Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

The N-terminal domain of Mycobacterium tuberculosis PPE17 (Rv1168c) protein plays a dominant role in inducing antibody responses in active TB patients

The N-terminal domain of Mycobacterium tuberculosis PPE17 (Rv1168c) protein plays a dominant role in inducing antibody responses in active TB patients

  • Philip Raj Abraham, 
  • Niteen Pathak, 
  • Gourango Pradhan, 
  • Gaddam Sumanlatha, 
  • Sangita Mukhopadhyay
PLOS
x

Abstract

The PPE (proline-proline-glutamic acid) proteins of Mycobacterium tuberculosis are characterized by a conserved N-terminal domain of approximately 180 amino acids and variable C-terminal domain. Since last decade, these proteins have gained much importance in the serodiagnosis of tuberculosis (TB) as they act as a source of antigenic variation. We have demonstrated earlier that one of the PPE proteins PPE17 (Rv1168c) induces strong B-cell and T-cell responses in active TB disease and also displays a higher antibody titer compared to immunodominant antigens such as ESAT-6, Hsp60 and PPD. However, the immunodominant domain of PPE17 (N-terminal or C-terminal) was not examined in detail. In the present study, we observed that antibody responses elicited in TB patients were directed mostly towards the N-terminal domain of PPE17 (N-PPE17). The antibody generated against N-PPE17 in TB patients did not significantly cross-react with N-terminal domains of other PPE proteins used in this study. Our data suggest that the N-terminal domain of PPE17 protein is immunodominant and could be used as a better serodiagnostic marker than the full-length PPE17 protein.

Introduction

Despite the fact that the disease tuberculosis (TB) can be cured, it remains one of the world’s biggest threats accounting for millions of deaths every year. The World Health Organization (WHO) has estimated 10.4 million new cases of active TB and 1.8 million deaths due to TB in 2015 [1]. The current situation has become more complicated due to emergence of multi and extensively drug resistant strains of M. tuberculosis and appearance of co-infection of human immunodeficiency virus (HIV) with TB. TB together with HIV infection ranks as a leading cause of death worldwide. Currently available methods for diagnosis of active TB have several limitations. For example, sputum smear microscopy requires highly trained manpower and diligence but sensitivity of detection is not satisfactory in patients co-infected with HIV [2]. In vitro mycobacterial culture, the gold standard for TB diagnosis, not only requires complex media formulations but also cumbersome, technically demanding and more importantly time consuming [3,4]. Purified protein derivative (PPD) based tuberculin skin test often fails to differentiate BCG (Bacille Calmette-Guérin) vaccinated healthy individuals from active TB patients and it cross-reacts with other mycobacterial species [5]. Over the years, significant efforts have been made to develop rapid TB diagnosis tests. Among these, polymerase chain reaction (PCR) for amplification of M. tuberculosis specific genes has attracted considerable interest, due its ability to identify M. tuberculosis in respiratory and non-respiratory specimens in relatively shorter time. However, the usefulness of this method is limited by the presence of PCR inhibitors in clinical specimens and the type of tissue from which DNA is isolated [6,7]. Recently, U.S. Food and Drug Administration approved interferon gamma (IFN-γ) release assay (IGRA) that can aid in the diagnosis of M. tuberculosis infection. In spite of advantages over the available diagnostic methods, this method still suffers from lack of consistency and reproducibility [8]. Of late, WHO recommended GeneXpert MTB/RIF test that can simultaneously detect TB and rifampicin drug resistance in less than two hours, but its higher operative cost and need of expertise for data analysis make it difficult to be popularized in developing and underdeveloped countries [9].

Measuring the antibody response to M. tuberculosis antigens by serological assays are appears to be more effective as these tests are simple, robust, cost-effective, shorter turn-around time and require minimal manpower training [10,11]. In addition, these tests can be developed as point-of-care tests that can be implemented at primary health centers in resource-limited countries. Serological assays are considered to be useful in detection of cases like sputum smear-negative TB, extrapulmonary TB, childhood TB and latent TB which are difficult to diagnose by conventional methods [38]. Therefore, studies are initiated to identify M. tuberculosis proteins that can provide enough sensitivity and specificity to be used as a first-line screening tool for serodiagnosis of TB. Various studies indicate that PPE proteins induce B-cell responses in active TB patients and can be used for serodiagnosis of TB [1222]. One of the PPE proteins, PPE17 (Rv1168c) is shown to be up-regulated in conditions that mimic the macrophage environment features [2326]. Also, over expression of this protein is observed in macrophages infected with various clinical isolates of M. tuberculosis [27]. Interestingly, PPE17 is reported to be surface exposed and immunogenic [28] and genes that are homologous to PPE17 are found to be absent in the non-tuberculous mycobacterial species. We reported earlier that PPE17 could discriminate patients with active TB from BCG-vaccinated healthy individuals [15,22]. Interestingly, we observed that PPE17 displayed higher sensitivity in detecting extrapulmonary and smear negative pulmonary TB cases than early secreted antigenic target 6 protein (ESAT-6) and purified protein derivative (PPD) as well as other PPE proteins [1418,21,22]. We also demonstrated that PPE17 is a potent T-cell antigen which elicited stronger gamma interferon response as compared to PPD [15]. These features make PPE17 a potential candidate antigen for accurate diagnosis of all the clinically distinct categories of active TB.

