Figures
Abstract
A recent study identified SCYL1 as one of the components of the oncogenic STP axis, which promotes triple-negative breast cancer by regulating degradation of the REST tumor suppressor. Contrary to the findings of that study, herein we show by using 3 distinct genetic approaches that SCYL1 does not regulate REST turnover. Specifically, REST protein levels and turnover were identical in Scyl1+/+ and Scyl1-/- mouse embryonic fibroblasts. Similarly, targeted inactivation of SCYL1 in Hek293T cells by using CRIPSR-Cas9 technology did not affect REST steady-state level and turnover. Furthermore, RNA interference–mediated depletion of SCYL1 in Hek293T or MDA-MB-231 cells did not alter REST steady-state level and turnover. Together, our findings indicate that SCYL1 does not contribute to REST turnover and thus do not support a previous study suggesting a role for SCYL1 in mediating REST degradation.
Citation: Gingras S, Kuliyev E, Pelletier S (2017) SCYL1 does not regulate REST expression and turnover. PLoS ONE 12(6): e0178680. https://doi.org/10.1371/journal.pone.0178680
Editor: Ruby John Anto, Rajiv Gandhi Centre for Biotechnology, INDIA
Received: July 21, 2015; Accepted: March 13, 2017; Published: June 1, 2017
Copyright: © 2017 Gingras et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper.
Funding: Support was provided by American Lebanese Syrian Associated Charities.
Competing interests: The authors have declared that no competing interests exist.
Introduction
The RE-1 silencing transcription factor (REST), also known as the neuron-restrictive silencer factor, is a transcriptional repressor that regulates early lineage commitment and neuronal plasticity [1]. During the transition from pluripotent to neural stem/progenitor cells, REST is actively degraded by the proteasome [1, 2], and downregulation of REST triggers neuronal gene expression critical to nervous system development [1]. In addition to regulating neuronal development, REST also functions as a tumor suppressor in epithelial tissues. An RNA interference (RNAi)–based screen identified REST as an important regulator of human mammary epithelial cell proliferation [3]. Consistent with the role of REST in regulating epithelial cell transformation, inactivating mutations, gene deletions, gene silencing, and alternative splicing of REST have been associated with epithelial malignancies [3–6]. During neuronal development and epithelial cell transformation, REST is degraded by the ubiquitin-proteasome pathway through the recognition of a phospho-degron located in the C-terminal region by the ubiquitin ligase βTRCP [1, 2]. In search of signaling pathways that regulate the phosphorylation and degradation of REST, Karlin et al. identified a novel oncogenic complex comprising SCYL1, TEX14, and PLK1 (STP axis), which cooperatively promotes the degradation of REST by phosphorylating a conserved phospho-degron, thereby linking REST to βTRCP [7].
SCYL1 is a critical regulator of motor neuron survival [8–10]. In mice, loss of SCYL1 function leads to an early onset motor neuron disorder with characteristic features of amyotrophic lateral sclerosis (ALS), including mislocalization of TDP43 and ubiquilin-2 in cytoplasmic aggregates in spinal motor neurons [9]. The mechanism underlying the neuroprotective function of SCYL1, however, has remained elusive. Interestingly, an early study in chicken embryos showed that ectopic expression of REST in the developing spinal cord leads to axonal pathfinding errors and suggested that downregulation of REST is necessary for proper neuronal development [11]. In light of recent findings suggesting a role for SCYL1 in regulating REST [7] turnover, we hypothesized that REST could be stabilized in Scyl1-deficient mice causing errors in motor neuron pathfindings and motor neuron degeneration.
To test this hypothesis, we first validated the findings of Karlin et al. that suggest a role for SCYL1 in regulating REST expression and turnover by using 3 distinct genetic approaches. Unexpectedly, we found that SCYL1 is dispensable for REST turnover. Specifically, we show that targeted inactivation of Scyl1 by conventional gene targeting in mouse embryonic fibroblasts (MEFs), CRIPSR-Cas9–mediated inactivation of SCYL1 in Hek293T cells, or RNAi-mediated knockdown of SCYL1 in Hek293T or MDA-MB-231 cells did not affect the steady-state expression level and turnover of REST. Thus, our data do not support the previously published data by Karlin et al. demonstrating a role for SCYL1 in regulating the REST level and turnover.
