ࡱ > %` ~N bjbj"x"x .d @ @ 0 ~ ~ ~ ~ - - - - V V V V , V d - ee >W : xW xW xW xW oY oY oY d d d d d d d $ [f h h v d Q - RZ kY oY RZ RZ d ~ ~ xW xW e R^ R^ R^ RZ X ~ D xW - xW ` R^ RZ d R^ R^ ! D - R^ xW 2W Jg V ] @ R^ ` 5e 0 ee R^ 9i ] L 9i R^ R^ x 9i - ^ 8 oY " Y R^ Y Y oY oY oY d d 6^ oY oY oY ee RZ RZ RZ RZ - - - ' T - - - T - - - ~ ~ ~ ~ ~ ~ Text S1
Plasmids pMXs-gw plasmids; pMXs-Oct4, pMXs-Klf4, pMXs-cMycT58 and pMXs-Sox2 were obtained from Addgene repository. pMXs-GFP plasmid was a gift from Professor Toshio Kitamura.
RT-PCR for Marker Genes Total RNA was extracted using RNeasy kit (Qiagen), and cDNA generated using superscript III ( I n v i t r o g e n ) . P C R w a s p e r f o r m e d u s i n g T a q P o l y m e r s a s e ( Q i a g e n ) o r P h u s i o n "! H i g h - F i d e l i t y D N A P o l y m e r a s e ( N e w E n g l a n d B i o L a b s ) . P r i m e r s e q u e n c e s a n d c y c l i n g c o n d i t i o n s a r e d e s c r i b e d i n p r i m e r t a b l e ( s e e b e l o w ) .
A n t i b o d i e s T h e f o l l o w i n g a n t i b o d i e s a n d d i l utions were used: Oct4 (1:100) from Santa Cruz Biotechnology (C-10, cat no: sc-5279), trimethyl H3-K27 (1:500) was a gift from Thomas Jenuwein, Nanog (1:200) from abcam (cat no: ab21603-100) and RC2 (1:50) mouse IgM from DSHB. Immunofluorescence stainings were performed as previously described ADDIN EN.CITE Silva2003272717Silva, J.Mak, W.Zvetkova, I.Appanah, R.Nesterova, T. B.Webster, Z.Peters, A. H.Jenuwein, T.Otte, A. P.Brockdorff, N.X Inactivation Group, MRC Clinical Sciences Centre, ICSM, Hammersmith Hospital, Du Cane Road, London W12 0NN, United Kingdom.Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexesDev CellDev Cell481-9544Amino Acid Sequence/geneticsAnimalsCell Differentiation/geneticsCells, CulturedChromatin/genetics/metabolismDNA Methylation*Dosage Compensation, GeneticEmbryo/*embryologyFemaleFetusGene Expression Regulation, Developmental/genetics*Histone-Lysine N-MethyltransferaseHistones/genetics/metabolismLysine/genetics/metabolismMaleMethyltransferases/genetics/*metabolismMiceMice, Inbred C57BLRNA, Untranslated/genetics/metabolismRepressor Proteins/genetics/*metabolismTotipotent Stem Cells/cytology/*metabolismX Chromosome/*genetics2003Apr12689588http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=12689588 Silva20064417Silva, J.Chambers, I.Pollard, S.Smith, A.Centre Development in Stem Cell Biology, Institute for Stem Cell Research, University of Edinburgh, Edinburgh, EH9 3JQ, UK.Nanog promotes transfer of pluripotency after cell fusionNatureNature997-10014417096AnimalsCell Differentiation/genetics/physiology*Cell FusionCell SurvivalCells, CulturedDNA-Binding Proteins/genetics/*physiologyEmbryo/cytologyFlow CytometryHomeodomain Proteins/genetics/*physiologyHybrid CellsMiceNeurons/*cytologyOctamer Transcription Factor-3/biosynthesisPluripotent Stem Cells/*cytology/physiologyTransgenes2006Jun 2216791199http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=16791199 Conti2005141417Conti, L.Pollard, S. M.Gorba, T.Reitano, E.Toselli, M.Biella, G.Sun, Y.Sanzone, S.Ying, Q. L.Cattaneo, E.Smith, A.Institute for Stem Cell Research, University of Edinburgh, Edinburgh, United Kingdom.Niche-independent symmetrical self-renewal of a mammalian tissue stem cellPLoS BiolPLoS Biole28339AnimalsBase SequenceCell Differentiation/drug effects/*physiologyCell Division/drug effects/*physiologyCells, CulturedEmbryo/cytologyEpidermal Growth Factor/pharmacologyFibroblast Growth Factor 2/pharmacologyHumansMiceMolecular Sequence DataNeurons/cytology/drug effects/physiologyPluripotent Stem Cells/*cytology/drug effects/*physiologyRatsRats, Sprague-DawleyStem Cell Transplantation2005Sep16086633http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=16086633 [1,2,3].
