Metal-dependent SpoIIE oligomerization stabilizes FtsZ during asymmetric division in Bacillus subtilis

Ewa Cendrowicz; Anabela de Sousa Borges; Malgorzata Kopacz; Dirk-Jan Scheffers

doi:10.1371/journal.pone.0174713

Abstract

SpoIIE is a bifunctional protein involved in asymmetric septum formation and in activation of the forespore compartment-specific transcription factor σ^F through dephosphorylation of SpoIIAA-P. The phosphatase activity of SpoIIE requires Mn²⁺ as a metal cofactor. Here, we show that the presence of a metal cofactor also influences SpoIIE oligomerization and asymmetric septum formation. Absence of Mn²⁺ from sporulation medium results in a delay of the formation of polar FtsZ-rings, similar to a spoIIE null mutant. We purified the entire cytoplasmic part of the SpoIIE protein, and show that the protein copurifies with bound metals. Metal binding both stimulates SpoIIE oligomerization, and results in the formation of larger oligomeric structures. The presence of SpoIIE oligomers reduces FtsZ GTP hydrolysis activity and stabilizes FtsZ polymers in a light scattering assay. Combined, these results indicate that metal binding is not just required for SpoIIE phosphatase activity but also is important for SpoIIE's role in asymmetric septum formation.

Citation: Cendrowicz E, de Sousa Borges A, Kopacz M, Scheffers D-J (2017) Metal-dependent SpoIIE oligomerization stabilizes FtsZ during asymmetric division in Bacillus subtilis. PLoS ONE 12(3): e0174713. https://doi.org/10.1371/journal.pone.0174713

Editor: Eric Cascales, Centre National de la Recherche Scientifique, Aix-Marseille Université, FRANCE

Received: June 20, 2016; Accepted: March 14, 2017; Published: March 30, 2017

Copyright: © 2017 Cendrowicz et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the paper and its Supporting Information files.

Funding: Work in the Scheffers lab is supported by a VIDI fellowship (864.09.010) from the Netherlands Organisation for Scientific Research (NWO) and the bilateral research programme “Biobased Economy” from NWO (729.004.005). Anabela de Sousa Borges was supported by a doctoral grant (SFRH/BD/78061/2011) from POPH/FSE and FCT (Fundação para a Ciência e Tecnologia) from Portugal. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

In response to starvation conditions, Bacillus subtilis cells cease vegetative growth and initiate the formation of a dormant cell type called a spore [1–3]. The first visible step in this process is the formation of the asymmetrically positioned septum that divides the cell into two daughter cells of different size: the larger mother cell and the smaller forespore, that each receive one copy of the chromosome. Subsequently, compartment specific transcription factors σ^F and σ^E are activated in the forespore and in the mother cell, respectively. This activation event is critical because it initiates the rest of the sporulation developmental program in each daughter cell. Ultimately, the forespore becomes the spore and the mother cell lyses when the process is complete.

Upon entry into sporulation, the cell division protein FtsZ, that during vegetative growth drives the mid-cell division, switches its position to the polar sites of the cell. The switch is triggered by an integral membrane protein called SpoIIE [4–7]. At the onset of sporulation, SpoIIE co-localizes with FtsZ at mid-cell and both proteins redeploy to polar sites via a spiral-like intermediate [4]. Recently, it was shown that this process also requires DivIVA, which interacts with SpoIIE [8]. Next, one of the polar Z-rings disassembles and the other one is converted into a division septum. SpoIIE contributes to, but is not essential for, the formation of polar Z-rings. In spoIIE null mutant cells, FtsZ still localizes to the polar sites but the switch from medial to polar rings is delayed and the frequency of polar Z-ring formation is decreased [9, 10]. While the FtsZ ring constricts, DivIVA and SpoIIE remain localized at the 'base' of the septum, with SpoIIE predominantly located at the prespore side of the septum [8]. SpoIIE is then transferred from the septum to the cell pole of the prespore, primed to perform its second function, while SpoIIE in the mothercell is degraded by FtsH [11]. This second SpoIIE function is the activation of the prespore specific transcription factor σ^F by dephosphorylating the anti-sigma factor antagonist SpoIIAA [12–14]. SpoIIE phosphatase is inactive in the pre-divisional cell and becomes active only after the asymmetric septum is formed [15]. It is thought that FtsZ may be involved in the activation of SpoIIE phosphatase, as well as oligomerization of SpoIIE, which protects SpoIIE from proteolysis by FtsH [11]. SpoIIE is a transmembrane protein with a three-domain structure: the N-terminal domain (domain I) consists of 10 membrane-spanning segments; the poorly conserved central domain (domain II) is involved in the oligomerization of SpoIIE and its interaction with FtsZ; the C-terminal domain (domain III) is the phosphatase domain (Fig 1A) [16–19]. There is a clear structural separation of the three domains of SpoIIE. The C-terminal domain III can independently function as a phosphatase in vitro [20], whereas the central domain II can interact with either FtsZ or itself [21], independent of the other two domains. However, some mutations in domain II influence the phosphatase activity of SpoIIE [15], whereas mutations in domain III that impair the phosphatase activity also impair polar cell division [7]. The structure of domain III revealed that this domain is structurally related to the Protein phosphatase 2C (PP2C), Mn²⁺-dependent family of protein phosphatases. Crystallized domain III contained one bound Mn²⁺ ion at low occupancy even though crystals were grown in the presence of 50 mM MnCl₂, suggesting very weak Mn²⁺ binding [19]. This was confirmed by the inability to detect bound Mn²⁺ by atomic absorption spectroscopy or size exclusion chromatography [19]. The phosphatase activity of domain III is Mn²⁺ dependent but could only be detected in the presence of high concentrations (20 mM) of added MnCl₂, again indicating that Mn²⁺ is not bound with high affinity [19]. Interestingly, other PPP2C family members contain two or three Mn²⁺ ions, and SpoIIE has the equivalent residues to coordinate a second Mn²⁺ ion although this second ion was not found in the structure [19].

Download:

Fig 1.