Materials and methods
Antibodies
The anti-REST rabbit polyclonal antibody (07–579) was purchased from EMD Millipore. The polyclonal anti-SCYL1 antibody produced in rabbit, Human Protein Atlas Number HPA015015, was purchased from Sigma-Aldrich. The monoclonal anti-β-actin antibody clone AC-15 produced in mouse (A1978) was purchased from Sigma-Aldrich. The anti-rabbit IgG HRP-linked antibody (111-035-003) and anti-mouse IgG HRP-linked antibody (115-035-174) were purchased from Jackson ImmunoResearch.
Tissue culture
Hek293T cells (ATCC® CRL-3216™) and SV40-transformed MEFs obtained from E15 Scyl1+/+ and Scyl1-/- mouse embryos [9] were cultured in DMEM, high glucose, supplemented with FBS, L-glutamine, penicillin, and streptomycin. MDA-MB-231 (ATCC® HTB-26™) cells were cultured in L-15 medium (Sigma-Aldrich, SLBN4238V), supplemented with fetal bovine serum to a final concentration of 10%, penicillin, and streptomycin. MDA-MB-231 cells were cultured with atmospheric air.
Generation CRISPR-Cas9 constructs
SCYL1 gene ablation in Hek293T cells was performed by using CRISPR-Cas9 technology. Two single-guide RNAs (sgRNAs) targeting exon 4 of SCYL1 were selected as described previously [12]: hScyl1sgRNA1, TCGTGGACCGAGCTGGCGAG (chr11:65,526,191–65,526,213, GRCh38/hg38) and the hScyl1sgRNA2, CTGCTGTCAGCCAACTCCGG (chr11:65,526,304–65,526,326, GRCh38/hg38). The selected guide sequences have no potential off-target sites with fewer than 3 mismatches, and the protospacer-adjacent motif-proximal 13-nucleotide seed sequences are unique in the human genome. The guide sequences were cloned in PX458 to generate px458-hScyl1-1 and px458-hScyl1-2, respectively. pSpCas9(BB)-2A-GFP (PX458) was a gift from Dr. Feng Zhang (Addgene plasmid # 48138) [13].
Generation of SCYL1-deficient Hek293T cells
Hek293T cells were transfected with both sgRNAs. Two days later, GFP-positive cells were single sorted by fluorescence-activated cell sorting into individual wells of 96-well plates. The region surrounding the target sequences was PCR amplified with the following primers: hScyl1-F01, GAGATCTCCTGGGGGCTACA, and hScyl1-R01, CAGAATCACCCAACCCCGAA. PCR products were TOPO cloned, and more than 12 mini-preps for each clone were sequenced. Three clones were obtained in which both SCYL1 alleles contained distinct deletions that caused a frame shift and premature stop codon, leading to mRNA decay. Also, 3 additional clones were selected in which SCYL1 remained unaltered. SCYL1 deletion was confirmed by western blot analysis.
Depletion of SCYL1 by RNA interference
Hek293T and MDA-MB-231 cells were transfected by using Lipofectamine® RNAiMAX transfection reagents (Invitrogen), as per manufacturer’s instructions, with the following RNAi duplexes (Invitrogen): SCYL1HSS126245 (5′-CCGUUGGGAAUAUACCUCAAGGCGA-3′), SCYL1HSS183826 (5′-CCAACCUCAAUGAGGAGCUGAUGAA-3′) and SCYL1HSS183827 (5′-UGCAACACCACAGUCUGCCUGGGCA-3′). Then, 30 pmole of RNAi duplexes in 250 μL Opti-MEM®I Reduced-Serum Medium without serum were combined with 5 μL Lipofectamine® RNAiMAX transfection reagents in 250 μL Opti-MEM®I Reduced Serum Medium without serum and mixed gently. After 20 min at room temperature, the RNAi duplex–lipofectamine complexes were added to each well of a 6-well plate containing 2.5 mL of culture medium. At 48 h post-transfection, cells were treated as described below.
REST half-life
Scyl1+/+ and Scyl1-/- MEFs, Hek293T cells, Hek293T-SCYL1KO cells and RNAi-treated Hek293T or MDA-MB-231 cells were plated in 6-well plates. At 24 (MEFs and Hek293T-SCYL1KO cells) or 48 h post-plating/transfection, cells were treated with 10 μg/mL of cycloheximide (CHX) for the indicated times. Cells were then lysed in RIPA buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% NP-40 [Igepal-CA-630], 0.5% sodium deoxycholate, 0.1% SDS) containing Complete™ protease inhibitors and PhosSTOP™ phosphatase inhibitors (Roche). Endogenous REST, SCYL1, and β-actin protein levels were determined by western blot analysis, and band intensities were quantified by using NIH Image J software version 1.42q (http://rsbweb.nih.gov/ij).
