Carollia perspicillata primary cultures are susceptible to entry by diverse viruses

We set out to develop bat-derived cell lines specifically for virological research with several criteria for the resulting product: (1) the cells should originate from a species that can be bred in captivity and studied under laboratory conditions, (2) the genome sequence for the species should be available, (3) the cells should grow under standard mammalian cell culture conditions to ensure accessibility, (4) the cells should have an intact innate immune response in order to gain insight into virus-host interactions, and (5) for virological relevance, the cells should support infection with viruses that are native to the bat species.

With the first and second points of our selective criteria in mind, we obtained tissues collected from a single, 3-year-old male C. perspicillata (Cp) bat from a disease-free captive colony housed in the Washington State University campus in Vancouver, Washington (Fig 1A). Brain, lung, kidney, liver, and spleen tissues were frozen until processing, and primary cells were isolated following standard protease digestion and culturing techniques (see Methods) [7,11–14]. We then generated a panel of diverse viral glycoproteins representative of different viral families, entry pathways, and zoonotic origin. Additional focus was given to orthohanatviruses as close relatives of Andes orthohantavirus have been identified in C. perspicillata [9,10,15]. Primary Cp cells were susceptible to entry by many of the tested pseudoviruses, with the hantavirus and VSV glycoproteins mediating the strongest entry (>100-fold over background signal; Fig 1B). Notably, viral entry observed in primary cells was similar in intensity to several standard laboratory cell lines including Huh-7, Vero E6, and HEK-293T cells transduced to express coronavirus receptors, human dipeptidyl peptidase 4 (hDPP4) and human angiotensin converting enzyme 2 (hACE2) (Fig 1C), as well as an immortalized Jamaican fruit bat (A. jamaicensis) cell line we developed previously (S1A Fig) [16]. In contrast, several other bat cell lines that we developed in earlier studies, including immortalized kidney cells from the big brown bat (Eptesicus fuscus) and the Egyptian fruit bat (R. aegyptiacus)[14,17] were less susceptible to viral entry than the Carollia cells (S1B-D Figs).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Carollia perspicillata primary cultures are susceptible to entry of diverse viruses.

(A) Primary cells were isolated from brain, lung, kidney, liver, and spleen of a single C. perspicillata bat and (B) infected with pseudotypes bearing glycoproteins from the indicated viruses. (C) Cell entry phenotypes of common laboratory cell lines to viral entry with pseudotype panel. Shown are results for six infection replicates per virus. Bat silhouette image produced by Roberto Díaz Sibaja (PyloPic). The data underlying this figure can be found in the S1 Data file available from the journal.

https://doi.org/10.1371/journal.pbio.3003098.g001

Immortalization of C. perspicillata cell lines through diverse methods

While primary cells more faithfully mimic tissue-specific gene expression profiles, they are limited in their number of cell divisions and passages and are not a homogenous population. Not surprisingly, most molecular virology studies are performed in immortalized cell lines that divide indefinitely and can therefore be easily shared among laboratories. Several methods have been used by various groups to immortalize primary cells. Viral proteins, such as the large T-antigen from SV40, inhibit tumor suppressor proteins like TP53 and Rab and shut down inhibition of cell division that normally follows in later passage primary cells [18,14]. Similarly, the Myotis polyomavirus T antigen (MyPVT) has been shown to enhance DNA replication in Vero cells and immortalize E. fuscus kidney cells, though the mechanisms of action are unclear [14]. Over-expression of human telomerase reduces the genomic damage from continual cell divisions and has been used to immortalize bat cells previously [7,19]. Direct knockout of the tumor suppressor, TP53, is yet another strategy to develop life-extended cells that has been employed more recently with the development of Cas9-targeted gene modification [20–23]. We tested all four strategies with multiple primary cell cultures using either in-house generated or commercially obtained lentivirus transduction systems (see Methods). Notably, while some methods were effective across all cell types tested, others led to cell cycle arrest following lentiviral transduction, preventing further characterization (Fig 2A). SV40 T-antigen successfully immortalized all four cell lines, whereas MyPV T-antigen was only effective for lung and kidney cells. In addition, immortalization by TP53-guided Cas9 was successful for all cell lines except those from the lung, while hTERT could only be introduced into spleen cells.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Carollia perspicillata cell lines immortalized through diverse methods are susceptible to viral entry.