However, it is unknown which region of PPE17 is immunogenic and can be used as a marker for serodiagnosis of TB. Further, it is well known that the PPE family proteins of M. tuberculosis shares a conserved N-terminal region of approximately 180 amino acids and variable C-terminal domain [29]. Thus, it is interesting to study if antibodies specific to the N-terminal domain of PPE17 (N-PPE17) show serological cross-reactivity with N-terminal domains of other PPE proteins in TB patients. Therefore, in the present study, we measured the levels of antibodies against the N-terminal domain of PPE17 in sera collected from active TB patients. The findings presented herein can be helpful to further design peptide based test for serodiagnosis of active TB cases.

Materials and methods

Ethics statement

The study was approved by the Institutional Ethical Committee of the Mahavir Hospital and Research Centre (No. ECR/450/inst/AP/2013). Written informed consent was obtained from the study participants before collection of sera samples.

Sera collection

Sera were collected from patients diagnosed for active tuberculosis at the DOTS (directly observed treatment short course) centre of Mahavir Hospital and Research Centre, Hyderabad, India. A total of 180 samples were collected from active TB patients showing symptoms for pulmonary and extrapulmonary TB (Table 1).

These patients were diagnosed based on the guidelines of the Revised National TB Control Programme of India. Parameters used for the diagnosis of pulmonary TB were smear microscopy, chest radiography and observation of clinical symptoms suggestive of TB while the extrapulmonary cases were confirmed by chest radiography, tissue biopsy and clinical symptoms (http://www.tbcindia.org). Sera samples were also collected from BCG-vaccinated healthy individuals (n = 20). In this control group, 14 were male and 6 were female participants between 24 to 45 years of age. No symptoms suggestive of clinically active TB were present in these BCG-vaccinated healthy individuals during collection of serum samples. Both the categories of study participants tested negative for human immunodeficiency virus infection.

Purification of recombinant PPE proteins

The full-length PPE17 protein of M. tuberculosis is 346 amino acids in length and is characterized by the presence of a conserved N-terminal domain of approximately 180 amino acids (S1 Fig). The expression and purification of recombinant full-length PPE17 protein (PPE17) was carried out following the methods as described by us earlier [15,22]. For purification of N-terminal domain of PPE17 (N-PPE17) protein, ORFs corresponding to 1 to 173 amino acids was amplified from BAC library contig Rv71 (C2) [kindly provided by Dr. Shekhar C. Mande, CDFD, Hyderabad] using forward primer 5' ATGGATCCATGGATTTCACAATTTTTCCGCCGG 3' (BamH1) and reverse primer 5' ATAAGCTTCTACGGGTTGGCGATCGGCGC 3' (HindIII). The amplified products were cloned in frame with N-terminal poly-histidine tag in pRSET-A vector (Invitrogen, Carlsbad, CA, USA). After confirming the clones by PCR and sequencing, the clones were transformed in Escherichia coli BL21 (DE3) pLysS cells. The full-length PPE18 (Rv1196) was cloned in frame with N-terminal poly-histidine tag in pRSET-A vector (Invitrogen, Carlsbad, CA, USA) and purified as described by us earlier [30]. Genes encoding full-length PPE44 (Rv2770c) and full-length PPE65 (Rv3621c) genes were cloned in frame with C-terminal poly-histidine tag in pET-23a vector and transformed in E. coli BL21 (DE3) pLysS cells. All these proteins were purified under native condition as described by us earlier [15, 22, 30]. Briefly, primary cultures were grown in Terrific broth (Becton Dickinson, Difco, Sparks, MD) containing ampicillin (100 μg/ml) at 37°C overnight. The secondary cultures were grown until the optical density (OD) of the culture reaches to 0.4 to 0.5 at 600 nm, induced with 1 mM isopropyl-β-D-thiogalactopyranoside (Sigma Aldrich, MO, USA), and further incubated at 37°C for 3 hr. The culture pellets were resuspended in lysis buffer (PBS containing 1 mg/ml lysozyme and 1% sodium lauryl sarcosine), sonicated, and centrifuged. Supernatant was loaded on TALON resin column (Takara Bio Inc. CA, USA) and kept for binding at 4°C for 30 min. The column was washed with PBS containing 20 mM imidazole. Protein fractions were eluted in elution buffer (200 mM imidazole) and the purity of the recombinant proteins were confirmed by Coomassie blue staining (S2 Fig).

The purified proteins were dialyzed in phosphate buffered saline (PBS, pH 7.4) and concentration of the proteins was estimated using bicinchoninic acid kit (Micro BCA protein assay kit from Thermo Scientific, Rockford, IL, USA). The molecular weight of PPE17, N-PPE17, PPE18, PPE44 and PPE65 was about 40 kDa, 27 kDa 45 kDa, 42 kDa and 43 kDa respectively.