(A) The putative three domain structure of SpoIIE (top) and a schematic of the SpoIIE construct used in this study (bottom), (B) SDS-PAGE of the sedimentation of ms-SpoIIE_cyt. Ms-SpoIIE_cyt was pre-incubated with 1 mM EDTA (lanes 1 and 2), followed by the incubation with 5 mM MnCl₂ (lanes 3 and 4), followed by the incubation with 10 mM EDTA (lanes 5 and 6). Odd numbers below the image represent supernatant fractions and even numbers represent pellet fractions, (C) Electron microscopy of ms-SpoIIE_cyt oligomers after co-purification with Fe²⁺ (i). Oligomers were not observed after incubation of the protein with 5 mM EDTA (ii). Arrows point to rod and circular structures of ms-SpoIIE_cyt. Scale bar: 50 nm, (D, E) Fluorescence emission spectra of s-SpoIIE_cyt-Cy5 titrated into a buffer in the absence (D) and presence (E) of Mn²⁺. Every spectrum represents a titration step with a 0.23 μM concentration increase of s-SpoIIE_cyt-Cy5, with the bottom spectrum representing buffer without any added protein.

https://doi.org/10.1371/journal.pone.0174713.g001

SpoIIE and FtsZ have been shown to interact in vitro using gel filtration [21]. However, details about the SpoIIE-FtsZ interaction and SpoIIE self-interaction are not known due to difficulties in the expression and purification of the soluble cytoplasmic domain of SpoIIE [20].

Here, we purified the soluble part of SpoIIE (SpoIIE_cyt) as a fusion protein and show that SpoIIE oligomerization is greatly stimulated by the presence of metal ions, which in turn stabilizes FtsZ polymers. Further, we show that in the absence of manganese, the formation of asymmetric septa is delayed, similar to the reported spoIIE null phenotype. Our data indicate that metal binding is not just required for the phosphatase activity of SpoIIE, but also for its interaction with FtsZ.

Methods

Plasmids and strains

pMalC2x (New England Biolabs) was used to clone and purify strep-tagged-SpoIIE_cyt (s-SpoIIE_cyt) as an N-terminal MBP-strep-tag-SpoIIE_cyt (ms-SpoIIE_cyt) fusion protein (Fig 1A). A 1503 bps fragment coding for spoIIE_cyt was amplified by PCR from B. subtilis 168 template genomic DNA using a forward primer containing the strep-tag coding sequence (bold) (5'-AGCGCTTGGCGTCACCCGCAGTTCGGTGGTCCTCAATCTATTACGAGGAAAGTGG)[15] and a reverse primer containing a BamHI site (underlined) (5'-GCGGATCCCATATATTCCCATCTTCGCCAGAAG). The PCR product was digested using BamHI and ligated into pMalC2x linearized with XmnI (blunt end)/BamHI, resulting in plasmid pEK33. The construct was verified by sequencing.

B. subtilis strains are listed in Table 1. Strain 4120 was constructed using standard B. subtilis transformation methods [22].

Download:

Table 1. B. subtilis strains used in this study.

https://doi.org/10.1371/journal.pone.0174713.t001

Protein expression and purification

FtsZ was purified as described, to > 95% purity [25]. Ms-SpoIIE_cyt or MBP alone were produced in E. coli BL21-RIL cells. Freshly transformed cells were grown overnight on LB (Lysogeny Broth, Lennox) agar plates containing 100 μg/ml ampicillin and 50 μg/ml chloramphenicol. Liquid LB medium containing the same antibiotics was inoculated with a single colony from a fresh plate. An overnight culture was diluted 1:100 into fresh LB containing the same antibiotics and grown at 37°C until OD₆₀₀ = 0.7, when iso-propyl-β-D-thiogalactopyranoside (IPTG) was added to 1 mM to produce the fusion proteins, and growth was continued at 37°C for 3 hours, after which cells were washed once with Tris-buffered Saline (TBS, 50 mM Tris/HCl, pH 7.6; 150 mM NaCl) and harvested by centrifugation. Cell pellets were flash frozen and stored at -20°C. For purification, cells were resuspended in buffer A (50 mM Tris/HCl pH = 7.5, 300 mM KCl, 0.5 mM DTT) supplemented with 0.1% Triton X-100 and disrupted by sonication. The cell lysate was clarified by centrifugation at 20,000 x g for 20 min and the supernatant was applied onto amylose resin (5 ml column volume) previously equilibrated with buffer. The resin was washed with the same buffer without Triton X-100 and the protein was eluted with 50 mM Tris/ HCl pH = 7.5, 300 mM KCl, 0.5 mM DTT and 10 mM maltose. All proteins were concentrated using Amicon Ultra-15 Centrifugal Filter Units (Merck Millipore). Protein concentrations were measured and absorption spectra were taken using a NanoDrop ND-1000 Spectrophotometer (ISOGEN Lifescience), and the protein was stored at -80°C. The extinction coefficient for ms-SpoIIE_cyt (Ex = 107720 M^-1cm^-1) was calculated using the ExPASy ProtParam tool [26]. Ms-SpoIIE_cyt was purified to > 95% purity based on SDS-PAGE analysis (not shown), however the protein was quite labile resulting in some degradation during incubations (e.g. Fig 1B).

To obtain s-SpoIIE_cyt, the protein solution was mixed with an equal volume of 50 mM Hepes/ NaOH pH = 7.5, 1M KCl, 0.5mM DTT, 1mM EDTA and 1% Triton X-100 to obtain final concentrations of 650 mM KCl and 0.5% Triton X-100. The MBP tag was cleaved overnight at 4°C using Factor Xa protease (New England Biolabs). Factor Xa was deactivated using Dansyl-glu-gly-arg-chloromethyl ketone and the protein mixture was applied onto HiLoad Superdex 16/600 gel filtration column and eluted with 50 mM Hepes/ NaOH, pH = 7.5, 650 mM KCl, 0.5 mM DTT, 1 mM EDTA and 0.5% Triton X-100.

ICP-OES measurement

Purified ms-SpoIIE_cyt was lyophilized and analysed for the presence of calcium, iron, magnesium, manganese and zinc using inductively-coupled plasma optical emission spectroscopy on an Optima 7000DV ICP-OES (PerkinElmer) apparatus. The measurements were performed in duplicate using protein obtained during two independent purifications.