RNA FISH was carried out as previously described ADDIN EN.CITE Heard2001818117Heard, E.Rougeulle, C.Arnaud, D.Avner, P.Allis, C. D.Spector, D. L.Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 11724, USA. edith.heard@curie.frMethylation of histone H3 at Lys-9 is an early mark on the X chromosome during X inactivationCellCell727-381076A Kinase Anchor ProteinsAcetylationAdaptor Proteins, Signal TransducingAnimalsCell Cycle Proteins/genetics/metabolismCell Differentiation/*physiologyCells, CulturedChromatin/*metabolism*Chromosomal Proteins, Non-HistoneCyclin-Dependent Kinase Inhibitor p27DNA-Binding Proteins/genetics/metabolism*Dosage Compensation, GeneticEnzyme Inhibitors/metabolismFemaleFibroblasts/physiologyGene SilencingHistones/*metabolismIn Situ Hybridization, FluorescenceMaleMethyl-CpG-Binding Protein 2MethylationMiceModels, BiologicalOncogene Proteins/genetics/metabolism*Proto-Oncogene ProteinsRNA/metabolismRNA, Untranslated/genetics/metabolism*Repressor ProteinsStem Cells/physiologyTranscription Factors/genetics/metabolismTumor Suppressor Proteins/genetics/metabolismX Chromosome/*metabolism2001Dec 1411747809http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=11747809 [4]. The Tsix probe (pTsix5) containing Tsix promoter and 5 region was a gift from Neil Brockdorff.
Analysis of genomic integration Genomic PCR for retroviral transgenes was carried out using the retro primers listed in the Table below. Southern hybridization was performed using the GE Healthcare AlkPhos Direct Labeling and Detection System with CDP-Star according to the manufacturers specifications. Genomic DNA was digested with EcoRI and transfer blots hybridized individually with full length Sox2, Klf4 or cMyc cDNA probes.
Northern hybridization was performed using the GE Healthcare AlkPhos Direct Labeling and Detection System with CDP-Star according to the manufacturers specifications. Total RNA was hybridized using full length Oct4, including UTR sequence.
Imaging and flow cytometry Slides were analyzed on a confocal microscope (Leica TCS SP5) and processed with Leica software and Adobe Photoshop. Images of live cells were captured with a Leica CTR microscope and processed with Leica software and Adobe Photoshop. Flow cytometry analyses were performed using a Dako Cytomation CyAn ADP high-performance cytometer with FlowJo and Summit software. Cell sorting was performed using a MoFlo high-speed cell sorter.
Quantitative RT-PCR analysis: Relative expression levels of Fgf4, Nanog, Nr0b1 and Rex1 were determined using the TaqMan Fast Universal PCR Master Mix (Applied Biosystems) and the FAM-labeled TaqMan probes, Mm00438917_m1, Mm02384862_g1, Mm00431729_m1 and Mm03053975_g1 respectively. Average threshold cycles were determined from triplicate reactions on a 7900 HT Fast Real-Time PCR System (Appl i e d B i o s y s t e m s ) , a n d t h e l e v e l s o f g e n e e x p r e s s i o n w e r e n o r m a l i z e d t o - a c t i n ( V I C - l a b e l e d T a q M a n p r o b e , 4 3 5 2 3 4 1 E ) . R e l a t i v e e x p r e s s i o n l e v e l s o f B l b p a n d O l i g 2 w e r e d e t e r m i n e d u s i n g g e n e - s p e c i f i c p r i m e r s a n d F A M - l a b e l e d p r o b e s ( n o . 5 8 a n d 2 1 r e s p e c t i v e l y ) from the Universal Probe Library (UPL) Set (Roche). The primers for Blbp were: 5- aaccagcatagatgacagaaactg -3 (forward) and 5- acttctgcacatgaatgagctt -3 (reverse), and the primers for Olig2 were: 5- agaccgagccaacaccag-3 (forward) and 5- aagctctcgaatgatccttcttt-3 (reverse). Average threshold cycles for Blbp and Olig2 were determined from triplicate reactions, and the levels of gene expression were normalized to GAPDH (VIC-labeled TaqMan probe, 4352339E).
Primer table
Text S1 references
ADDIN EN.REFLIST 1. Silva J, Mak W, Zvetkova I, Appanah R, Nesterova TB, et al. (2003) Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes. Dev Cell 4: 481-495.
2. Silva J, Chambers I, Pollard S, Smith A (2006) Nanog promotes transfer of pluripotency after cell fusion. Nature 441: 997-1001.
O )
b &
˿yhZI h@ h@ CJ OJ QJ ^J aJ hu` CJ OJ QJ ^J aJ h@ hB&