(A) Select primary cells were further transduced with lentiviral vectors representative of different strategies to immortalize cell lines. Transduced (B) brain, (C) lung, (D) kidney, and (E) spleen cells were screened for entry with pseudotyped particles bearing glycoproteins from the indicated viruses. Shown are the data from infection experiments performed in six replicates. The data underlying this figure can be found in the S1 Data file available from the journal.

https://doi.org/10.1371/journal.pbio.3003098.g002

As we and others have noted, most of the immortalized cells were less susceptible to viral entry than their parental primary cells (Fig 2B–2E) [7]. A few notable exceptions to this trend included Cp brain cells transduced with TP53-guided Cas9 (CaPsm-B gRNA:TP53), which showed high susceptibility (>100-fold over background) to orthohantaviruses (Fig 2B), and kidney cells transduced with TP53-guided Cas9 (CaPsm-K gRNA:TP53), which showed measurable susceptibility (>10-fold over background) to MERS-CoV (Fig 2C). To test whether the cells retained their viral susceptibility over time, we performed entry assays on cells that were maintained for up to 31 passages (S2 Fig). Unfortunately, many of the transduced cells did not continually divide suggesting the approaches taken did not lead to immortalization. Three out of four of the immortalized cells evaluated broadly lost susceptibility to pseudovirus entry, with only the CaPsm-K gRNA:TP53 cell line exhibited an increase in susceptibility to MERS-CoV spike pseudotyped virus (S2 Fig). Unfortunately, even transduced cell lines that propagated well eventually lost susceptibility to pseudotype entry. Transduced kidney cell lines retained susceptibility to pseudotype entry over multiple passages and were therefore selected for further testing and development (S2 Fig).

C. perspicillata cells support infection with replication-competent recombinant VSV (rVSV)

To further assess if these primary cells were suitable for viral entry experiments, we tested a subset of primary cells for their ability to support infection with replication-competent rVSV. VSV bearing its native glycoprotein or glycoproteins from Andes and Hantaan virus efficiently replicated in kidney cells immortalized with SV40-T antigen (CaPsm-K SV40T) (Fig 3A). To assess if Andes virus entry in these cells is mediated by a known hantavirus receptor, Protocadherin-1 (PCDH1), we incubated rVSVs with soluble PCDH1 (soluble extracellular cadherin domains 1 and 2, sEC1–2) to verify if entry into CaPsm-K SV40T cells is mediated by this cellular receptor. Human osteosarcoma U2OS cells were used as a positive control. Similar to U2OS cells, a reduction in Andes virus glycoprotein-mediated infection was observed in the CaPsm-K SV40T cells (Fig 3B and 3C). Notably, Hantaan virus was not inhibited in either cell line, in agreement with previous work showing that this virus does not use PCDH1 as a receptor [24]. However, preincubation of cells with a human PCDH1-specific antibody (mAb-3305) that has been shown to block PCDH1-dependent infection of Andes virus previously [24], did not block Andes virus glycoprotein-mediated infection in CaPsm-K SV40T cells but did so in human pulmonary microvascular endothelial cells (HPMEC) (Fig 3D). To determine if this was due to the rapid recycling of mAb-3305, the PCDH1-specific antibody was preincubated with CaPsm-K SV40T cells on ice (Fig 3E). Preincubation of the CaPsm-K SV40T cells with mAb-3305 did not block infection, suggesting that this antibody may not be cross-reactive or alternatively, Andes virus can use an alternate entry receptor in these bat cells.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Carollia perspicillata cells support infection with replication-competent recombinant VSV (rVSV).

(A) Cp kidney cells immortalized by SV40 T-antigen (CaPsm-K SV40T) were infected with replication-competent VSV (rVSV) pseudotyped with indicated orthohantavirus glycoproteins. Neutralization of rVSV ANDV and HTNV with soluble PCDH1 receptor (sEC1–2) on Cp kidney cells (B), and human U2OS cells for comparison (C). (D) Neutralization of rVSV-ANDV and HTNV on Cp kidney cells by preincubation of cells with an anti-PCDH1 (mAb-3305) antibody. Neutralization of rVSV ANDV by mAb-3305 on human pulmonary microvascular endothelial cells (HPMEC) is shown as a positive control. (E) To rule out the possibility that mAb-3305 fails to block rVSV-ANDV infection in Cp kidney cells due to rapid uptake/clearance of the antibody, the experiment was performed on ice. The data underlying this figure can be found in the S1 Data file available from the journal.