Light scattering

The effects of various cations on the oligomerization of s-SpoIIE_cyt were monitored by 90° light scattering using an AMINCO-Bowman Series 2 fluorescence spectrometer. s-SpoIIE_cyt or MBP (1.5 μM) were incubated in 50 mM MES/NaOH pH = 6.5, 300 mM KCl. After 60 seconds of incubation various chloride salts of divalent cations (Ca²⁺, Mg²⁺, Mn²⁺, Zn²⁺, Fe²⁺, Cu²⁺, Co²⁺, Ni²⁺) were added to the solution (10 mM final concentration) and the light scattering signal was monitored for 1 hour.

EDTA mediated reversal of s-SpoIIE_cyt oligomerization was performed in a larger volume cuvette (1 ml) to allow stirring, and measurements were taken using a QuantaMaster^™ spectrofluorometer controlled by the FelixGX program (Photon Technology International, Inc.). MnCl₂ (10 mM final concentration) was added to the sample after 3.5 min and EDTA (20 mM final concentration) was added after 10 minutes of incubation. As a dilution control, an equal volume of H₂O was added to a duplicate sample. The light scattering signal of protein without Mn²⁺ was measured as blank.

The effect of s-SpoIIE_cyt (1.5 μM) on the assembly of FtsZ (10 μM) was studied in 50 mM Tris/HCl, pH = 7.5, 300 mM KCl, 10 mM MgCl₂. After 90 sec of measurement GTP or GDP (2 mM final concentration) was added to the sample. Samples without s-SpoIIE_cyt contained an equal volume of storage buffer. As controls, measurements were taken of strep-SpoIIE_cyt and/or FtsZ in the presence or absence of nucleotides. All experiments were done at 30°C.

Oligomerization of fluorescent ms-SpoIIE_cyt

To study the oligomerization of ms-SpoIIE_cyt in the presence and absence of Mn²⁺, the fluorescence spectra of ms-SpoIIEcyt-Cy5 were acquired in the presence of Mn²⁺ or EDTA. ms-SpoIIE_cyt was purified from lysates by binding to an amylose resin as described above, with the inclusion of an on-column Cy5 labeling step. After washing with buffer A, the resin with bound ms-SpoIIE_cyt was mixed with fluorescent label Cy5 (GE Healthcare) and incubated for 1 hour at 4°C. Excess label was washed away using the same buffer and labeled protein was eluted with buffer A supplemented with 10 mM maltose.

Equal volumes of ms-SpoIIE_cyt-Cy5 were titrated to a buffer containing 50 mM Tris/HCl, 300 mM KCl, 1 mM EDTA with or without 10 mM MnCl₂, at 30°C. Each titration step increased the total protein concentration with 0.23 μM. Immediately after each addition of ms-SpoIIE_cyt, a fluorescence spectrum (640–685 nm, excitation 633 nm) was recorded in a QuantaMaster^™ spectrofluorometer controlled by the FelixGX program (Photon Technology International, Inc.). Oligomerization was monitored by Cy5 self-quenching and the titration was stopped when fluorescence no longer increased upon the addition of protein.

Sedimentation assay

To study metal dependent sedimentation of ms-SpoIIE_cyt, the protein (10 μM) was incubated in a total volume of 100 μl of buffer (50 mM MES/ NaOH, pH = 6.5, 50 mM KCl) supplemented with 1 mM EDTA. After 20 min, a 30 μl aliquot was collected and the remaining 70 μl was supplemented with 5 mM MnCl₂ and incubated for another 30 min. Another 30 μl aliquot was collected and the rest of the sample was supplemented with 10 mM EDTA and incubated for another 40 min before taking the final aliquot. All aliquots were spun down, immediately after collection, at 186,000 x g and the supernatants and pellets were separated for analysis by SDS-PAGE.

Electron microscopy

To visualize ms-SpoIIE_cyt using Transmission Electron Microscopy (TEM), 10 μM ms-SpoIIE_cyt was prepared in 50 mM Hepes/ NaOH, pH = 7.5, 50 mM KCl.

To visualize FtsZ in the presence or absence of s-SpoIIE_cyt, 10 μM FtsZ with or without 1.5 μM s-SpoIIE_cyt was prepared in polymerization buffer: 50 mM Tris/ HCl, pH = 7.5, 300 mM KCl supplemented with 1 mM EDTA or 10 mM MgCl₂ or 10 mM MnCl₂. After 5 min of incubation at 30°C, 1 mM GTP or 1 mM GDP was added to the mixture. Additionally, 1.5 μM s-SpoIIE_cyt was prepared as above in the presence of 10 mM MnCl₂. 2 μl of each sample was collected after 30 min and applied onto glow discharged carbon grids prepared as described [25]. The grids were examined in a Philips CM120 electron microscope equipped with a LaB₆ filament operating at 120 kV. Images were recorded with a Gatan 4000 SP 4 K slow-scan CCD camera at magnifications 35,000x (for FtsZ ± s-SpoIIE_cyt) or 45,500x (for ms-SpoIIE_cyt structures alone).

Fluorescence microscopy

Overnight culture of B. subtilis strain 4055 (P_hyperspac -ftsZ-eyfp) [23] or 4120 (P_hyperspac -ftsZ-eyfp, P_xyl-kinA) grown in CH medium [27] was diluted into fresh CH to an OD of 0.1. Cells were grown at 37°C until OD of 0.7. At this point, 2 samples of 5 ml were taken and cells were collected and washed 2 times with the same volume of CH with (spo+) or without (spo-) manganese. After the washing steps, spo+ and spo- cells were resuspended in 100 μl of CH with and without manganese, respectively. Sporulation medium [28](with or without manganese) was added up to the volume of 5 ml in the presence of 0.02 mM of IPTG to allow low level expression of ftsZ-eyfp. In the case of strain 4120, 0.5% (w/v) Xylose was also added to the sporulation medium to overproduce KinA. Cells were allowed to sporulate at 37°C by continuing the incubation. Every hour, a 500 μl sample was taken and cells were harvested and resuspended in 20–50 μl of PBS before being mounted on an agarose pad prior to microscopy. FtsZ-eYFP was visualized as described in [23] and cells were scored according to their Z-ring localization.

