Evol. 2005 Jul;20(7):402–9. pmid:16701403
  6. 6. Gadau J, Page RE, Werren JH. The genetic basis of the interspecific differences in wing size in Nasonia (Hymenoptera; Pteromalidae): major quantitative trait loci and epistasis. Genetics. 2002 Jun;161(2):673–84. pmid:12072464
  7. 7. Mirth CK, Shingleton AW. Integrating body and organ size in Drosophila: recent advances and outstanding problems. Front Endocrinol. 2012 Apr 3;3:49.
  8. 8. D’Amico LJ, Davidowitz G, Nijhout H. The developmental and physiological basis of body size evolution in an insect. Proc R Soc B Biol Sci. 2001 Aug 7;268(1476):1589–93.
  9. 9. Nijhout HF. The control of body size in insects. Dev Biol. 2003 Sep;261(1):1–9. pmid:12941617
  10. 10. Barnes C, Maxwell D, Reuman DC, Jennings S. Global patterns in predator-prey size relationships reveal size dependency of trophic transfer efficiency. Ecology. 2010 Jan;91(1):222–32. pmid:20380211
  11. 11. Lafferty KD, Kuris AM. Trophic strategies, animal diversity and body size. Trends Ecol Evol. 2002 Nov;17(11):507–13.
  12. 12. Head ML, Kozak GM, Boughman JW. Female mate preferences for male body size and shape promote sexual isolation in threespine sticklebacks. Ecol Evol. 2013 Jul;3(7):2183–96. pmid:23919161
  13. 13. Mitchell G, van Sittert S, Roberts D, Mitchell D. Body surface area and thermoregulation in giraffes. J Arid Environ. 2017 Oct 1;145:35–42.
  14. 14. Gibert JP, DeLong JP. Temperature alters food web body-size structure. Biol Lett. 2014;10(8).
  15. 15. Twombly S, Tisch N. Body size regulation in copepod crustaceans. Oecologia. 2000;122(3):0318.
  16. 16. Gokhale RH, Shingleton AW. Size control: the developmental physiology of body and organ size regulation. Wiley Interdiscip Rev Dev Biol. 2015 Jul;4(4):335–56. pmid:25808999
  17. 17. Nagashima T, Ishiura S, Suo S. Regulation of body size in Caenorhabditis elegans: effects of environmental factors and the nervous system. Int J Dev Biol. 2017;61(6–7):367–74. pmid:28695956
  18. 18. Glazier DS. Effects of metabolic level on the body size scaling of metabolic rate in birds and mammals. Proc Biol Sci. 2008 Jun 22;275(1641):1405–10. pmid:18348961
  19. 19. Beldade P, Mateus AR, Keller RA. Evolution and molecular mechanisms of adaptive developmental plasticity. Mol Ecol. 2011 Apr 1;20(7):1347–63. pmid:21342300
  20. 20. West-Eberhard MJ. Developmental plasticity and evolution. Oxford University Press; 2003. 794 p.
  21. 21. Gotthard K, Nylin SS. Adaptive plasticity and plasticity as an adaptation: a selective review of plasticity in animal morphology and life history. Oikos. 1995 Oct;74(1):3.
  22. 22. Pfennig DW, Wund MA, Snell-Rood EC, Cruickshank T, Schlichting CD, Moczek AP. Phenotypic plasticity’s impacts on diversification and speciation. Trends Ecol Evol. 2010 Aug 1;25(8):459–67. pmid:20557976
  23. 23. Ghosh SM, Testa ND, Shingleton AW. Temperature-size rule is mediated by thermal plasticity of critical size in Drosophila melanogaster. Proc Biol Sci. 2013 Apr 17;280(1760):20130174. pmid:23595269
  24. 24. Czarnoleski M, Kramarz P, Małek D, Drobniak SM. Genetic components in a thermal developmental plasticity of the beetle Tribolium castaneum. J Therm Biol. 2017 Aug;68(Pt A):55–62. pmid:28689722
  25. 25. Fischer K, Bauerfeind SS, Fiedler K. Temperature-mediated plasticity in egg and body size in egg size-selected lines of a butterfly. J Therm Biol. 2006 May 1;31(4):347–54.
  26. 26. Angilletta MJJ, Niewiarowski PH, Navas CA. The evolution of thermal physiology in ectotherms. J Therm Biol. 2002;27:249–68.
  27. 27. Schlichting C, Pigliucci M. Phenotypic evolution: a reaction norm perspective. Sinauer; 1998. 387 p.