https://doi.org/10.1371/journal.pbio.3003098.g003

Immortalized cells respond to poly(I:C) stimulation

To test the immunocompetency of the Cp kidney cell lines, we first measured the transfectability of both primary and immortalized kidney cell cultures using poly(I:C) (surrogate viral dsRNA) labeled with rhodamine (poly(I:C)-Rho) (Fig 4A). Poly(I:C)-Rho was successfully delivered in all cell lines, with the CaPsm-K gRNA:TP53 cell line demonstrating the highest uptake of the immunostimulant (Fig 4A). As immortalization has been speculated to alter the ability of cell lines to have an intact interferon response [25], we characterized the response of our bat cells to poly(I:C) by measuring interferon beta (IFNβ) and interferon-induced protein with tetratricopeptide repeats 1 (IFIT1) transcript levels using qPCR to assess the detection of dsRNA and the type I IFN signaling pathway (Fig 4B). All four immortalized kidney cell lines upregulated IFNβ and IFIT1 transcripts to similar levels, demonstrating the recognition of dsRNA and induction of antiviral genes. To assess whether the IFNβ response was effective in blocking virus infection, we stimulated cells with poly(I:C) prior to infection with VSV that was engineered to express the green fluorescent protein (VSV-GFP) (Figs 4C and 4D). While VSV-GFP replicated efficiently in both primary and immortalized kidney cells, CaPsm-K gRNA:TP53 cells were the least permissive. However, pretreatment with poly(I:C) completely inhibited virus replication. Immunoblotting for IFIT1, an interferon-stimulated gene (ISG), confirmed that poly(I:C) induced the expression of IFIT1 in infected and uninfected cells (Fig 4E).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Immortalized Carollia kidney cells respond to surrogate virus infection.

(A) CaPsm-K primary and immortalized cells were transfected with 10 μg of poly (I:C) chemically labeled with rhodamine (pIC-Rho) for 16 h. Following fixation, cells were stained with antibodies against GAPDH and DAPI and visualized by confocal microscopy. Scale bars represent 25 μm. (B) CaPsm-K cells were transfected with 100 ng of poly (I:C) for 8 h. The upregulation of IFN-β and IFIT1 transcripts was assessed by qPCR. Data are represented as a mean ± SD, n = 4 replicates. (C) CaPsm-K cells transfected with 100 ng of poly (I:C) for 8 h were infected with VSV-GFP (MOI 1) for 16 h (n = 4). Viral replication was visualized by fluorescent microscopy. Scale bars represent 100 μm. (D) Green fluorescent protein (GFP) signal was quantified using ImageJ (Two-way ANOVA with Šídák’s multiple comparisons test). (E) Representative western blot of VSV-GFP infected cells, where IFIT1, VSV-M, and ACTB were probed for. L = molecular weight ladder. (F) CaPsm-K cells transfected with 100 ng of poly(I:C) for 8 h were infected with MERS-CoV (MOI 0.1) for 48 h (n = 3). Supernatant was collected and TCID50 assay was performed to assess viral titer. (G) Representative western blot of MERS-CoV infected cells, where IFIT1, MERS-CoV nucleocapsid (N), and GAPDH were probed for. L = molecular weight ladder. The data underlying this figure can be found in the S1 Data file available from the journal.

https://doi.org/10.1371/journal.pbio.3003098.g004

Our entry results using pseudotyped virus suggested that the Cp kidney cell lines expressed the necessary factors for MERS-CoV entry (Fig 2C). Therefore, we repeated our poly(I:C) experiment but replaced VSV with authentic MERS-CoV (Fig 4F). Like VSV-GFP, all cell lines were permissive to infection with MERS-CoV, with the virus replicating to lower titers in CaPsm-K gRNA:TP53 cells. Stimulation with poly(I:C) prior to infection reduced MERS-CoV replication, with the most substantial reduction observed in kidney cells immortalized using MyPVT. IFIT1 analysis through immunoblotting demonstrated similar expression of IFIT1 in cells pre-stimulated with poly(I:C), with IFIT1 not induced in cells only infected with MERS-CoV (Fig 4G). Taken together, these results demonstrate that C. perscipillata kidney cells are immunocompetent, warranting further study of their responses to infection.