Promoter-reporter fusion monitoring

Strain 168 (control), IDJ006 (P_spo0A-gfp) and IDJ007 (P_spoIIA-gfp) were grown and induced for sporulation exactly as described above. Upon resuspension in sporulation medium with or without manganese, the cells were transferred to a 96 well plate, 150 μL of culture per well. The plate was incubated in a Biotek Synergy Mx Microplate reader and cells were allowed to sporulate by incubation at 37°C with continuous shaking. Growth and GFP production were monitored every 10 min for 8 hours by measuring absorbance (at 600 nm) and fluorescence (excitation 485 nm; emission 528 nm.; both 20 nm bandpass). Promoter activity was calculated as the ratio of fluorescence over absorbance (to correct for cell density). Two biological replicates were tested, each in triplicate.

GTPase assay

Real-time coupled GTP hydrolysis assays were performed as described in [29, 30]. The reaction mixture contained 20 U/ml pyruvate kinase/lactate dehydrogenase mixture (Sigma Aldrich), 2 mM phospho(enol)pyruvate (PEP, Sigma Aldrich), 1 mM NADH (Sigma Aldrich), 10 μM FtsZ and no or 1.5 μM s-SpoIIE_cyt in polymerization buffer: 50 mM Tris/HCl, pH = 7.5, 300 mM KCl. The reaction was started after 2 min of incubation at 30°C with 1 mM GTP and 10 mM MgCl₂ mixture in the same polymerization buffer, in order to avoid oligomerization of s-SpoIIE_cyt before polymerization of FtsZ. The reaction was followed for 60 min at 30°C.

Results

Metal binding enhances SpoIIE oligomerization

A 501 residue fragment of SpoIIE containing domains II and III (amino acids 326–827) was N-terminally fused to maltose binding protein (MBP) via a short strep-tag (Fig 1A). The ms-SpoIIE_cyt protein was purified with a high yield (~ 40 mg/1L culture). The absorption spectrum of purified ms-SpoIIE_cyt showed a broad peak in the 420 nm region (S1A Fig), similar to those of iron/manganese-protein complexes [31], suggesting that ms-SpoIIE_cyt was purified in a metal bound form. Domain III of SpoIIE belongs to the Mn²⁺- dependent phosphatase 2C family of phosphatases and is capable of binding one Mn²⁺ ion when the protein is crystallized in the presence of excess MnCl₂ [19]. Ms-SpoIIE_cyt was lyophilized and bound metals were analyzed by inductively-coupled plasma optical emission spectroscopy, which revealed that ms-SpoIIE_cyt copurifies with iron bound in a metal/protein ratio close to 2:1 (Table 2). The analysis also revealed small amounts of calcium and magnesium bound to the protein but manganese levels were below the detection limit (Table 2), even when the growth medium was supplemented with 0.5 mM MnCl₂ (not shown). This is in agreement with a previous study in which bound Mn²⁺ could not be detected by atomic absorption spectroscopy or size exclusion chromatography after purification of domain III [19].

Download:

Table 2. Metals copurifying with ms-SpoIIE_cyt.

Metals associated with lyophilized ms-SpoIIE_cyt were analyzed by ICP-OES. The mean and standard deviation from two independent determinations are shown.

https://doi.org/10.1371/journal.pone.0174713.t002

It was possible to replace iron with manganese by incubation of the protein with EDTA followed by incubation with excess of MnCl₂. After incubation with EDTA, the absorption peak at 420 nm disappeared (S1B Fig). The absorption peak re-appeared when the protein was incubated with excess MnCl₂ (S1C Fig). Domain II (amino acids 321–567, Fig 1A) is involved in the oligomerization of SpoIIE [21]. To determine whether metal binding influences SpoIIE oligomerization, we repeated the metal exchange experiment with EDTA and MnCl₂ and used high speed centrifugation to separate higher order oligomers from soluble protein. After incubation with EDTA, ms-SpoIIE_cyt was found in the supernatant (Fig 1B). Subsequent incubation with MnCl₂ resulted in sedimentation of a large fraction of the protein, which upon resuspension in the presence of EDTA returned to a soluble form (Fig 1B). This shows that ms-SpoIIE_cyt is capable of metal-dependent oligomerization. Oligomerization is reversible upon EDTA incubation indicating that the sedimentation is not the result of aspecific protein aggregation. Purified protein, when examined by EM, also showed larger structures suggestive of protein oligomers, which were not detected after incubation of the protein with EDTA (Fig 1C).

SpoIIE is also able to form small oligomers (up to 300 kDa as determined by gel filtration chromatography) in the absence of added metal ions [21], however these oligomers cannot be observed in sedimentation and light scattering (below) assays. To test whether the presence of metals influences the formation of small oligomers of SpoIIE, ms-SpoIIE_cyt was labeled with the fluorescent dye Cy5. Cy5 self-quenching has been used to detect oligomerization/clustering of proteins, such as v-SNAREs [32]. Cy5-labeled ms-SpoIIE_cyt was titrated into a buffer supplemented with either EDTA or MnCl₂, and the increase in fluorescence signal was followed until the signal ceased to increase (Fig 1D and 1E). The quantum yield of ms-SpoIIE_cyt-Cy5 was lower in the presence of metal compared to the samples with EDTA (note difference in scale between 1D, E), possibly due to binding of the protein to metal ions or formation of dimers. However, the goal was not to compare the absolute intensities of the spectra between the two experiments but to find the concentration at which fluorescence did not increase as a result of self-quenching which we interpret to be due to the formation of small oligomers of ms-SpoIIE_cyt-Cy5. The stop in signal increase occured at a lower protein concentration (1.4 μM) when ms-SpoIIE_cyt-Cy5 was incubated with Mn²⁺ than when ms-SpoIIE_cyt-Cy5 was incubated with EDTA (2.1 μM). Although these experiments do not reveal the size of the oligomers, nor the absolute critical concentration for oligomerization, these results do suggest that the concentration at which small ms-SpoIIE_cyt oligomers start to form is lowered in the presence of metals.