Enzyme Immuno Assay (EIA)

The serum IgG levels in various sera samples were quantified following EIA, as described earlier [15,22]. Briefly, each well of the 96-well microtiter plate (Costar, Corning, NY, USA) was coated with 50 μl of PBS containing 1 μg of PPE17 (500 nM) or N-PPE17 (740 nM) recombinant protein and the plates were incubated overnight at 4°C. Next day, after washing with PBS, the wells were blocked with 200 μl of blocking buffer (PBS containing 2% bovine serum albumin) and kept at 37°C for 2 hr. After washing the EIA plates for three times with PBS-Tween buffer (PBS-T), sera samples (50 μl) were added and the plates were incubated for 1 hr at 37°C. Subsequently, 50 μl of anti-human immunoglobulin G (IgG) conjugated to horseradish peroxidase (HRP, Sigma Aldrich, MO, USA) was added at 1/8000 dilution and the plates were incubated for 1 hr at 37°C. After washing the wells, the HRP activity was measured by o-phenylenediamine tetrahydrochloride using H2O2 as substrate. The reaction was terminated with 1N H2SO4 and absorbance values were measured at 492 nm with an EIA reader (BioTek Instruments Inc., VT, USA). For inhibition EIA, the sera were pre-incubated with 1 μg/50 μl of recombinantly purified full-length PPE17 (500 nM) or PPE18 (444 nM) or PPE44 (476 nM) or PPE65 (465 nM) protein at 37°C for 1 hr in 96 well flat bottom micro test plates (Tarsons Products Pvt. Ltd, India) and then added directly to the N-PPE17 pre-coated plates and EIA was carried out.

Statistical analysis

The mean EIA absorbance values (OD at 492 nm (A492)) of the healthy control sera plus three standard deviations was calculated and used as cut-off values. A sample showing antibody levels greater than or equal to the cut-off value was considered as positive. For calculating the statistical significance between two groups, non-parametric Mann-Whitney test was performed. The analysis of variance (ANOVA) was performed for calculating statistical significance between different clinical categories of TB patients (smear positive, smear negative and extrapulmonary TB) as described previously [15, 22]. Statistical analyses were performed using GraphPad prism and P < 0.05 was considered as significant.

Results

Both full-length PPE17 (PPE17) and N-terminal domain of PPE17 (N-PPE17) proteins had higher antibody titers in the sera obtained from active TB patients

When sera obtained from TB patients were incubated with either PPE17 or N-PPE17 protein and compared with that of BCG-vaccinated healthy controls, significantly higher antibody titers were observed in TB patients as compared to healthy controls (P < 0.001; Fig 1A). It is interesting to note that the sera from TB patients had PPE17-specific antibody levels similar to that of N-PPE17 (mean OD492 ± SEM, 0.676 ± 0.028 for PPE17 and 0.601 ± 0.022 for N-PPE17 respectively). We have also compared the antibody responses against PPE17 and N-PPE17 in different clinical categories such as smear positive, smear negative and extrapulmonary TB. Interestingly, PPE17 as well as N-PPE17 exhibited almost similar antibody titers in the sera obtained from different categories of TB patients (Fig 1B). We did not observe any significant differences (P > 0.05) in the antibody responses among these categories of TB cases when full-length PPE17 and N-PPE17 was used in EIA (Fig 1B) indicating that seropositivity did not differ among subtypes of TB patients. To test the sensitivity of PPE17 versus N-PPE17, a cut-off value was determined by calculating mean OD492 of the healthy control sera plus three standard deviations. Accordingly, the cut-off values were found to be 0.327 for PPE17 and 0.309 for N-PPE17. N-PPE17 displayed marginally higher sensitivity (91.66%; 165/180) compared to PPE17 (83.33%; 150/180) for the diagnosis of TB cases (Fig 2A) and 30 (16.66%) and 15 (8.33%) patients displayed OD below the cut-off value for PPE17 and N-PPE17 respectively.

thumbnail
Fig 1. The full-length PPE17 protein (PPE17) as well as the N-terminal fragment of PPE17 (N-PPE17) can discriminate active TB patients (n = 180) from BCG-vaccinated healthy controls (n = 20).

(A) The mean absorbance values (OD492) of TB patients versus healthy controls were compared for PPE17 and N-PPE17 proteins following EIA. (B) The EIA absorbance values shown in Fig 1A were re-plotted to compare the antibody levels of the smear positive pulmonary TB (n = 78), smear negative pulmonary TB (n = 47) and extrapulmonary TB (n = 55) patients between the PPE17 and N-PPE17 proteins. Horizontal line indicates the mean absorbance values.

https://doi.org/10.1371/journal.pone.0179965.g001

thumbnail
Fig 2. The N-terminal fragment of PPE17 (N-PPE17) is more sensitive to detect TB cases than full-length PPE17 protein.

(A) The percentages of high-level responders (patients showing antibody levels greater than or equal to the cut-off values) shown in Fig 1A were calculated using a cut-off value (mean OD492 of healthy control sera plus 3 SD) for PPE17 and N-PPE17. (B) The percentage of high level responders was compared for pulmonary (smear-positive and smear-negative) and extrapulmonary TB cases.

https://doi.org/10.1371/journal.pone.0179965.g002

We have also tested the sensitivities of these antigens for the diagnosis of different clinical categories of TB patients like smear positive TB, smear negative TB and extrapulmonary TB. Interestingly, we observed that the diagnostic sensitivity of N-PPE17 for smear negative and smear positive TB was higher than PPE17 (91%, 93.62% and 90.91% versus 80.77%, 78.72% and 89% for smear positive, smear negative and extrapulmonary TB respectively) (Fig 2B).