Cell cycle analysis by flow cytometry
Hek293T and Hek293T-SCYL1KO cells were incubated for 6 hours in the presence of DMSO or BI 2536 (100nM). The cells were then harvested and washed three times in PBS. The cells were then fixed in cold 70% ethanol for 30 minutes on ice. Next, the cells were washed twice with PBS, spun down and treated with 50 μL of RNase A (100 μg/mL). Then 200uL of propidium Iodide (50 μg/mL) was added to the cells and the cells were analyzed by flow cytometry (FACScan, Becton Dickinson, San Jose, CA). The % of cells in each stage of the cell cycle was determined using ModFit (Verity Software house, Topsham, ME) and plotted.
Results
To determine whether SCYL1 was involved in REST turnover, we measured the steady-state level and half-life of REST in Scyl1+/+ and Scyl1-/- MEFs by using cycloheximide chase experiments. We recognize the fact that protein synthesis inhibition by CHX can alter protein degradation via AKT activation [14]and that 35S-methionine/cysteine metabolic labeling represents a better approach to follow the degradation of proteins. However, for the sake of reproducibility, we have used CHX to prevent de novo synthesis of REST as did Karlin et al. in their studies [7]. Unexpectedly, both the steady-state level and half-life of REST were identical in Scyl1+/+ and Scyl1-/- MEFs (Fig 1), indicating that SCYL1 is dispensable for REST turnover in murine fibroblasts.
(A) REST protein turnover in Scyl1+/+ and Scyl1-/- MEFs. MEFs were seeded at a density of 250,000 cells per well of 6-well plates. The following day, cells were treated with 10 μg/mL of cycloheximide (CHX) for the indicated times. Endogenous REST, SCYL1, and β-actin levels were determined by western blot analysis. The images are representative of 2 independent experiments performed on 2 independently derived Scyl1+/+ and 3 Scyl1-/- MEF lines. Note the absence of SCYL1 in Scyl1-/- MEFs. (B) Quantification of REST protein levels in Scyl1+/+ and Scyl1-/- MEFs. The ratio of the band intensity of REST to β-actin was normalized to the ratio of untreated cells (time = 0 h). Data represent mean ± standard error of the mean.
Because MEFs may express factors that regulate REST turnover independently of the STP axis, we tested whether targeted ablation of SCYL1 in Hek293T cells, the cells used in the Karlin et al. study, affected REST turnover. We generated 3 independent Hek293T cell lines in which SCYL1 was disrupted by using CRISPR-Cas9 technology and measured the half-life of REST in each line. As seen in Scyl1-/- MEFs, the half-life and steady-state level of REST were identical in both Hek293T and Hek293T-SCYL1KO cells, indicating that SCYL1 is also dispensable for REST turnover in Hek293T cells (Fig 2).
(A) REST protein turnover in Hek293T cells. Hek293T-SCYL1KO cell lines (n = 3) were generated by using CRISPR-Cas9 technology (see Materials and Methods). Three Hek293T cell lines in which SCYL1 was unaltered (Hek293T) and three Hek293T-SCYL1KO cell lines were seeded at a density of 250,000 cells per well of 6-well plates. The following day, the cells were treated with 10 μg/mL of CHX for the indicated time. Endogenous REST, SCYL1, and β-actin levels were determined by western blot analysis. The images are representative of 2 independent experiments performed on 3 different independently derived clones for each genotype. (B) Quantification of REST protein levels in cell lines Hek293T and Hek293T-SCYL1KO. The ratio of the band intensity of REST to β-actin was normalized to the ratio of untreated (time = 0 h). Data represent mean ± standard error of the mean.