To study the influence of metal ions on SpoIIE_cyt oligomerization in more detail, we removed the MBP-tag from the fusion protein via proteolytic cleavage resulting in s-SpoIIE_cyt which only contains a short 10 amino acid N-terminal strep-tag. Oligomerization of s-SpoIIE_cyt in the presence of its cofactor Mn²⁺ and other divalent cations was followed by light scattering. All divalent cations induced the oligomerization of s-SpoIIE_cyt (Fig 2A), whereas buffer had no effect (S2 Fig). Fe²⁺ could not be tested as Fe²⁺ is oxidized very easily in solution which made the analysis in the presence of Fe²⁺ impossible even when reducing agents like DTT or ascorbate were added (not shown). The maximum light scattering signal obtained in the presence of different metals reflected the preferential binding of metal ions by proteins described by the Irving-Williams series (Mn(II) < Fe(II) < Co(II) < Ni(II) < Cu(II) > Zn(II) [33]), and is in line with the observation that the metal-binding preferences of metalloproteins most often do not match the metal requirement of the protein [34]. Thus, it is tempting to speculate that the observed oligomerization is the result of the affinity of SpoIIE for the metals tested. An alternative explanation that would fit these results is that the different metals affect the oligomerization of SpoIIE differently. In a control experiment, incubation of MBP with metals did not result in an increase in light scattering (Fig 2B). As in the sedimentation experiment, the metal induced oligomerization of s-SpoIIE_cyt could be (largely) reversed by the addition of EDTA (Fig 2C).

Download:

Fig 2. Binding to divalent cations reversibly enhances oligomerization of s-SpoIIE_cyt.

(A, B) Light scattering measurement of 1,5 μM s-SpoIIE_cyt (A) and MBP (B) in the presence of 10 mM of divalent cations added after 60 sec. (C) Light scattering signal of s-SpoIIE_cyt, with 10 mM Mn²⁺ added after 60 sec and 20 mM EDTA or H₂O (control) added after 600 sec.

https://doi.org/10.1371/journal.pone.0174713.g002

The absence of manganese delays polar Z-ring formation in vivo

The dependence of the sporulation process on manganese is well known, but has so far not been linked to efficient formation of the sporulation septum. The best known role of manganese is its requirement as a cofactor in the phosphatase activity of SpoIIE [13]. Manganese could also influence the sporulation phosphorelay as Mn²⁺ has been reported to upregulate Spo0A phosphorylation through KinD [35], and manganese could function as a metal cofactor of Spo0F which is a crucial component of the phosphorelay [36, 37]. To test whether the role of SpoIIE in polar septation, which precedes its role as a phosphatase, is also metal dependent, we studied FtsZ-eYFP localization in sporulating B. subtilis cells in the presence and absence of manganese. In the absence of manganese, relocation of the Z-ring from mid-cell to the cell poles is delayed (compared to samples supplemented with Mn²⁺). We noticed that in the absence of Mn²⁺ cells contain more mid-cell rings and significantly less polar rings compared to cells in sporulation medium supplemented with Mn²⁺ (Fig 3). It is clear that asymmetric septum formation is affected in the absence of manganese. To test whether the sporulation phosphorelay is affected in the absence of manganese, we investigated the activity of the spo0A and spoIIA promoters in cells sporulating in the presence and absence of manganese (S3 Fig). This showed that P_spo0A activity is not changed, which is interesting as Spo0A drives the relocalization of FtsZ to the poles [38]. On the other hand, P_spoIIA activity, the outcome of the phosphorelay, is delayed in the absence of manganese (S3 Fig).

Download:

Fig 3. The absence of Mn²⁺ from the sporulation medium delays asymmetric Z-ring formation.

Pie-chart representation of sporulating B. subtilis cells in the presence (+) and absence (-) of Mn²⁺. Four different types of cell (representative images in the legend) were scored: cells without any Z-ring in the cell (no ring), cells with a Z-ring in the middle of the rod (mid-cell ring), cells with two rings assembled at the cell poles (two polar rings) and cells with only one polar ring (polar ring). Non-sporulating cells are marked in blue shades, while sporulating cells are marked in orange shades. Each pie chart is the result of two independent classification experiments in which at least 290 cells were classified per condition. Actual percentages and standard deviations are included in S1 Table.

https://doi.org/10.1371/journal.pone.0174713.g003

To exclude, as much as possible, the possibility that the delay in the phosphorelay is the principal cause for the delay in polar septation in the absence of Mn²⁺, we repeated this experiment in a strain that overproduces KinA. KinA overproduction artificially charges the phosphorelay both in sporulating and even in exponentially growing cells [24]. To prevent overcharging the phosphorelay during growth, kinA was only induced after resuspension in sporulation medium. KinA overproduction resulted in faster sporulation, and therefore cells were analysed after 60, 120 and 180 mins. As above, the absence of Mn²⁺ resulted in more cells with mid-cell rings and less cells with polar rings after 60 mins (S4 Fig, S2 Table). After 120 mins, midcell rings had completely disappeared and the number of cells with polar rings was significantly lower in the absence of Mn²⁺ (S4 Fig, S2 Table). The total amount of cells with polar rings was also decreased compared to the initial experiment as polar FtsZ rings disassemble once the polar septum is formed, which occurs very fast under these conditions.

The delay and decrease in the formation of asymmetric Z-rings in the absence of manganese is similar to what is observed in spoIIE null mutants [9, 10]. Although this delay could be a secondary effect caused by a delay in the phosphorelay, polar septation is also reduced in the absence of manganese when the phosphorelay is artificially charged (S4 Fig). Combined, these results suggest that the role of SpoIIE in relocating FtsZ to the cell pole is affected in the absence of manganese.