Immortalized clonal cell lines retain susceptibility to viral entry

Our entry results suggest that the C. perspicillata kidney cell lines transduced with TP53-guided Cas9 are susceptible to entry via the widest range of viral glycoproteins of all the cell lines developed (Figs 2C and S2). Importantly, despite immortalization, these cells also retained their interferon response (Fig 4). We observed that later passage Cp TP53-guided cells were more susceptible to MERS-CoV than earlier passages (S2 Fig), and that this entry phenotype was more variable throughout the course of this study. Therefore, we wondered whether the Cp cells represented a mixed population of susceptible and non-susceptible cells. To help address this question, we isolated individual cells through limiting dilution plating (Fig 5A; see Methods). Twenty clones were selected from the limiting dilutions for their ability to form dense monolayers. From these 20 clones, only five retained the ability to divide from one cell through plating for infection. Testing the viral pseudotype panel on these cells revealed minor variation in viral susceptibility between clones and an overall improvement in entry from the heterogenous parental population (Fig 5B). Of the five clones that were tested, only a subset continuously grew in culture, with clone-9 (CKg9) exhibiting the best growth and highest susceptibility to viral entry through continuous passage (Fig 5C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Immortalized clonal cell lines retain susceptibility to viral entry.

(A) Select transduced cells were further plated for clonal isolation and 20 clones were propagated from single cells plated in 96-well format. (B) Clones that continuously grew were further screened for suppressibility to viral entry with pseudotypes bearing glycoproteins of the indicated viruses. (C) Clones that grew past 10 passages were re-screened for susceptibility to viral entry. Shown are the results from infection experiments performed in six replicates. The data underlying this figure can be found in the S1 Data file available from the journal.

https://doi.org/10.1371/journal.pbio.3003098.g005

Immortalized Carollia cells support whole virus replication

To further assess the suitability of these cells for virological experiments, we infected primary and immortalized Cp kidney cells with authentic VSV-GFP (MOI 1), MERS-CoV (MOI 0.1), and SARS-CoV-2 (MOI 0.01) for 1–72 h (Fig 6A). Upon infection with VSV-GFP, all cell lines supported virus replication, with viral titers peaking at 24 h in the primary cells. However, VSV-GFP titers did not peak until 48 h in CaPsm-K SV40T and MyPVT cells, and until 72 h in gRNA:TP53 cells. Similarly, CaPsm-K gRNA:TP53 cells were the least permissive to MERS-CoV, with titers remaining below 10² TCID₅₀/ml by 72 h of infection (Fig 6A). Meanwhile, similar replication kinetics were observed for infected primary and SV40T-immortalized cells, with MERS-CoV titers peaking around 10³ TCID₅₀/ml by 72 h of infection. For cells immortalized using MyPVT, infection peaked and plateaued at 48 h. Consistent with our previous data which demonstrated that the Cp kidney cells do not permit entry of pseudoviruses displaying the SARS-CoV-2 spike protein (Fig 2C), infection with authentic SARS-CoV-2 was not supported in the primary or immortalized kidney cell lines (Fig 6A).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. Immortalized Carollia cells support whole virus replication.

(A) Primary and immortalized kidney (CaPsm-K) cells were infected with VSV-GFP (MOI 1), MERS-CoV (MOI 0.1), or SARS-CoV-2 (MOI 0.01) for up to 72 h. Replication was monitored using TCID₅₀ limiting dilution assays. (B) Clonal transduced kidney cells (CKg9) cells and CaPsmK-SV40T cells infected with Andes virus were monitored by qPCR. (C) CKg9 cells infected with Seoul virus (SEOV) were monitored by end-point microscopy for Seoul nucleocapsid protein. The data underlying this figure can be found in the S1 Data file available from the journal.

https://doi.org/10.1371/journal.pbio.3003098.g006

As orthohantaviruses related to Andes virus have been reported in C. perspicillata [9,10,15], we subsequently tested the infectivity of Andes virus in the clonal transduced Ckg9 cell line and observed day-over-day increases in the viral genome suggestive of viral replication (Fig 6B). Infection of these cells with Seoul virus, another rodent-borne orthohantavirus, allowed for detection of Seoul nucleocapsid protein in the cell lines (Fig 6C), suggesting that the Ckg9 cell line supports Seoul virus replication.

Biosafety and ethics statement

Bat tissues were sourced from a US-based facility at Washington State University (Vancouver, WA, USA). Collection of animal tissues used in this study was approved by Washington State University IACUC (ASAF #6588). Experiments with live, replication-competent coronaviruses were performed at the University of Saskatchewan/VIDO’s BSL3 facility following approved protocols and standard procedures. Experiments with live hantaviruses were performed under BSL3 conditions at the University of New Mexico. Experiments with replication defective VSV pseudotypes and replication competent rVSVs were performed at BSL2+ conditions at Washington State University and LSU Health Sciences Center-Shreveport, respectively.