Sera from patients with active tuberculosis had antibodies predominantly against the N-terminal fragment of PPE17

Next, we tested whether antibody responses against the full-length PPE17 were induced predominantly against the N-terminal domain of PPE17 protein. To test this, we followed inhibition EIA where sera (50 μl) of TB patients were pre-incubated with 1 μg of N-PPE17 protein before the sera were added to the EIA plate coated with PPE17 protein. Interestingly, we observed that pre-incubation of sera samples with N-PPE17 protein significantly inhibited the antibody responses to PPE17 protein (mean OD492 ± SEM, 0.714 ± 0.032 versus 0.275 ± 0.014; P < 0.001; Fig 3A). When Fig 3A was reanalyzed to examine reactivity of individual sample, it was observed that responses of majority of sera samples to PPE17 full-length protein were inhibited by its N-terminal fragment (Fig 3B). The N-PPE17 inhibited antibody responses to PPE17 at both 1 μg/50 μl and 3 μg/50 μl concentrations (S3 Fig).

thumbnail
Fig 3. The N-terminal fragment of PPE17 (N-PPE17) is predominantly recognized by the sera of TB patients.

(A) The EIA plates coated with full-length PPE17 protein were incubated with TB patients sera (n = 143) that were pre-incubated with 1 μg of N-PPE17 protein diluted in PBS followed by incubation with anti-human IgG-HRP. The absorbance was read at 492 nm using the chromogenic substrate OPD. (B) The EIA absorbance values at 492 nm shown in Fig 3A were re-plotted for individual sera samples of active TB patients.

https://doi.org/10.1371/journal.pone.0179965.g003

To compare the efficacy of PPE17 and N-PPE17 in detecting the TB patient sera, EIA plates were coated with different concentrations (25 ng to 1 μg per well) of either PPE17 or N-PPE17 and then incubated with sera collected from active TB patients and the absorbance values were positively correlated with increased concentrations of PPE17 as well as N-PPE17. Both PPE17 and N-PPE17 proteins displayed higher mean absorbance values at 1 μg/well/50μl concentration. However, N-PPE17 displayed higher mean absorbance values compared to PPE17 at 50 ng/well/50 μl, 100 ng/well/50 μl, 250 ng/well/50 μl and 500 ng/well/50 μl concentrations (Fig 4A). Since, the molecular weight of N-PPE17 is smaller than PPE17, it may be argued that, higher OD observed for N-PPE17 may be due to higher number of molecules present for a given mass of both the proteins. However, we could observe that the mean OD of N-PPE17 at 37 nM (50 ng/well) is higher than the full-length PPE17 at 50 nM (100 ng/well). Similarly, at molar concentrations of 74 nM (100 ng/well) and 185 nM (250 ng/well), N-PPE17 displayed higher OD than the full-length PPE17 protein used at 125 nM (250 ng/ml) and 250 nM (500 ng/ml) respectively. Therefore, N-PPE17 appears to be more efficient to detect antibody levels in the patient sera than the full-length PPE17 protein.

thumbnail
Fig 4. The N-terminal fragment of PPE17 (N-PPE17) shows better seroreactivity than full-length PPE17 in active TB patients (n = 143).

(A) The full-length PPE17 or N-PPE17 protein was coated on EIA plate at various concentrations starting from 25 ng/well/50 μl to 1 μg/well/50 μl and antibody responses of TB patient sera were compared. The negative control (no antigen) displayed a background absorbance value of 0.056. Data shown in Fig 4A were re-plotted to compare the antibody levels of TB patients between PPE17 and N-PPE17 at 50 ng/well/50 μl (B1), 100 ng/well/50 μl (C1) and 250 ng/well/50 μl (D1) antigen coating concentrations. Data from Fig 4A were re-plotted to compare the PPE17 and N-PPE17-specific antibody levels in sera samples of smear positive (n = 58), smear negative (n = 38) and extrapulmonary TB (n = 47) patients at antigen concentration of 50 ng/well/50 μl (B2), 100 ng/well/50 μl (C2) and 250 ng/well/50 μl (D2).

https://doi.org/10.1371/journal.pone.0179965.g004

When we compared N-PPE17 and PPE17-specific antibody levels in each sample using antigen concentrations 50 ng/well/50 μl, 100 ng/well/50 μl and 250 ng/well/50 μl, majority of the samples displayed higher absorbance values against N-PPE17 than PPE17 at all the three concentrations used (Fig 4B1–4D1). We also compared the antibody levels in the sera of smear positive, smear negative and extrapulmonary TB cases against PPE17 and N-PPE17 at these concentrations. It was found that though all the categories of patient sera had significantly higher antibody titers against N-PPE17 than full-length PPE17 (P < 0.001), no significant differences in antibody responses were observed between these subsets of cases at any antigen concentration tested (P > 0.05, Fig 4B2–4D2) indicating that PPE17 as well as N-PPE17 do not discriminate between smear positive, smear negative and extrapulmonary TB cases serologically.