We hypothesized that REST turnover might be differentially regulated under acute versus chronic depletion of SCYL1, which might explain the differences between our findings and those of Karlin et al. To test this, we depleted SCYL1 in Hek293T cells by using 3 distinct RNAi duplexes and measured REST half-life and turnover. Although all 3 RNAi duplexes efficiently depleted SCYL1, REST half-life and steady-state expression remained unchanged (Fig 3A). Although Karlin et al. performed most of their studies related to REST protein turnover in Hek293T cells, some of their studies were also performed in MDA-MB-231 cells. Therefore, to rule out the possibility that discrepancy between both studies is due to the use of different cell lines, we tested whether REST protein expression and turnover were differently regulated in the breast cancer cell line MDA-MB-231. We assessed the role of SCYL1 in regulating REST turnover in MDA-MB-231 by using RNAi-mediated knockdowns. Although all 3 RNAi duplexes efficiently depleted SCYL1 (Fig 3B), REST half-life and steady-state expression remained unchanged (Fig 3B). Altogether, our results indicate that SCYL1 is dispensable for the downregulation of REST.
Hek293T (A) or MDA-MB-231 (B) cells were transfected with or without RNAi duplexes targeting SCYL1 (RNAi-1: SCYL1HSS126245, RNAi-2: SCYL1HSS183826, RNAi-3: SCYL1HSS183827). At 48 h post- transfection, cells were treated with 10 μg/mL of CHX for the indicated time. Endogenous REST, SCYL1, and β-actin levels were determined by western blot analysis. Comparable knockdown efficiencies were achieved for all 3 RNAi duplexes.
Lastly, we tested whether inhibition of polo-like kinase 1 (PLK1) activity using the small molecule BI2436 affected REST protein levels and turnover in Hek293T cells as reported by Karlin et al. Surprisingly, although incubation of Hek293T or Hek293T-SCYL1KO cells with BI 2536 (100nM) for 6h induced cell cycle arrest in G2M phase (Fig 4C), consistent with previous findings [15], it failed to affect REST expression and turnover (Fig 4A and 4B). Similarly, incubation of MDA-MB-231 cells with BI 2536 (100nM) had no effect on the steady levels of REST (Fig 4D and 4E). These results indicate that PLK1 activity is also dispensable for REST turnover in both Hek293T cells and MDA-MB-231.
(A) Three Hek293T cell lines in which SCYL1 was unaltered (Hek293T) and three Hek293T-SCYL1KO cell lines were seeded at a density of 250,000 cells per well of 6-well plates. The following day, the cells were treated with 10 μg/mL of CHX for 6 h in the presence or absence of absence of BI 2536 (100nM). Endogenous REST, SCYL1, and β-actin levels were determined by western blot analysis. The images are representative of 2 independent experiments performed on 3 different independently derived clones for each genotype. (B) Quantification of REST protein levels in cell lines Hek293T and Hek293T-SCYL1KO. The ratio of the band intensity of REST to β-actin was normalized to the ratio of untreated (time = 0 h). Data represent mean ± standard error of the mean. (C) Flow cytometric analysis of cell cycle with propidium iodide DNA staining of exponentially growing Hek293T (n = 3) and Hek293T-SCYL1KO (n = 3) cells treated for 6 h with 100nM BI 2536 or DMSO. In the presence of BI 2536, cells accumulated to 4N DNA content, indicative of G2/M arrest. Data represent mean ± standard error of the mean. (D) Four distinct cultures of MDA-MB-231 cells were incubated with DMSO or BI2 2536 (100nM) for 6 h. Endogenous REST, SCYL1, and β-actin levels were determined by western blot analysis. (E) Quantification of REST protein levels in MDA-MB-231 cells. The ratio of the band intensity of REST to β-actin was normalized to the ratio of DMSO treated cells. Data represent mean ± standard error of the mean.
Discussion
A novel oncogenic pathway regulating REST tumor suppressor turnover was recently described [7]. The STP axis, comprising SCYL1, Tex14 and PLK1, was identified in a kinome-wide RNAi screen for kinases that regulate REST turnover [7]. These findings were of particular interest to us because of our efforts in understanding the neuroprotective function of SCYL1 [9]. Thus, to validate these findings, we first analyzed REST expression and turnover in Scyl1-/- and Scyl1-/- MEFs. Unexpectedly, we found that loss of SCYL1 had no effect on REST levels and turnover. Because Karlin et al. used Hek293T cells to demonstrate that SCYL1 regulates REST turnover and because MEFs may express additional proteins that regulate REST turnover, we next targeted SCYL1 in Hek293T cells by using the CRISPR-Cas9 technology. Again, the loss of SCYL1 did not influence REST expression and turnover. In their study, Karlin et al. used an RNAi-mediated strategy to demonstrate a role for SCYL1 in regulating REST turnover in Hek293T cells and triple-negative cancer cells. We also performed RNAi-mediated studies by using 3 distinct RNAi duplexes (SCYL1HSS126245, SCYL1HSS183826, SCYL1HSS183827, Invitrogen) in Hek293T and MDA-MB-231 cells and found that despite significantly reducing SCYL1 expression, none of the RNAi duplexes affected REST expression and turnover. Altogether, our findings clearly indicate that SCYL1 is not required for REST degradation.