FtsZ polymers are stabilized by SpoIIE

FtsZ and SpoIIE are known to interact [21]. To study the effect of SpoIIE on FtsZ in more detail we analysed the dynamics of FtsZ polymerization in the presence of s-SpoIIE_cyt. In control experiments, the presence of Mn²⁺ in the polymerization buffer resulted in FtsZ polymerization followed by irreversible bundling (S5A, S5C and S5F Fig) which caused FtsZ to come out of solution. As s-SpoIIE_cyt also oligomerizes with Mg²⁺ and this metal allows dynamic polymerization and depolymerization of FtsZ we chose to only include Mg²⁺ in the polymerization buffer. As expected, polymerization of FtsZ alone was dynamic and GTP dependent, although the signal is barely visible in the settings used in this experiment (Fig 4A, trace FtsZ/GTP, see also S5A Fig). S-SpoIIE_cyt alone in the polymerization buffer with GTP resulted in oligomerization as seen above (Fig 4A, trace s-SpoIIE_cyt/GTP). However, when FtsZ and s-SpoIIE_cyt were both present, a strong signal increase could be observed which was more than the individual signals combined, suggesting that both proteins co-polymerize (Fig 4A). The increase in signal was independent of the nucleotide added although GTP caused the increase to occur after a shorter lag phase and to a higher signal over the 1 hr timecourse of the experiment. This result suggests that s-SpoIIE_cyt and FtsZ interact to form very stable polymers, perhaps bundles. Samples were taken after 30 min and examined by EM. Samples containing FtsZ alone did not show polymers as these polymers would have disassembled at this 30 min timepoint (Fig 4B, see also S5A and S5E Fig)—although our FtsZ was clearly capable of forming polymeric structures that were stable over 30 min when formed in the presence of EDTA, which blocks GTP hydrolysis and thus polymer disassembly (see S5D Fig). To our surprise, the samples containing s-SpoIIE_cyt and FtsZ did not contain bundles and even individual polymers were difficult to detect (Fig 4B), although the FtsZ concentrations used in this experiment were similar to previous experiments that easily identified FtsZ bundling by ZapA [39]. The structures observed in samples containing s-SpoIIE_cyt and Mn²⁺ were not as large as the ones observed with ms-SpoIIE_cyt and Fe²⁺ (Fig 1C), however this experiment is performed at a lower protein concentration, in a different buffer system, and the protein s-SpoIIE_cyt itself is smaller as it lacks the MBP-fusion tag (370 aa). Thus, these structures cannot be directly compared.

Download:

Fig 4. s-SpoIIE_cyt interacts directly with FtsZ.

A) Light scattering signals of FtsZ (FtsZ/GTP) s-SpoIIE_cyt (s-SpoIIEcyt/GTP) or FtsZ and s-SpoIIEcyt (FtsZ/GTP/s-SpoIIEcyt) in the presence of GTP, or FtsZ and s-SpoIIEcyt in the presence of GDP(FtsZ/GDP/s-SpoIIEcyt). B) Electron micrographs of a similar experiment as shown in A), samples were taken after 30 min incubation and placed on EM grids. Scale bar, 100 nm.

https://doi.org/10.1371/journal.pone.0174713.g004

Stabilization of FtsZ polymers is concomitant with a reduction in FtsZ GTPase activity, as previously shown for ZapA bundling [40]. When FtsZ GTPase was monitored in the presence of s-SpoIIE_cyt under similar conditions, a strong reduction in GTPase activity was observed, from 2.22 ± 0.22 GTP/min/FtsZ without s-SpoIIE_cyt to 0.16 ± 0.03 GTP/min/FtsZ in the presence of s-SpoIIE_cyt. This is in agreement with stabilization of FtsZ polymers by s-SpoIIE_cyt.

Discussion

SpoIIE is a bifunctional protein involved in asymmetric septum formation and activation of the forespore compartment-specific transcription factor σ^F [5, 13]. In this short paper we investigate the role of a metal cofactor in both functions of SpoIIE. We purified the entire cytoplasmic part of the SpoIIE protein, which consists of two domains that are involved in oligomerization and interaction with FtsZ (domain II) [21] and in dephosphorylation of SpoIIAA-P (domain III) [19]. Isolated domain III is sufficient to dephosphorylate SpoIIAA in the presence of the cofactor Mn²⁺ [19]. In the crystal structure of the phosphatase domain of SpoIIE, only a single manganese ion was found at low occupancy in the active site. This ion could only be detected in the structure after growing crystals in excess MnCl₂, but not by other methods [19]. The presence of only one Mn²⁺ ion in the structure represented a fundamental difference between SpoIIE and the other type PP2C phosphatases, eg. human PP2Cα phosphatase which has two metal ions bound at the active site [19]. Our analysis revealed that ms-SpoIIE_cyt copurifies with two bound metal ions and that metal binding is involved in the reversible oligomerization of SpoIIE_cyt. The presence of two metal ions is in agreement with the predictions for PP2C phosphatases and the presence of a second metal binding pocket predicted from the primary structure of SpoIIE [19]. There are various explanations for the difference in the amount of metal ions found in this study compared to the previous work [19]. Domain III was crystallized in Na-citrate which, due to its chelating properties, may have removed a less-tight bound metal from domain III. It is also possible that domain II of SpoIIE is necessary for the stable binding of a second metal by domain III, or that domain II itself is involved in the binding of the second metal (although the latter is not very likely). After removal of bound iron, metal dependent oligomerization followed the metal binding preference described in the Irving-Williams series [33]. The question remains why SpoIIE purifies with Fe²⁺ bound rather than Mn²⁺ as these metals are next to each other and the concentration of both ions in the E. coli cytoplasm is comparable, in the range of 10⁻⁶ to 10⁻⁷ M [34]. It is not uncommon for proteins that have Mn²⁺ as cofactor to copurify with a different metal bound [34], eg. the B. subtilis nucleotide pyrophosphohydrolase YpgQ was recently purified and crystallized with bound Ni²⁺ although it requires Mn²⁺ for its activity [41]. It is likely that the delivery pathway for Mn²⁺ to SpoIIE requires an, as yet unknown, chaperone [34].

SpoIIE oligomerization was also induced by other divalent cations, which is not surprising as the binding specificity of enzymes for metal ions is quite low [42]. Our data indicate that domains II and III are not fully independent and may influence each other’s activity, which is in agreement with the previous in vivo findings, where mutations in either of the domains had an influence on the activity of the other domain [7, 15].