N-PPE17 did not share cross-reactive epitopes with N-terminal domains of other PPE proteins

The N-terminal domain of PE/PPE family of proteins is known to be conserved [29, 3133]. Since the antibody responses of active TB patients were induced predominantly against the N-terminal region of PPE17, it was of interest to examine whether N-PPE17 shared cross-reactivities with N-terminal domains of various other PPE proteins. Therefore, N-PPE17 antigen coated plates were incubated with TB patients sera either left untreated or pre-incubated with either full-length PPE17 (Rv1168c), full-length PPE18 (Rv1196), full-length PPE44 (Rv2770c) or full-length PPE65 (Rv3621c) proteins. These PPE proteins are known to be expressed during active TB infection and induce B-cell and T-cell immune responses [3437]. The N-terminal domains of these PPE proteins share about 50% homology in the amino acid sequence with N-PPE17. Interestingly, pre-incubation of sera with PPE17 resulted in quenching of N-PPE17-specific antibody population up to 75% (P < 0.001) as expected, but the other three PPE proteins failed to significantly quench N-PPE17-specific antibodies (Fig 5; P > 0.05). This observation suggests that in TB patients, the N-terminal domain of PPE17 is immunodominant and N-PPE17-specific antibodies do not cross react with homologous N-terminal domains of other PPE proteins tested.

thumbnail
Fig 5. N-PPE17-specific antibodies in sera obtained from TB patients did not significantly cross-react with N-terminal domains of other PPE proteins.

Sera samples (n = 50) pre-incubated with recombinantly purified full-length PPE17 or PPE18 or PPE44 or PPE65 protein were added to EIA plates coated with recombinantly purified N-PPE17. The plates were further incubated with anti-human IgG-HRP and absorbance was read at 492 nm using the chromogenic substrate OPD.

https://doi.org/10.1371/journal.pone.0179965.g005

Discussion

Since the discovery of M. tuberculosis PE/PPE proteins, several studies have been undertaken to identify suitable antigens that could be used to discriminate BCG-vaccinated healthy individuals from active TB patients [12,15,18,21,22]. We demonstrated earlier that the PPE17 protein could be used as a potent B-cell as well as T-cell marker to detect active TB disease [15]. In continuation of our efforts towards serological characterization of PPE17 in detail, we next studied the specific domain(s) of PPE17 that were responsible for induction of higher antibody responses in active TB patients. For this, the recombinant full-length PPE17 protein (PPE17) and N-terminal region of PPE17 (N-PPE17) proteins were used to screen the TB patient sera by EIA. Interestingly, we noted that the antibody responses generated in TB patients were mostly directed towards the N-PPE17, as in an inhibition EIA, pre-incubation of TB sera with the recombinantly purified N-PPE17 could significantly inhibit detection of full-length PPE17-specific antibody responses. It was observed that the patients with active TB disease had levels of N-PPE17-specific antibodies similar to that of full-length PPE17, indicating that the N-terminal domain of PPE17 was immunodominant. Further, PPE17-specific antibody levels in majority of the sera samples were neutralized by N-PPE17, suggesting that the N-terminal but not the C-terminal domain of PPE17 elicited stronger antibody responses in patients with active TB disease. This may be due to absence of immunodominant B-cell epitopes in the C-terminal domain of PPE17 protein. In our earlier studies, we observed that TB patients had higher anti-PPE17 antibody titers as compared to BCG-vaccinated healthy individuals [15]. In the present study, we demonstrate that antibody responses to PPE17 can be attributed to the PPE17 N-terminal domain in these patients. Both PPE17 and N-PPE17 were able to successfully discriminate sera of the active TB patients from the BCG-vaccinated healthy controls with sensitivities of 83.33% and 91.66% respectively. However, 16.66% (30/180) and 8.33% (15/180) patients showed OD below the cut-off values which could be due to differences in B and T-cell responses in patients which may be attributed to differences in individual genetic polymorphism [3841].

Interestingly, when the immune response profiles of N-PPE17 in various clinical categories were studied, it was observed that the TB patients belonging to both pulmonary (smear positive and smear negative) and extrapulmonary clinical categories exhibited antibody responses to N-PPE17 equivalent to that of PPE17. These data reveal that all the three clinical categories of TB patients induce antibody responses predominantly against the N-PPE17 and N-PPE17 is probably associated with TB disease manifestation and can be used as a potent serodiagnostic marker to detect these categories of TB patients.

We have also compared the seroreactivity of TB patients against various concentrations of PPE17 and N-PPE17 proteins (ranging from 25 ng/well to 1μg/well) by EIA and the absorbance values were found to be well correlated with increased amount of PPE17 and N-PPE17 used. PPE17 as well as N-PPE17 proteins reacted strongly with serum antibodies from TB patients in EIA at 1 μg/well antigen concentration, however, at lower antigen concentrations (50 ng/well, 100 ng/well and 250 ng/well), N-PPE17 displayed higher absorbance than PPE17. This could be due to steric masking of N-terminal region in full-length PPE17. Thus, our study provides a hint that the N-terminal fragment of PPE17 could be used as a better serodiagnostic marker than the full-length PPE17 protein.