Figures and depictions

All labware representations in figures were produced by the authors using PowerPoint. The Phylostomid bat silhouette image in Fig 1A was generated by Roberto Díaz Sibaja and downloaded from PyloPic (https://www.phylopic.org).

Isolation of primary cells

Tissues were harvested from a male C. perspicillata bat at approximately 20 months of age, 17.1 g, from a disease-free colony. Tissue samples were washed and finely minced in sterile phosphate-buffered saline (PBS), transferred to fetal bovine serum (FBS) supplemented with 10% dimethyl sulfoxide, and frozen in liquid nitrogen. Primary cells were isolated as we have previously reported for other bat species [13,14]. Briefly, samples were thawed at 37 °C and transferred to sterile 10 cm plates. FBS/DMSO solution was removed with a pipette and tissues were washed with PBS. Tissues were incubated in trypsin for 10 min, with gentle agitation through a 1000 µL pipette to help loosen cells from the tissue matrix. Trypsin was neutralized with primary cell culture medium consisting of high glucose Dulbecco’s modified Eagle’s medium (DMEM; Corning), 12% FBS, penicillin/streptomycin, amphotericin B, l-glutamine, and minimum essential medium non-essential amino acids. The slurry of cells, tissue debris, and media were transferred to 75 cm² flasks, labeled “passage 0” and maintained at 37 °C with 5% CO₂. Flasks were monitored daily for cell growth and media was refreshed every 2 days. Flasks that achieved 70%–90% confluency with primary cell cultures were expanded into larger 150 cm² flasks for banking stocks of early passage cells and future experiments. Primary cells were used up to passage 10 for viral infection assays in Fig 4.

Immortalization of primary cells

Immortalization of bat cells with the large T-antigen from SV-40 virus and the human telomerase gene (hTERT) have been previously described [7,13]. Briefly, lentiviruses encoding each of these proteins and puromycin N-acetyletransferase were obtained commercially and used following manufacturers’ instructions (GenTarget). Lentiviruses were generated using the second-generation system, where 500 ng of psPAX and pMDG2 and 1 µg of either construct were transfected into HEK293T cells. Following 48-h post-transfection, medium was collected, centrifuged, and stored at −80 °C. Cp cells were transduced with lentiviruses encoding either SV40 T-antigen or hTERT and then maintained in a primary cell culture media (see above) with puromycin at between 0.5 and 1.5 µg/mL depending on the cell source for two passages. After bulk, untransduced cell die-off, the media was changed to a standard maintenance media consisting of high-glucose DMEM supplemented with 10% FBS, l-glutamine, and penicillin streptomycin. MyPVT is an ortholog of the SV40 T-antigen, but from a bat polyomavirus and has been previously described [14]. MyPV T-antigen was amplified from the M. polyomavirus whole genome (NCBI Accession number NC 0113101.1) and cloned into a lentiviral plasmid. Cells transduced with MyPVT lentivirus were maintained in standard 10% FBS DMEM. TP53 KO was inspired by previous studies that used human, mouse, and canine cells [21–23]. At the time of designing this study, the sequenced genome for C. perspicillata was still in development. Therefore, we used the R. aegyptiacus (GenBank: (NW_023416309.1:73376916-73388351) and A. jamaicensis (GenBank: (NW_026521968.1:7682714-7693614) genomes to design a series of Cas9-guide RNAs directed toward the exon-intron junctions of exons 1 and 5 of the bat TP53 tumor suppressor gene. Four resulting gRNAs were designed:

RA TP53 – EXON 1 – FORWARD: 5′-CTTGTGGAAACTGTGAGTAG-3′

RA TP53 – EXON 5 – REVERSE: 5′-TCCACCCGGATAAGATGCTG-3′

AJ TP53 – EXON 1 – REVERSE: 5′-TGACTCATTGGTGGCTCCAC-3′

AJ TP53 – EXON 5 – FORWARD: 5′-GGTGCCCTACGAAACACCTG-3′

Guide RNAs were cloned into a lentiviral Cas9/CRISPR vector (addgene #52961) [48] and used to produce VSV-g pseudotyped lentiviral particles in 293T cells. Cas9:bat TP53 lentiviruses were collected 48 h later, filtered through 0.45 μM mixed cellulose ester filters, and stored at −80°C until use. Cells were transduced with a combination of all four lentiviruses and maintained in standard media consisting of high-glucose DMEM supplemented with 10% FBS, l-glutamine, and penicillin/streptomycin. All transduced cells were expanded in large culture flasks for stock banking shortly after transduction and, when applicable, puromycin selection.