Manganese is important for the oligomerization and activity of SpoIIE but it has been known for a long time that it is also necessary for sporulation of B. subtilis. Mn²⁺ is an essential cofactor for phosphoglycerate phosphomutase, and in the absence of Mn²⁺ and only when cells are grown on specific carbon sources, the accumulation of 3-phosphoglycerate affects both growth and sporulation [43]. To avoid 3-phosphoglycerate accumulation we used growth media in which such accumulation does not occur, and only removed Mn²⁺ at the start of sporulation. Mn²⁺ is a cofactor for many enzymes involved in sporulation but it is not understood at which stage sporulation is blocked in the absence of Mn²⁺. Because of the role of SpoIIE in asymmetric septation, we decided to study localization of FtsZ-eYFP during sporulation in the presence and absence of Mn²⁺. We noticed that in the absence of manganese, formation of the asymmetric septum is delayed and less polar Z-rings are formed compared to cells sporulating in the presence of Mn²⁺. Only two proteins are known to be involved in the switch from medial to polar Z-ring, the sporulation-specific transcriptional factor Spo0A and SpoIIE. A mutation in the spo0A gene completely blocks sporulation before the formation of asymmetric septa (at stage 0). Thus, it is unlikely that the lack of manganese influences Spo0A as it would completely block relocation of the Z-ring [6]. Also, the activity of the P_spo0A promoter is unaffected by the absence of Mn²⁺ (S3 Fig). Localization of FtsZ in the absence of Mn²⁺ during sporulation resembles the situation in spoIIE null mutant cells. It has been shown previously that deletion of the spoIIE gene affects formation of asymmetric Z-rings but does not prevent it [9, 10]. So the delay observed in our experiment could be either because SpoIIE requires Mn²⁺ for efficient FtsZ ring positioning, or because of a secondary effect as Mn²⁺ also influences downstream activation of the sporulation phoshorelay (S3 Fig) [35–37]. We hypercharged the phosphorelay by overproducing KinA [24] and found that overall, polar septation was faster, but that there still was a delay in polar septation in the absence of Mn²⁺. Combined, our results strongly suggest that the absence of manganese influences relocation of the Z-ring in a SpoIIE-dependent manner. The observation that FtsZ polymers are stabilized, and display reduced GTPase activity, in the presence of SpoIIE is in line with our suggestion that metal-dependent SpoIIE oligomerization stabilizes FtsZ filaments in such a way that they can spiral out to form the asymmetric septum.

Supporting information

S1 Table. Percentages represented in the piechart in Fig 3.

The table shows the average and standard deviation (avg ±stdv) per class scored for two independent experiments. In each single experiment at least 290 cells were scored per condition.

https://doi.org/10.1371/journal.pone.0174713.s001

(PDF)

S2 Table. Percentages represented in the piechart in S4 Fig.

The table shows the average and standard deviation (avg ±stdv) of two independent experiments. In each single experiment at least 200 cells were scored per condition.

https://doi.org/10.1371/journal.pone.0174713.s002

(PDF)

S1 Fig. Absorption spectra of purified ms-SpoIIE_cyt (A), the same material to which 2 mM EDTA was added, after incubation for 24 hours (B), and the same material after MnCl₂ was added to 4 mM, after incubation for 16 hrs (C).

Additions resulted in slight dilution of the protein sample, from 12.1 mg/mL (A) to 11.3 mg/mL (B) to 10.3 mg/mL (C). Spectra were taken using a Nanodrop ND-1000 from 220 to 750 nm and the absorption was depicted as absorption calculated for a optical pathlength of 10 mm.

https://doi.org/10.1371/journal.pone.0174713.s003

(PDF)

S2 Fig. Light scattering measurement of 1,5 μM s-SpoIIE_cyt in the presence of 10 mM MnCl₂ or buffer (control) added after 60 sec.

https://doi.org/10.1371/journal.pone.0174713.s004

(PDF)

S3 Fig. The activation of the sporulation phosphorelay is delayed in the absence of Mn²⁺.

Strains 168 (wt, square symbols, as reference), IDJ006 (P_spo0A-gfp, triangles) and IDJ007 (P_spoIIA-gfp, circles) were sporulated in the presence (closed symbols, +) and absence (open symbols, -) of Mn²⁺ and the promoter activity was monitored by following GFP fluorescence corrected for cell density. The increase of Pspo0A driven GFP production starts after roughly 60 minutes and is independent of Mn²⁺ (panel A), whereas P_spoIIA driven GFP production is clearly delayed in the absence of Mn²⁺ (panel B). Please note the difference in scale between panels A and B, reflective of the stronger promoter activity of P_spoIIA. Wild type cells (same data plotted in panels A and B) were included as a reference for background fluorescence. The average and standard deviations are plotted for triplicate measurements of two biological duplicates (6 measurements each point).

https://doi.org/10.1371/journal.pone.0174713.s005

(PDF)

S4 Fig. The absence of Mn²⁺ from the sporulation medium delays asymmetric Z-ring formation in cells with a hypercharged phosphorelay.

Pie-chart representation of sporulating B. subtilis cells in the presence (plus) and absence (minus) of Mn²⁺. Cells were scored as described for Fig 3. Non-sporulating cells are marked in blue shades, while sporulating cells are marked in orange shades. Each pie chart is the result of two independent classification experiments in which at least 200 cells were classified per experiment. Actual percentages and standard deviations are included in S2 Table.

https://doi.org/10.1371/journal.pone.0174713.s006

(PDF)

S5 Fig.

(A) Light scattering signal of FtsZ in the presence of 2 mM GTP and 10 mM of divalent cations (Mn²⁺, Mg²⁺) or 1 mM EDTA. (B) continuation of the signal from the sample with Mn²⁺. (C, D, E) Electron microscopy of FtsZ polymers assembled in the presence of 2 mM GTP and either Mn²⁺ (C), EDTA (D) or Mg²⁺ (E) after 30 min of incubation. (F) Representative picture of FtsZ polymers assembled in the presence of 2 mM GTP and Mn²⁺ after 90 min of incubation. Scale bar 50 nm.

https://doi.org/10.1371/journal.pone.0174713.s007

(PDF)

Acknowledgments

We would like to thank Hans van der Velde for help with the ICP-OES measurements and Hanna Dudek for advice. We thank Danae Morales Angeles for help with constructing strain 4120.

Work in the Scheffers lab is supported by a VIDI fellowship (864.09.010) from the Netherlands Organisation for Scientific Research (NWO) and the bilateral research programme “Biobased Economy” from NWO (729.004.005). Anabela de Sousa Borges was supported by a doctoral grant (SFRH/BD/78061/2011) from POPH/FSE and FCT (Fundação para a Ciência e Tecnologia) from Portugal.

Author Contributions

Conceptualization: EC DJS.
Formal analysis: EC ASB MK DJS.
Funding acquisition: ASB DJS.
Investigation: EC ASB MK DJS.
Methodology: EC ASB MK DJS.
Project administration: DJS.
Supervision: DJS.
Validation: EC ASB MK DJS.
Visualization: EC ASB MK DJS.
Writing – original draft: EC DJS.
Writing – review & editing: EC ASB MK DJS.