Since, the members of the PE/PPE family of proteins are characterized by highly conserved N-terminal domain, it is possible that the N-terminal epitopes of PPE proteins are responsible for antibody cross-reactivity in M. tuberculosis-infected patients. Therefore, we tested the cross-reactivity of N-PPE17 along with three other full-length PPE proteins such as PPE18 (Rv1196), PPE44 (Rv2770c) and PPE65 (Rv3621c). Sera samples of TB patients were pre-incubated with these proteins and then added to N-PPE17 coated EIA plates. Interestingly, we observed that none of the PPE proteins could significantly inhibit reactivity of sera samples to N-PPE17. Though there could exist a weak cross-reactivity to other N-terminal domains of PPE proteins, we hint at absence of a universal cross-reactive epitope in the N-terminal domains of PPE proteins used in this study. This indicates that though the N-terminal regions of PPE proteins share a conserved sequence, they may be structurally different. Earlier we demonstrated that N-terminal fragments of PPE17 and PPE18 proteins induce contrasting signaling cascades in macrophages due to their different conformations [30,35,42,43]. Thus, it is interesting to speculate that though the N-terminal region of about 180 amino acid residues of PPE proteins are conserved, the subtle variation in the sequence and length in the C-terminal region could change the three-dimensional epitopes of PPE proteins resulting in more unique immunoreactivity to N-PPE17. To test whether N-terminal domain of PPE17 has any unique region that is responsible for eliciting stronger antibody responses in TB patient sera, we used Imed antigenic prediction tool (imed.meducm.es/Tools/antigenic.pi) to predict the B-cell epitope present in the N-terminal domain of PPE17. When the predicted antigenic region of N-PPE17 was aligned with N-terminal regions of PPE18, PPE44 and PPE65 using EMBOSS water pair wise alignment tool, we found a stretch of amino acid sequence starting from 122 amino acid to 140 amino acid (IFGIHTPAIFALDALYAQY) is immunogenic and the percentage identity of this stretch with N-PPE18, N-PPE44 and N-PPE65 was only 38%, 36% and 42% respectively. Therefore, it can be concluded that the amino acid regions from 122 to 140 is almost 60% unique to N-PPE17 which might be responsible for the strong antibody response to PPE17 protein.

In summary, we demonstrate that the N-terminal domain of PPE17 protein is immunodominant and can discriminate BCG-vaccinated healthy controls from patients with active TB and can be used as a potent serodiagnostic marker. Though the present study involves samples from active TB patients only, it might be interesting to investigate application of the N-PPE17 protein antigen in discriminating individuals with latent TB infection from BCG-vaccinated healthy individuals.

Supporting information

S1 Fig. Amino acid sequence (1 to 346) of Mycobacterium tuberculosis PPE17 protein.

Amino acid sequence starting from 1 to 173 (highlighted in bold) represents N-terminal region of PPE17. The predicted antigenic peptide (sequence starting from 122 to 140 amino acids) unique to N-terminal PPE17 is represented in the box.

https://doi.org/10.1371/journal.pone.0179965.s001

(PDF)

S2 Fig. Purification of recombinant PPE17 proteins.

Recombinant PPE proteins from Escherichia coli were purified by affinity chromatography using TALON resins. Results shown is for Coomassie-blue stained sodium dodecyl sulfate gel showing the protein molecular weight marker (M) and elution fractions (1 to 7) for PPE17 (A), N-terminal fragment of PPE17 (B), PPE44 (C), PPE18 (D) and PPE65 (E). Molecular weight of the PPE proteins is highlighted with an arrow.

https://doi.org/10.1371/journal.pone.0179965.s002

(PDF)

S3 Fig. N-PPE17 inhibits detection of antibody response of TB patients to PPE17 in concentration-dependent manner.

The EIA plate coated with either N-terminal fragment of PPE17 or full-length PPE17 antigen was incubated with 50 μl sera (n = 40) that were either left untreated or pre-incubated with 1μg (20 μg/ml) or 3 μg (60 μg/ml) of N-PPE17 protein. The plates were further incubated with anti-human IgG-HRP and absorbance was read at 492 nm using OPD.

https://doi.org/10.1371/journal.pone.0179965.s003

(PDF)

Acknowledgments

We are thankful to G.S. Susiharan for the technical support and Madhu Babu Battu for bioinformatics study. The authors are thankful to the participants enrolled for this study at Bhagwan Mahavir Medical Research Centre, Hyderabad.

Author Contributions

  1. Conceptualization: SM PRA GS.
  2. Formal analysis: SM PRA.
  3. Funding acquisition: SM PRA.
  4. Investigation: SM NP PRA.
  5. Methodology: PRA NP GP.
  6. Project administration: SM.
  7. Resources: SM PRA.
  8. Supervision: SM.
  9. Validation: SM GS.
  10. Visualization: SM PRA.
  11. Writing – original draft: SM PRA.
  12. Writing – review & editing: SM.