Clonal cell lines

Early passage stocks of C. perspicillata kidney cells transduced with Cas9:bat TP53 lentivirus were thawed and maintained for one passage before seeding at low density of 0.8 cells/well in 96 well plates. Wells were monitored over two weeks for single-cell isolation and growth. Twenty wells that reached 100% confluency the fastest were selected for expansion into 6-wells. Five of the 20 clones maintained continual growth to be expanded into larger culture flasks. Clonal cells were maintained in standard media consisting of high-glucose DMEM supplemented with 10% FBS, l-glutamine, and penicillin/streptomycin. DMEM with high glucose (DMEM; Gibco, #12491015) supplemented with 10% FBS (Sigma-Aldrich, #12107C) and 1× antibiotic antimycotic (Gibco, #15240062).

Plasmids

Glycoproteins from MERS-CoV/EMC12, SARS-CoV-2/Wuh1, HCoV-229E, and Lassavirus/Josiah were codon optimized and cloned into pcDNA3.1 as previously described [13,49,50]. Marburg/Musoke glycoprotein in pCAGGS vector was generously provided by Andrea Marzi (NIH/NIAID). Orthohantavirus M-segments from plasmids generously provided by Jay Hooper (USAMRIID) were subcloned into pcDNA3.1 using standard PCR approaches. Plasmids used for the expression of His-tagged version of sEC1–2 of human PCDH1 and mAb-3305, a human IgG targeting EC1 domain of human PCDH1, were described previously [9,10,15].

Pseudotype entry assay

Pseudotype entry assays were performed as described previously [13,49,50]. Briefly, 293Ts were seeded in poly-lysine treated 6-well plates and transfected with plasmids encoding viral glycoproteins. Twenty-four hours later, cells were infected with single cycle vesicular stomatitis luciferase-GFP dual reporter virus pseudotyped with VSV-G (VSVΔG-luc/GFP) for 1 h and washed three times with PBS to remove residual input virus. Culture supernatants containing viral psuedotpyes were collected 48 h later, briefly centrifuged to remove debris, aliquoted, and stored at −80 °C. For entry assays, cells were seeded in 96-well plates and infected with equal volumes of viral pseudotypes diluted in DMEM supplemented with 2% FBS, l-glutamine, and penicillin/streptomycin. Innoculated cells were centrifuged at 1,200g, 4 °C for 1 h and then transferred to 37 °C incubators with 5% CO₂. Luciferase was measured as a readout for cell entry (BrightGlo; Promega), and data were normalized by comparing raw luciferase signal from pseudotyped viruses against luciferase signal from non-pseudotyped negative control particles [13,17,51,52].

rVSV infection assays

Titers of the stocks of rVSVs expressing Andes virus (ANDV) Gn/Gc, Hantaan virus (HTNV) Gn/Gc, or VSV G glycoproteins as their sole entry proteins were determined on Vero cells to determine multiplicity of infection (MOI) for infection experiments on Cp cells. Vero cells plated in 96-well plates (8,000 cells per well) were infected with serial log dilutions of rVSVs. At 8-h post-infection, the cells were fixed using 2% formaldehyde for 15 min at room temperature and nuclei were counter-stained with Hoechst 33342. Infected (eGFP-positive) cells were imaged on a Cytation-5 (Agilent) and automatically enumerated using the onboard Gen5.0 software to calculate titers of the stocks. For comparison of infectivity of these rVSVs on Cp cells, immortalized kidney cells plated in 96-well plates (8,000 cells per well) were infected with 2-fold serial dilutions of viruses (an MOI range of 1.5–374 for rVSV Andes virus and 0.8–207 for rVSV Hantaan virus and VSV G). At 16-h post-infection, cells were fixed and scored for infection as described above. The results were expressed as percent infection.

For neutralization of rVSV infection with sEC1–2, rVSV-ANDV Gn/Gc and HTNV Gn/Gc viruses were titered to determine the amount of virus required to obtain 20%–30% infection as 16-h post-infection in immortalized Cp kidney cells and human osterosarcoma U2OS cells. These pre-titrated amounts were incubated with 3-fold serial dilutions of sEC1–2 starting at 3 μM for 1 h at 37° C. These rVSV:sEC1–2 mixtures were then applied to monolayers of immortalized Cp kidney cells in 96-well plate and infection was scored at 16-h post-infection as described above. The results were expressed as relative percent infection as compared to that in well without sEC1–2 protein (infection in no sEC1–2 well was set at 100%).