The reason for the discrepancy between our results and Karlin et al. is unknown. One explanation however is that the RNAi duplexes used in their study had off-target activity. Karlin et al. initially used RNAi duplexes SCYL1HSS126244, SCYL1HSS126245, and an unspecified one to identify SCYL1 as one of the STP axis genes. HSS126244 had the most prominent effect on REST protein expression, followed by HSS126245, and the third RNAi had no effect [7]. Subsequent experiments essentially relied on SCYL1HSS126244, which was shown to affect REST protein expression levels and delay REST turnover in Hek293T cells and triple-negative breast cancer cell lines [7]. Considering that RNAi screens are notorious for producing false-positive outcomes due to gene-silencing pathways based on microRNAs [16–18], it is possible that SCYL1HSS126244, in addition to targeting SCYL1, has other target sites and thereby affects the expression of other genes that regulate REST protein expression and turnover. Functional genome-wide RNAi-based gene silencing screens have been instrumental in identifying novel cellular pathways and potential drug targets and should be continued to be used. However, potential hits from these screens should be validated by using additional robust genetic approaches such as conventional and CRISPR-Cas9–mediated gene targeting [19]. Here we used three distinct genetic strategies to directly assess whether SCYL1 is involved in regulating REST protein levels and turnover. Although REST half-life was similar in parental cell lines (Hek293T and MDA-MB-231) between the two studies, we found that depletion of SCYL1 using three distinct RNAi duplexes in MDA-MB-231 cells or Hek293T cells or by gene disruption using CRISPR-Cas9 in Hek293T cells or conventional targeting in mouse embryonic fibroblasts had no effect on REST protein level or turnover. Our findings directly challenge the mechanism put forth by Karlin et al.
Our findings also argue against a role for PLK1 activity in regulating REST protein expression and turnover and suggest that another pathway, perhaps the MAP kinase signaling pathway as shown recently [20], regulates REST turnover in Hek293T cells. Inhibition of PLK1 had no effect on REST protein expression or turnover in Hek293T and MDA-MB-231 cells. Our studies, however, do not contest the possible role of Tex14 in mediating REST turnover; the formation of an STP complex; or the possibility of SCYL1, Tex14, PLK1, and REST being aberrantly expressed in triple-negative breast cancer cells [7].
Acknowledgments
The authors also thank Dr. Vani Shaker for editing the manuscript and Dr. Richard Cross for flow cytometry.
Author Contributions
- Conceptualization: SP SG.
- Formal analysis: SP SG.
- Investigation: SP SG EK.
- Methodology: SP SG.
- Project administration: SP.
- Resources: SP SG EK.
- Supervision: SP.
- Validation: SP SG EK.
- Visualization: SP SG EK.
- Writing – original draft: SP SG.
- Writing – review & editing: SP SG EK.