  28. 28. Newman RA. Genetic variation for phenotypic plasticity in the larval life history of spadefoot toads (Scaphiopus couchii). Evolution. 1994 Dec 1;48(6):1773–85. pmid:28565166
  29. 29. Lardies M. Genetic variation for plasticity in physiological and life-history traits among populations of an invasive species, the terrestrial isopod Porcellio laevis. Evol Ecol Res. 2008;10:747–762.
  30. 30. Nokelainen O, van Bergen E, Ripley BS, Brakefield PM. Adaptation of a tropical butterfly to a temperate climate. Biol J Linn Soc. 2018 Jan 15;123(2):279–89.
  31. 31. Robinson SJW, Partridge L. Temperature and clinal variation in larval growth efficiency in Drosophila melanogaster. J Evol Biol. 2001 Dec 20;14(1):14–21. pmid:29280588
  32. 32. Partridge L, Barrie B, Fowler K, French V. Evolution and development of body size and cell size in Drosophila melanogaster in response to temperature. Evolution. 1994 Aug;48(4):1269–76. pmid:28564446
  33. 33. French V, Feast M, Partridge L. Body size and cell size in Drosophila: the developmental response to temperature. J Insect Physiol. 1998;44:1081–9. pmid:12770407
  34. 34. Bochdanovits Z, de Jong G. Experimental evolution in Drosophila melanogaster: interaction of temperature and food quality selection regimes. Evolution. 2003 Aug;57(8):1829. pmid:14503624
  35. 35. Mirth CK, Truman WJ, Riddiford ML. The Ecdysone receptor controls the post-critical weight switch to nutrition-independent differentiation in Drosophila wing imaginal discs. Development. 2009 Jul 15;136(14):2345–53. pmid:19515698
  36. 36. McBrayer Z, Ono H, Shimell M, Parvy J-P, Beckstead RB, Warren JT, et al. Prothoracicotropic hormone regulates developmental timing and body size in Drosophila. Dev Cell. 2007 Dec;13(6):857–71. pmid:18061567
  37. 37. Oldham S, Hafen E. Insulin/IGF and target of rapamycin signaling: a TOR de force in growth control. Trends Cell Biol. 2003 Feb;13(2):79–85. pmid:12559758
  38. 38. Colombani J, Bianchini L, Layalle S, Pondeville E, Dauphin-Villemant C, Antoniewski C, et al. Antagonistic actions of ecdysone and insulins determine final size in Drosophila. Science. 2005 Oct 28;310(5748):667–70. pmid:16179433
  39. 39. Klepsatel P, Gáliková M, Huber CD, Flatt T. Similarities and differences in altitudinal versus latitudinal variation for morphological traits in Drosophila melanogaster. Evolution. 2014;68(5):1385–98. pmid:24410363
  40. 40. Betini GS, McAdam AG, Griswold CK, Norris DR. A fitness trade-off between seasons causes multigenerational cycles in phenotype and population size. Elife. 2017 Feb 6;6(e18770).
  41. 41. De Jong G, Bochdanovits Z. Latitudinal clines in Drosophila melanogaster: body size, allozyme frequencies, inversion frequencies, and the insulin-signalling pathway. J Genet. 2003 Dec;82(3):207–23. pmid:15133196
  42. 42. Mendes CC, Mirth CK. Stage-specific plasticity in ovary size is regulated by insulin/insulin-like growth factor and ecdysone signaling in Drosophila. Genetics. 2016;202(2):703–19. pmid:26715667
  43. 43. Gockel J, Robinson SJW, Kennington WJ, Goldstein DB, Partridge L. Quantitative genetic analysis of natural variation in body size in Drosophila melanogaster. Heredity. 2002 Jul 24;89(2):145–53. pmid:12136418
  44. 44. Wijngaarden PJ, Brakefield PM. The genetic basis of eyespot size in the butterfly Bicyclus anynana: an analysis of line crosses. Heredity. 2000 Nov;85 Pt 5:471–9.
  45. 45. Mundy NI, Badcock NS, Hart T, Scribner K, Janssen K, Nadeau NJ. Conserved genetic basis of a quantitative plumage trait involved in mate choice. Science. 2004 Mar 19;303(5665):1870–3. pmid:15031505
  46. 46. Mackay TFC, Richards S, Stone EA, Barbadilla A, Ayroles JF, Zhu D, et al. The Drosophila melanogaster Genetic Reference Panel. Nature. 2012 Feb 8;482(7384):173–8. pmid:22318601
  47. 47. King EG, Macdonald SJ, Long AD. Properties and power of the Drosophila Synthetic Population Resource for the routine dissection of complex traits. Genetics. 2012;191(3).