The rVSV neutralization experiments of rVSV infection with an anti-PCDH1 antibody, mAb-3305 were performed similarly except that the cells were incubated with mAb-3305 or a human IgG control (Ctrl) at 11 to 680 nM concentration in 4-fold serial dilutions for 1 h at 37 °C or on ice before infection with pre-titrated amounts of rVSV-ANDV Gn/Gc or HTNV Gn/Gc. For on ice experiments, cell monolayers were prechilled on ice for 10 min before the addition of antibodies. At 16-h post-infection, the percent relative infection was estimated as described above as compared to that in the well without antibody (infection in no antibody wells was set at 100%). Primary human pulmonary microvascular cells (HPMECs) were used as positive controls for these studies.

Viruses

Genetically engineered VSV encoding a green fluorescent protein (VSV-GFP) cassette was propagated in Vero76 cells in DMEM and stored at −80 °C. MERS-CoV (isolate EMC/2012) and ancestral SARS-CoV-2 (isolate SB3) were propagated in Vero76 cells [53]. All work with infectious MERS-CoV and SARS-CoV-2 was completed at VIDO in a containment level 3 laboratory and was approved by the institutional biosafety committee. Standard operating procedures approved by the institutional biosafety committee were followed for sample inactivation.

Seoul virus strain SR11 and Andes virus strain CHI-9717869 were propagated on Vero E6 cells (ATCC, CRL-1586) for 12 days. Infectious virus was isolated by harvesting supernatant and centrifuging at 1000rcf for 10 min to remove cellular debris. The rVSVs expressing Andes virus and Hantaan virus glycoproteins have been described previously [54].

Transfection

Cells were seeded at a density of 1.5 × 10⁵ cells/well for 24 h followed by transfection with 10 µg of poly(I:C) chemically labeled with rhodamine (Invivogen, #tlrl-picr) for 16 h, or with 100 ng of poly(I:C) (Invivogen, #tlrl-pic) for 8 h. Cells transfected with poly(I:C) chemically labeled with rhodamine were fixed in methanol and stained for GAPDH (EMD Millipore, #MAB374) and DAPI (Thermo Scientific, #62248) and visualized using confocal microscopy.

Whole-virus infection

Carollia kidney cells were seeded at a seeding density of 1.5 × 10⁵ cells/well. Following 24 h, cells were transfected with 100 ng of poly(I:C) (Invivogen, #tlrl-pic) for 8 h prior to infection with VSV-GFP (MOI 1) or MERS-CoV (MOI 0.1) for 16 h and 48 h, respectively. Protein lysate was harvested and assessed by immunoblotting, while supernatant for MERS-CoV infected cells was harvested to assess viral titer by tissue culture infectious dose assay (TCID₅₀). Kidney cells were similarly seeded for VSV-GFP (MOI 1), MERS-CoV (MOI 0.1), and SARS-CoV-2 (MOI 0.01) growth curves. Supernatant was harvested following 1, 24, 48, and 72 h of infection and titerd on Vero76 cells using a TCID₅₀ assay. For Seoul and Andes virus infections, cells were seeded in cell culture vessels 18−24 h prior to infection at a target density of 70%. Virus stock was diluted to the target, cell-specific MOI using serum-free DMEM (VWR 4000-304) supplemented with 1× pen/strep, 1% nonessential amino acids, 2.5% HEPES, and cells were infected for 1 h at 37 °C. Cells were washed twice with sterile PBS solution (FisherScientific, SH30264FS), and appropriate culture medium was added for the duration of the experiment.

Tissue culture infectious dose 50 assay

Supernatants from VSV-GFP, MERS-CoV, and SARS-CoV-2 infected cells were titrated in triplicate on Vero76 cells using TCID₅₀ assay. Briefly, 3 × 10⁴ cells were seeded per well of a 96-well plate. Following 24 h of seeding, media was removed from the cells and 50 µL of serially diluted virus-containing supernatant was added to each well for 1 h at 37 °C. Following inoculation, the supernatant was removed and replaced with DMEM containing 2% FBS. The plates were incubated for 1 (VSV-GFP) to 5 days (MERS-CoV, SARS-CoV-2), and cytopathic effect was observed under a light microscope. Tissue culture infectious dose ₅₀/mL was calculated using the Spearman and Karber algorithm.