References

  1. 1. World Health Organization (WHO), Geneva: Global tuberculosis report 2015.
  2. 2. Siddiqi K, Lambert ML, Walley J. Clinical diagnosis of smear-negative pulmonary tuberculosis in low-income countries: the current evidence. Lancet Infect. Dis. 2003; 3:288–96. pmid:12726978.
  3. 3. Pfyffer GE and Wittwer F. Incubation time of mycobacterial cultures: how long is long enough to issue a final negative report to the clinician? J Clin Microbiol. 2012; 50:4188–89. pmid:23052304.
  4. 4. Lv Z, Zhang M, Zhang H, Lu X. Utility of real-time quantitative polymerase chain reaction in detecting Mycobacterium tuberculosis. BioMed Res Int. 2017; pmid:28168192.
  5. 5. Huebner RE, Schein MF, Bass JB. The tuberculin skin test. Clin Infect Dis. 1993; 17: 968–75. pmid:8110954.
  6. 6. Moore DF, Curry JI. Detection and identification of Mycobacterium tuberculosis directly from sputum sediments by Amplicor PCR. J Clin Microbiol. 1995; 33:2686–91. pmid:8567906.
  7. 7. Marchetti G, Gori A, Catozzi L, Catozzi L, Vago L, Nebuloni M, et al. Evaluation of PCR in detection of Mycobacterium tuberculosis from formalin-fixed, paraffin-embedded tissues: Comparison of four amplification assays. J Clin Microbiol. 1998; 36:1512–17. pmid:9620369.
  8. 8. Herrera V, Perry S, Parsonnet J, Banaei N. Clinical application and limitations of interferon-γ release assays for the diagnosis of latent tuberculosis infection. Clin Infect Dis. 2011; 52:1031–7. pmid:21460320.
  9. 9. Trebucq A, Enarson DA, Chiang CY, van Deun A, Harries AD, Boillot F, et al. Xpert® MTB/RIF for national tuberculosis programmes in low-income countries: when, where and how? Int J Tuberc Lung Dis. 2011; 15:1567–71. pmid:22005110.
  10. 10. Baumann R, Kempfer S, Chegou NN, Oehlmann W, Loxton AG, Kaufmann SH et al. Serological diagnosis of tuberculosis by combining Ig classes against selected mycobacterial targets. J Infect 2014; 59: 581–589. pmid:24968240.
  11. 11. Steingart KR, Dendukuri N, Henry M, Schiller I, Nahid P, Hopewell PC et al. Performance of purified antigens for serodiagnosis of pulmonary tuberculosis: a meta-analysis. Clin Vaccine Immunol. 2009;16:260–76. pmid:19052159.
  12. 12. Choudhary RK, Mukhopadhyay S, Chakhaiyar P, Sharma N, Murthy KJ, Katoch VM, et al. PPE antigen Rv2430c of Mycobacterium tuberculosis induces a strong B-cell response. Infect Immun. 2003; 71:6338–43. pmid:14573653.
  13. 13. Chakhaiyar P, Nagalakshmi Y, Aruna B, Murthy KJ, Katoch VM, Hasnain SE. Regions of high antigenicity within the hypothetical PPE major polymorphic tandem repeat open-reading frame, Rv2608, show a differential humoral response and a low T cell response in various categories of patients with tuberculosis. J Infect Dis. 2004; 190:1237–44. pmid:15346333.
  14. 14. Rindi L. Peroni I, Lari N, Bonanni D, Tortoli E, Garzelli C. Variation of the expression of Mycobacterium tuberculosis ppe44 gene among clinical isolates. FEMS Immunol Med Microbiol. 2007; 5:381–7. pmid:17727653.
  15. 15. Khan N, Alam K, Nair S, Valluri VL, Murthy KJ, Mukhopadhyay S. Association of strong immune responses to PPE protein Rv1168c with active tuberculosis. Clin Vaccine Immunol. 2008; 15:974–80. pmid:18400969.
  16. 16. Zhang H, Zhang H, Wang J, Lei J, Zhang M, Yang Y, et al. PPE protein (Rv3425) from DNA segment RD11 of Mycobacterium tuberculosis: a potential B-cell antigen used for serological diagnosis to distinguish vaccinated controls from tuberculosis patients. Clin Microbiol Infect. 2007; 13:139–45. pmid:17328725.
  17. 17. Zhang G, Zhang L, Zhang M, Pan L, Wang F, Huang J, et al. Screening and assessing 11 Mycobacterium tuberculosis proteins as potential serodiagnostical markers for discriminating TB patients from BCG vaccinees. Geno Proteo Bioinfo. 2009; 7:107–15. pmid:19944383.
  18. 18. Tundup S, Pathak N, Ramanadham M, Mukhopadhyay S, Murthy KJR, Ehtesham NZ, et al. The co-operonic PE25/PPE41 protein complex of Mycobacterium tuberculosis elicits increased humoral and cell mediated immune response. PLoS ONE. 2008; 3:e3586. pmid:18974870.
  19. 19. Ireton GC, Greenwald R, Liang H, Esfandiari J, Lyashchenko KP, Reed SG. Identification of Mycobacterium tuberculosis antigens of high serodiagnostic value. Clin Vaccine Immunol. 2010; 17:1539–47. pmid:20719988.
  20. 20. Xu JN, Chen JP, Chen DL. Serodiagnosis efficacy and immunogenicity of the fusion protein of Mycobacterium tuberculosis composed of the 10-kilodalton culture filtrate protein, ESAT-6, and the extracellular domain fragment of PPE68. Clin Vaccine Immunol. 2012; 19:533–44. pmid:22357648.
  21. 21. Abraham PR, Latha GS, Valluri VL, Mukhopadhyay S. Mycobacterium tuberculosis PPE protein Rv0256c induces strong B cell response in tuberculosis patients. Infect Genet Evol. 2014; 22:244–9. pmid:23827809.