  48. 48. Huang W, Massouras A, Inoue Y, Peiffer J, Ràmia M, Tarone AM, et al. Natural variation in genome architecture among 205 Drosophila melanogaster Genetic Reference Panel lines. Genome Res. 2014 Jul 1;24(7):1193–208. pmid:24714809
  49. 49. Ivanov DK, Escott-Price V, Ziehm M, Magwire MM, Mackay TFC, Partridge L, et al. Longevity GWAS using the Drosophila Genetic Reference Panel. Journals Gerontol Ser A Biol Sci Med Sci. 2015 Dec;70(12):1470–8.
  50. 50. Wang JB, Lu H-L, St. Leger RJ. The genetic basis for variation in resistance to infection in the Drosophila melanogaster genetic reference panel. PLOS Pathog. 2017 Mar 3;13(3):e1006260. pmid:28257468
  51. 51. Vonesch SC, Lamparter D, Mackay TFC, Bergmann S, Hafen E, Markow T, et al. Genome-wide analysis reveals novel regulators of growth in Drosophila melanogaster. PLOS Genet. 2016 Jan 11;12(1):e1005616. pmid:26751788
  52. 52. Unckless RL, Rottschaefer SM, Lazzaro BP. A genome-wide association study for nutritional indices in Drosophila. G3. 2015 Jan 12;5(3):417–25. pmid:25583649
  53. 53. Ørsted M, Rohde PD, Hoffmann AA, Sørensen P, Kristensen TN. Environmental variation partitioned into separate heritable components. Evolution. 2018 Nov 28;72(1):136–52. pmid:29125643
  54. 54. Gerken AR, Eller OC, Hahn DA, Morgan TJ. Constraints, independence, and evolution of thermal plasticity: probing genetic architecture of long- and short-term thermal acclimation. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4399–404. pmid:25805817
  55. 55. Nelson CS, Beck JN, Wilson KA, Pilcher ER, Kapahi P, Brem RB. Cross-phenotype association tests uncover genes mediating nutrient response in Drosophila. BMC Genomics. 2016 Dec 4;17(1):867. pmid:27809764
  56. 56. Howick VM, Lazzaro BP. The genetic architecture of defence as resistance to and tolerance of bacterial infection in Drosophila melanogaster. Mol Ecol. 2017 Mar;26(6):1533–46. pmid:28099780
  57. 57. Hong W. SNAREs and traffic. Biochim Biophys Acta—Mol Cell Res. 2005 Jun 30;1744(2):120–44.
  58. 58. Stewart BA, Mohtashami M, Zhou L, Trimble WS, Boulianne GL. SNARE-dependent signaling at the Drosophila wing margin. Dev Biol. 2001 Jun 1;234(1):13–23. pmid:11356016
  59. 59. Andersson ER, Sandberg R, Lendahl U. Notch signaling: simplicity in design, versatility in function. Development. 2011 Sep 1;138(17):3593–612. pmid:21828089
  60. 60. Lai EC, Kimble J. Notch signaling: control of cell communication and cell fate. Development. 2004 Mar 1;131(5):965–73. pmid:14973298
  61. 61. dos Santos G, Schroeder AJ, Goodman JL, Strelets VB, Crosby MA, Thurmond J, et al. FlyBase: introduction of the Drosophila melanogaster Release 6 reference genome assembly and large-scale migration of genome annotations. Nucleic Acids Res. 2015 Jan;43(D1):D690–D697.
  62. 62. Scharf FS, Juanes F, Rountree RA. Predator size—prey size relationships of marine fish predators: interspecific variation and effects of ontogeny and body size on trophic-niche breadth. Vol. 208, Marine Ecology Progress Series. Inter-Research Science Center; 2000. p. 229–48.
  63. 63. Nunney L, Cheung W. The effect of temperature on body size and fecundity in female Drosophila melanogaster: evidence for adaptive plasticity. Evolution. 1997 Oct;51(5):1529. pmid:28568642
  64. 64. Ikeya T, Galic M, Belawat P, Nairz K, Hafen E. Nutrient-dependent expression of insulin-like peptides from neuroendocrine cells in the CNS contributes to growth regulation in Drosophila. Curr Biol. 2002 Aug 6;12(15):1293–300. pmid:12176357
  65. 65. Robertson FW. Studies in quantitative inheritance. XII. Cell size and number in relation to genetic and environmental variation of body size in Drosophila. Genetics. 1959 Sep;44(5):869–96. pmid:17247865
  66. 66. Bergland AO, Genissel A, Nuzhdin S V, Tatar M. Quantitative trait loci affecting phenotypic plasticity and the allometric relationship of ovariole number and thorax length in Drosophila melanogaster. Genetics. 2008;180(1):567–582. pmid:18716336
  67. 67. Atkinson D. Temperature and organism size: biological law for ectotherms? Adv Ecol Res. 1994;25:1–58.