Immunofluorescence assays

SEOV-infected cells were incubated at 37 °C for 24–96 h. At each time point, cell monolayers were washed twice with sterile PBS solution and fixed with ice-cold 95% ethanol:5% acetic acid solution for 10 min on ice as previously described [55]. Cells were then washed twice with PBS and blocked with 3% fetal calf serum in PBS for 1 h. Cells were probed overnight at 4 °C for SEOV N protein (custom, Genscript) at dilution 1:400 in 1×PBS and with secondary antibody AlexaFluor 555 goat α mouse (Thermo Fisher Scientific, A-551,31,570) at dilution 1:400 for 2 h at room temperature. Nuclear stain DAPI was used at 1:1,000 for 10 min at room temperature (SeraCare, 5930-0006). Representative images were acquired on the EVOS FL Auto imaging system (Thermo Fisher Scientific, AMF7000).

Immunoblots

Protein lysates were collected in 1× sample buffer and boiled for 10 min at 96 °C. Proteins were separated by SDS-PAGE using homemade 10% polyacrylamide gels and semi-dry transferred to a 0.2 µm nitrocellulose membrane using the Trans-Blot Turbo Transfer System (BioRad, #1704270). Membranes were blocked using intercept blocking solution (Licor Biosciences, #927-60001) and probed with primary antibodies diluted in 50% intercept blocking solution and 50% TBS overnight on a rocker. Primary antibodies include VSV-M (Kerafast, #EB0011), MERS-CoV N (Sino Biological, #40068-RP01-200), IFIT1 (Thermo Scientific, #PA531254), GAPDH (EMD Millipore, #MAB374), and/or ACTB (Abcam, #ab8227). The appropriate secondary antibody (Licor Biosciences, #926-6870 or #926-32213) diluted in 50% intercept blocking solution and 50% TBS was then added for 60 min. Membranes were imaged and analyzed using the Odyssey imager (Licor Biosciences) and Image Studio Software (Licor Biosciences).

RNA and qRT-PCR assays

Cells were lysed for RNA analysis using TRIzol Reagent (ThermoFisher Scientific, 15596026). RNA used for ANDV viral RNA quantification was purified using Zymo Research Direct-zol RNA Miniprep Plus kit (VWR 76211-340) according to manufacturer’s instructions. RNA concentrations were quantified using a NanoDrop UV-Vis Spectrophotometer (ND-1000). cDNA was synthesized using Applied Biosystems High-Capacity cDNA Reverse Transcription Kit (FisherScientific, 43-688-14) by adding 400ng total RNA to the reaction mixture containing random hexamers following manufacturer guidelines. Quantitative real-time PCR was performed using the Taqman Fast Advanced Master Mix (Thermo Fisher, 4444556) and the following primer sets as described by Warner et al.: ANDV S129f – AAGGCAGTGGAGGTGGAC, ANDV S291r – CCCTGTTGGATCAACTGGTT, ANDV TM – 56-FAM/ACGGGCAGC/ZEN/TGTGTCTACATTGGA/3IABkFQ (PMID: 33627395). Standard curve was generated with plasmid DNA containing the coding region of the ANDV nucleoprotein.

RNA was extracted from cells which received 100 ng of nonlabeled poly(I:C) following the manufacturer’s instructions for the RNeasy Plus Mini Kit (Qiagen, #74136). Four hundred nanograms of purified RNA was reverse transcribed into cDNA following the manufacturer’s instructions for the iScript gDNA Clear cDNA Synthesis Kit (Bio-Rad, #1725035). qRT-PCR was performed using the SsoAdvanced Universal SYBR Green Supermix (BioRad, #1725274) to assess IFNβ, IFIT1, and GAPDH transcript levels. The following primer sets were designed for this analysis: CpIFNb_F – GCAGCCCTGGAGGAAATC, CpIFNb_R – CCAGGCACATCTGCTGTAC, CpIFIT1_F – CTGTGATGCTTTGCCGAACC, CpIFT1_R – GGTTGGGCCTTGCTGAAATG, CpGAPDH_F – GGAGCGAGATCCCACCAACAT, and CpGAPDH_R – TGGAGTTGTCATACTTGTCCTGA.

Data and Reagent availability

The following top-performing cell lines from this study are available through BEI Resources and distributed by ATCC: Bulk, non-clonal C. perspicillata kidney cells immortalized with SV-40 T-antigen (NR-59778) and clonal CKg9 cells (NR-59779). All other cell lines are available upon request. Please refer to S3 Fig for a bright field image that depicts the morphology of the kidney cells. Raw numerical values for all graphed data can are available for download as supplementary information.