References
- 1. Ballas N, Grunseich C, Lu DD, Speh JC, Mandel G. REST and its corepressors mediate plasticity of neuronal gene chromatin throughout neurogenesis. Cell. 2005;121(4):645–57. pmid:15907476
- 2. Westbrook TF, Hu G, Ang XL, Mulligan P, Pavlova NN, Liang A, et al. SCFbeta-TRCP controls oncogenic transformation and neural differentiation through REST degradation. Nature. 2008;452(7185):370–4. PubMed Central PMCID: PMC2688689. pmid:18354483
- 3. Westbrook TF, Martin ES, Schlabach MR, Leng Y, Liang AC, Feng B, et al. A genetic screen for candidate tumor suppressors identifies REST. Cell. 2005;121(6):837–48. pmid:15960972
- 4. Kreisler A, Strissel PL, Strick R, Neumann SB, Schumacher U, Becker CM. Regulation of the NRSF/REST gene by methylation and CREB affects the cellular phenotype of small-cell lung cancer. Oncogene. 2010;29(43):5828–38. pmid:20697351
- 5. Coulson JM, Edgson JL, Woll PJ, Quinn JP. A splice variant of the neuron-restrictive silencer factor repressor is expressed in small cell lung cancer: a potential role in derepression of neuroendocrine genes and a useful clinical marker. Cancer research. 2000;60(7):1840–4. pmid:10766169
- 6. Wagoner MP, Gunsalus KT, Schoenike B, Richardson AL, Friedl A, Roopra A. The transcription factor REST is lost in aggressive breast cancer. PLoS genetics. 2010;6(6):e1000979. PubMed Central PMCID: PMC2883591. pmid:20548947
- 7. Karlin KL, Mondal G, Hartman JK, Tyagi S, Kurley SJ, Bland CS, et al. The oncogenic STP axis promotes triple-negative breast cancer via degradation of the REST tumor suppressor. Cell reports. 2014;9(4):1318–32. PubMed Central PMCID: PMC4427000. pmid:25453754
- 8. Blot S, Poirier C, Dreyfus PA. The mouse mutation muscle deficient (mdf) is characterized by a progressive motoneuron disease. Journal of neuropathology and experimental neurology. 1995;54(6):812–25. pmid:7595654
- 9. Pelletier S, Gingras S, Howell S, Vogel P, Ihle JN. An early onset progressive motor neuron disorder in Scyl1-deficient mice is associated with mislocalization of TDP-43. The Journal of neuroscience: the official journal of the Society for Neuroscience. 2012;32(47):16560–73.
- 10. Schmidt WM, Kraus C, Hoger H, Hochmeister S, Oberndorfer F, Branka M, et al. Mutation in the Scyl1 gene encoding amino-terminal kinase-like protein causes a recessive form of spinocerebellar neurodegeneration. EMBO reports. 2007;8(7):691–7. PubMed Central PMCID: PMC1905899. pmid:17571074
- 11. Paquette AJ, Perez SE, Anderson DJ. Constitutive expression of the neuron-restrictive silencer factor (NRSF)/REST in differentiating neurons disrupts neuronal gene expression and causes axon pathfinding errors in vivo. Proceedings of the National Academy of Sciences of the United States of America. 2000;97(22):12318–23. PubMed Central PMCID: PMC17339. pmid:11050251
- 12. Pelletier S, Gingras S, Green DR. Mouse genome engineering via CRISPR-Cas9 for study of immune function. Immunity. 2015;42(1):18–27. pmid:25607456
- 13. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nature protocols. 2013;8(11):2281–308. PubMed Central PMCID: PMC3969860. pmid:24157548
- 14. Dai CL, Shi J, Chen Y, Iqbal K, Liu F, Gong CX. Inhibition of protein synthesis alters protein degradation through activation of protein kinase B (AKT). The Journal of biological chemistry. 2013;288(33):23875–83. PubMed Central PMCID: PMC3745334. pmid:23843462
- 15. Steegmaier M, Hoffmann M, Baum A, Lenart P, Petronczki M, Krssak M, et al. BI 2536, a potent and selective inhibitor of polo-like kinase 1, inhibits tumor growth in vivo. Current biology: CB. 2007;17(4):316–22. pmid:17291758
- 16. Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136(2):215–33. PubMed Central PMCID: PMC3794896. pmid:19167326
- 17. Carthew RW, Sontheimer EJ. Origins and Mechanisms of miRNAs and siRNAs. Cell. 2009;136(4):642–55. PubMed Central PMCID: PMC2675692. pmid:19239886
- 18. Hannus M, Beitzinger M, Engelmann JC, Weickert MT, Spang R, Hannus S, et al. siPools: highly complex but accurately defined siRNA pools eliminate off-target effects. Nucleic acids research. 2014;42(12):8049–61. PubMed Central PMCID: PMC4081087. pmid:24875475
- 19. Mohr SE, Smith JA, Shamu CE, Neumuller RA, Perrimon N. RNAi screening comes of age: improved techniques and complementary approaches. Nature reviews Molecular cell biology. 2014;15(9):591–600. PubMed Central PMCID: PMC4204798. pmid:25145850
- 20. Nesti E, Corson GM, McCleskey M, Oyer JA, Mandel G. C-terminal domain small phosphatase 1 and MAP kinase reciprocally control REST stability and neuronal differentiation. Proceedings of the National Academy of Sciences of the United States of America. 2014;111(37):E3929–36. PubMed Central PMCID: PMC4169941. pmid:25197063