  68. 68. Chapman RF, Simpson SJ, Douglas AE. The insects: structure and function. Cambridge. 2012.
  69. 69. Shingleton AW, Frankino WA, Flatt T, Nijhout H., Emlen DJ. Size and shape: the developmental regulation of static allometry in insects. BioEssays. 2007 Jun;29(6):536–48. pmid:17508394
  70. 70. Morgante F, Sørensen P, Sorensen DA, Maltecca C, Mackay TFC. Genetic architecture of micro-environmental plasticity in Drosophila melanogaster. Sci Rep. 2015 Sep 6;5(1):9785.
  71. 71. Ayroles JF, Buchanan SM, O’Leary C, Skutt-Kakaria K, Grenier JK, Clark AG, et al. Behavioral idiosyncrasy reveals genetic control of phenotypic variability. Proc Natl Acad Sci. 112 (21):6706–11. pmid:25953335
  72. 72. Eberl DF, Duyk GM, Perrimon N. A genetic screen for mutations that disrupt an auditory response in Drosophila melanogaster. Proc Natl Acad Sci U S A. 1997 Dec 23;94(26):14837–42. pmid:9405700
  73. 73. Gramates LS, Marygold SJ, Santos G Dos, Urbano J-M, Antonazzo G, Matthews BB, et al. FlyBase at 25: looking to the future. Nucleic Acids Res. 2017 Jan 4;45(D1):D663–71. pmid:27799470
  74. 74. Beldade P, Brakefield PM, Long AD. Contribution of Distal-less to quantitative variation in butterfly eyespots. Nature. 2002 Jan 17;415(6869):315–8. pmid:11797007
  75. 75. Linnen CR, Poh Y-P, Peterson BK, Barrett RDH, Larson JG, Jensen JD, et al. Adaptive evolution of multiple traits through multiple mutations at a single gene. Science. 2013 Mar 15;339(6125):1312–6. pmid:23493712
  76. 76. Dilda CL, Mackay TFC. The genetic architecture of Drosophila sensory bristle number. Genetics. 2002 Dec;162(4):1655–74. pmid:12524340
  77. 77. Norry FM, Gomez FH. Quantitative trait loci and antagonistic associations for two developmentally related traits in the Drosophila head. J Insect Sci. 2017 Jan;17(1):19. pmid:28130460
  78. 78. Gurganus MC, Fry JD, Nuzhdin S V, Pasyukova EG, Lyman RF, Mackay TF. Genotype-environment interaction at quantitative trait loci affecting sensory bristle number in Drosophila melanogaster. Genetics. 1998 Aug;149(4):1883–98. pmid:9691044
  79. 79. Leips J, Mackay TF. Quantitative trait loci for life span in Drosophila melanogaster: interactions with genetic background and larval density. Genetics. 2000 Aug;155(4):1773–88. pmid:10924473
  80. 80. Fry JD, Nuzhdin S V, Pasyukova EG, Mackay TF. QTL mapping of genotype-environment interaction for fitness in Drosophila melanogaster. Genet Res. 1998 Apr;71(2):133–41. pmid:9717436
  81. 81. Gutteling EW, Riksen JAG, Bakker J, Kammenga JE. Mapping phenotypic plasticity and genotype–environment interactions affecting life-history traits in Caenorhabditis elegans. Heredity (Edinb). 2007 Jan 6;98(1):28–37.
  82. 82. Ungerer MC, Halldorsdottir SS, Purugganan MD, Mackay TFC. Genotype-environment interactions at quantitative trait loci affecting inflorescence development in Arabidopsis thaliana. Genetics. 2003 Sep;165(1):353–65. pmid:14504242
  83. 83. Via S, Lande R. Genotype-environment interaction and the evolution of phenotypic plasticity. Evolution. 1985;39(3):505–22. pmid:28561964
  84. 84. Via S, Gomulkiewicz R, De Jong G, Scheiner SM, Schlichting CD, Van Tienderen PH. Adaptive phenotypic plasticity: consensus and controversy. Trends Ecol Evol. 1995;10(5):212–7. pmid:21237012
  85. 85. Via S. Adaptive phenotypic plasticity: target or by-product of selection in a variable environment? Vol. 142, The American Naturalist. The University of Chicago PressThe American Society of Naturalists; 1993. p. 352–65.