  22. 22. Abraham PR, Udgata A, Sumanlata G, Mukhopadhyay S. The Mycobacterium tuberculosis PPE protein Rv1168c induces stronger B cell response than Rv0256c in active TB patients. Infect Genet Evol. 2016; 40:339–45. pmid:26364913.
  23. 23. Betts JC, Lukey PT, Robb LC, McAdam RA, Duncan K. Evaluation of a nutrient starvation model of Mycobacterium tuberculosis persistence by gene and protein expression profiling. Mol Microbiol. 2002; 43:717–31. pmid:11929527.
  24. 24. Schnappinger D, Ehrt S, Voskuil MI, Liu Y, Mangan JA, Monahan IM, et al. Transcriptional adaptation of Mycobacterium tuberculosis within macrophages: insights into the phagosomal environment. J Exp Med 2003. 198:693–704. pmid:12953091.
  25. 25. Bacon J, James BW, Wernisch L, Williams A, Morley KA, Hatch GJ, et al. The influence of reduced oxygen availability on pathogenicity and gene expression in Mycobacterium tuberculosis. Tuberculosis 2004. 84:205–17. pmid:15207490.
  26. 26. Muttucumaru D, Roberts GG, Hinds J, Stabler RA, Parish T. Gene expression profile of Mycobacterium tuberculosis in a non-replicating state. Tuberculosis (edinb). 2002; 84:239–46. pmid:15207493.
  27. 27. Homolka S, Niemann S, Russell DG, Rohde KH. Functional genetic diversity among Mycobacterium tuberculosis complex clinical isolates: delineation of conserved core and lineage-specific transcriptomes during intracellular survival. PLoS Pathog. 2010; 6:e1000988. pmid:20628579.
  28. 28. Dona V, Ventura M, Sali M, Cascioferro A, Provvedi R, Palu G, et al. The PPE Domain of PPE17 is responsible for its surface localization and can be used to express heterologous proteins on the mycobacterial surface. PLoS ONE. 2013; 8:e57517. pmid:23469198.
  29. 29. Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, et al. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature. 1998; 393:537–44. pmid:9634230.
  30. 30. Nair S, Ramaswamy PA, Ghosh S, Joshi DC, Pathak N, Siddiqui I, et al. The PPE18 of Mycobacterium tuberculosis interacts with TLR2 and activates IL-10 induction in macrophage. J Immunol. 2009; 183:6269–81. pmid:19880448.
  31. 31. Mukhopadhyay S, Balaji KN. The PE and PPE proteins of Mycobacterium tuberculosis. Tuberculosis (edinb). 2011; 91:441–7. pmid:21527209.
  32. 32. Sampson SL. Mycobacterial PE/PPE proteins at the host-pathogen interface. Clin Dev Immunol. 2011;497203. pmid:21318182.
  33. 33. Ahmed A, Das A, Mukhopadhyay S. Immunoregulatory functions and expression patterns of PE/PPE family members: Roles in pathogenicity and impact on anti-tuberculosis vaccine and drug design. IUBMB Life. 2015; 67:414–27. pmid:26104967.
  34. 34. Bonanni D, Rindi L, Lari N, Garzelli C. Immunogenicity of mycobacterial PPE44 (Rv2770c) in Mycobacterium bovis BCG-infected mice. J Med Microbiol. 2005; 54:443–48. pmid:15824420.
  35. 35. Nair S, Pandey AD, Mukhopadhyay S. The PPE18 protein of Mycobacterium tuberculosis inhibits NF-κB/rel-mediated proinflammatory cytokine production by upregulating and phosphorylating suppressor of cytokine signaling 3 protein. J Immunol. 2011; 186:5413–24. pmid:21451109
  36. 36. Monterrubio-Lopez GP, Gonzalea-Y-Merchand JA, Robas-Aparcio RM. Identification of novel potential vaccine candidates against tuberculosis based on reverse vaccinology. BioMed Res Int. 2015: 483150. pmid:25961021.
  37. 37. Khubaib M, Sheikh JA, Pandey S, Srikanth B, Bhuwan M, Khan N, et al. Mycobacterium tuberculosis co-operonic PE32/PPE65 proteins alter host immune responses by hampering Th1 response. Front Microbiol. 2016; 7:719. pmid:27242739.
  38. 38. Raja A. Immunology of tuberculosis. Indian J Med Res. 2004; 120:213–32. pmid:15520479.
  39. 39. Longhi RM, Zembrzuski VM, Basta PC, Croda J. Genetic polymorphism and immune response to tuberculosis in indigenous populations: a brief review. Braz J Infect Dis. 2013; 363–8. pmid:23665009.
  40. 40. Khalilullah SA, Harapan H, Hasan NA, Winardi W, Ichsan I, Mulyadi M. Host genome polymorphisms and tuberculosis infection: What we have to say? Egypt J Chest Dis Tuberc. 2014; 63:173–85. pmid:26966339.
  41. 41. Fol M, Druszczynska M, Wlodarczyk M, Ograczyk E, Rudnicka W. Immune response gene polymorphisms in tuberculosis. Acta Biochim Pol. 2015; 62:633–40. pmid:26634232.
  42. 42. Bhat KH, Chaiytanya CK, Parveen N, Varman R, Ghosh S, Mukhopadhyay S. Proline-Proline-Glutamic Acid (PPE) protein Rv1168c of Mycobacterium tuberculosis augments transcription from HIV-1 long terminal repeat promoter. J Biochem. 2012; 287:16930–46.
  43. 43. Udgata A, Qureshi R, Mukhopadhyay S. Transduction of functionally contrasting signals by two mycobacterial PPE proteins downstream of TLR2 receptors. J Immunol. 2016; 197:1776–87. pmid:27481848.