  86. 86. Scheiner SM, Lyman RF. The genetics of phenotypic plasticity. II. Response to selection. J Evol Biol. 1991 Jan 1;4(1):23–50.
  87. 87. Leimar O, Hammerstein P, Van Dooren TJM. A new perspective on developmental plasticity and the principles of adaptive morph determination. Am Nat. 2006 Mar;167(3):367–76. pmid:16673345
  88. 88. Murren CJ, Auld JR, Callahan H, Ghalambor CK, Handelsman CA, Heskel MA, et al. Constraints on the evolution of phenotypic plasticity: limits and costs of phenotype and plasticity. Heredity. 2015 Oct 18;115(4):293–301. pmid:25690179
  89. 89. Callahan HS, Maughan H, Steiner UK. Phenotypic plasticity, costs of phenotypes, and costs of plasticity. Ann N Y Acad Sci. 2008 Jun;1133(1):44–66.
  90. 90. van den Heuvel J, Saastamoinen M, Brakefield PM, Kirkwood TBL, Zwaan BJ, Shanley DP. The predictive adaptive response: modeling the life-history evolution of the butterfly Bicyclus anynana in seasonal environments. Am Nat. 2013 Feb;181(2):E28–42. pmid:23348784
  91. 91. Tobler R, Franssen SU, Kofler R, Orozco-terWengel P, Nolte V, Hermisson J, et al. Massive habitat-specific genomic response in D. melanogaster populations during experimental evolution in hot and cold environments. Mol Biol Evol. 2014 Feb 1;31(2):364–75. pmid:24150039
  92. 92. Turner TL, Stewart AD, Fields AT, Rice WR, Tarone AM. Population-based resequencing of experimentally evolved populations reveals the genetic basis of body size variation in Drosophila melanogaster. PLoS Genet. 2011 Mar 17;7(3):e1001336. pmid:21437274
  93. 93. Kolaczkowski B, Kern AD, Holloway AK, Begun DJ. Genomic differentiation between temperate and tropical Australian populations of Drosophila melanogaster. Genetics. 2011 Jan 1;187(1):245–60. pmid:21059887
  94. 94. Fabian DK, Kapun M, Nolte V, Kofler R, Schmidt PS, Schlötterer C, et al. Genome-wide patterns of latitudinal differentiation among populations of Drosophila melanogaster from North America. Mol Ecol. 2012 Oct;21(19):4748–69. pmid:22913798
  95. 95. Bates D, Mächler M, Bolker B, Walker S. Fitting linear mixed-effects models using lme4. J Stat Softw. 2015 Jun 23;67(1):1–48.
  96. 96. Eden E, Navon R, Steinfeld I, Lipson D, Yakhini Z. GOrilla: a tool for discovery and visualization of enriched GO terms in ranked gene lists. BMC Bioinformatics. 2009 Feb 3;10(1):48.
  97. 97. Eden E, Lipson D, Yogev S, Yakhini Z. Discovering motifs in ranked lists of DNA sequences. PLoS Comput Biol. 2007;3(3):e39. pmid:17381235
  98. 98. Xia J, Gill EE, Hancock REW. NetworkAnalyst for statistical, visual and network-based meta-analysis of gene expression data. Nat Protoc. 2015 May 7;10(6):823–44. pmid:25950236
  99. 99. Xia J, Benner MJ, Hancock REW. NetworkAnalyst—integrative approaches for protein-protein interaction network analysis and visual exploration. Nucleic Acids Res. 2014 Jul 1;42(W1):W167–74.
  100. 100. Blomberg SP, Garland T, Ives AR. Testing for phylogenetic signal in comparative data: behavioral traits are more labile. Evolution. 2003 Apr;57(4):717–45. pmid:12778543
  101. 101. Pagel M. Inferring the historical patterns of biological evolution. Nature. 1999 Oct 28;401(6756):877–84. pmid:10553904
  102. 102. Revell LJ. phytools: an R package for phylogenetic comparative biology (and other things). Methods Ecol Evol. 2012 Apr 1;3(2):217–23.
  103. 103. R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. 2013. http://www.r-project.org/
  104. 104. Taiyun W, Viliam S. R package “corrplot”: visualization of a correlation matrix. 2017. https://github.com/taiyun/corrplot