References

1. Errington J. Regulation of endospore formation in Bacillus subtilis. Nat Rev Microbiol. 2003;1(2):117–26. pmid:15035041
- View Article
- PubMed/NCBI
- Google Scholar
2. Tan IS, Ramamurthi KS. Spore formation in Bacillus subtilis. Environ Microbiol Rep. 2014;6(3):212–25. pmid:24983526
- View Article
- PubMed/NCBI
- Google Scholar
3. Eichenberger P. Genomics and Cellular Biology of Endospore Formation. In: Graumann PL, editor. Bacillus Cellular and Molecular Biology. 2 ed: Caister Academic Press; 2012. p. 319–50.
4. Ben-Yehuda S, Losick R. Asymmetric cell division in B. subtilis involves a spiral-like intermediate of the cytokinetic protein FtsZ. Cell. 2002;109:257–66. pmid:12007411
- View Article
- PubMed/NCBI
- Google Scholar
5. Feucht A, Magnin T, Yudkin MD, Errington J. Bifunctional protein required for asymmetric cell division and cell-specific transcription in Bacillus subtilis. Genes Dev. 1996;10:794–803. pmid:8846916
- View Article
- PubMed/NCBI
- Google Scholar
6. Khvorova A, Zhang L, Higgins ML, Piggot PJ. The spoIIE locus is involved in the Spo0A-dependent switch in the location of FtsZ rings in Bacillus subtilis. J Bacteriol. 1998;180:1256–60. pmid:9495766
- View Article
- PubMed/NCBI
- Google Scholar
7. Carniol K, Ben-Yehuda S, King N, Losick R. Genetic dissection of the sporulation protein SpoIIE and its role in asymmetric division in Bacillus subtilis. J Bacteriol. 2005;187(10):3511–20. pmid:15866939
- View Article
- PubMed/NCBI
- Google Scholar
8. Eswaramoorthy P, Winter PW, Wawrzusin P, York AG, Shroff H, Ramamurthi KS. Asymmetric division and differential gene expression during a bacterial developmental program requires DivIVA. PLoS genetics. 2014;10(8):e1004526. pmid:25101664
- View Article
- PubMed/NCBI
- Google Scholar
9. Barák I, Youngman P. SpoIIE mutants of Bacillus subtilis comprise two distinct phenotypic classes consistent with a dual functional role for the SpoIIE protein. J Bacteriol. 1996;178:4984–9. pmid:8759864
- View Article
- PubMed/NCBI
- Google Scholar
10. Illing N, Errington J. Genetic regulation of morphogenesis in Bacillus subtilis: roles of sE and sF in prespore engulfment. J Bacteriol. 1991;173:3159–69. pmid:1902463
- View Article
- PubMed/NCBI
- Google Scholar
11. Bradshaw N, Losick R. Asymmetric division triggers cell-specific gene expression through coupled capture and stabilization of a phosphatase. eLife. 2015;4.
- View Article
- Google Scholar
12. Arigoni F, Duncan L, Alper S, Losick R, Stragier P. SpoIIE governs the phosphorylation state of a protein regulating transcription factor sigma-F during sporulation in Bacillus subtilis. Proc Natl Acad Sci USA. 1996;93:3238–42. pmid:8622920
- View Article
- PubMed/NCBI
- Google Scholar
13. Duncan L, Alper S, Arigoni F, Losick R, Stragier P. Activation of cell-specific transciption by a serine phosphatase at the site of asymmetric division. Science. 1995;270:641–4. pmid:7570023
- View Article
- PubMed/NCBI
- Google Scholar
14. Clarkson J, Campbell ID, Yudkin MD. NMR studies of the interactions of SpoIIAA with its partner proteins that regulate sporulation in Bacillus subtilis. J Mol Biol. 2001;314(3):359–64. pmid:11846550
- View Article
- PubMed/NCBI
- Google Scholar
15. Feucht A, Abbotts L, Errington J. The cell differentiation protein SpoIIE contains a regulatory site that controls its phosphatase activity in response to asymmetric septation. Mol Microbiol. 2002;45(4):1119–30. pmid:12180929
- View Article
- PubMed/NCBI
- Google Scholar
16. Adler E, Donella-Deana A, Arigoni F, Pinna LA, Stragier P. Structural relationship between a bacterial developmental protein and eukaryotic PP2C protein phosphatases. Mol Microbiol. 1997;23:57–62. pmid:9004220
- View Article
- PubMed/NCBI
- Google Scholar
17. Barák I, Behari J, Olmedo G, Guzman P, Brown DP, Castro E, et al. Structure and function of the Bacillus SpoIIE protein and its localization to sites of sporulation septum assembly. Mol Microbiol. 1996;19:1047–60. pmid:8830262
- View Article
- PubMed/NCBI
- Google Scholar
18. Das AK, Helps NR, Cohen PT, Barford D. Crystal structure of the protein serine/threonine phosphatase 2C at 2.0 A resolution. EMBO J. 1996;15(24):6798–809. pmid:9003755
- View Article
- PubMed/NCBI
- Google Scholar
19. Levdikov VM, Blagova EV, Rawlings AE, Jameson K, Tunaley J, Hart DJ, et al. Structure of the phosphatase domain of the cell fate determinant SpoIIE from Bacillus subtilis. J Mol Biol. 2012;415(2):343–58. pmid:22115775
- View Article
- PubMed/NCBI
- Google Scholar
20. Rawlings AE, Levdikov VM, Blagova E, Colledge VL, Mas PJ, Tunaley J, et al. Expression of soluble, active fragments of the morphogenetic protein SpoIIE from Bacillus subtilis using a library-based construct screen. Protein Eng Des Sel. 2010;23(11):817–25. pmid:20817757
- View Article
- PubMed/NCBI
- Google Scholar
21. Lucet I, Feucht A, Yudkin MD, Errington J. Direct interaction between the cell division protein FtsZ and the cell differentiation protein SpoIIE. EMBO J. 2000;19(7):1467–75. pmid:10747015
- View Article
- PubMed/NCBI
- Google Scholar
22. Anagnostopoulos C, Spizizen J. Requirements for transformation in Bacillus subtilis. J Bacteriol. 1961;81:741–6. pmid:16561900
- View Article
- PubMed/NCBI
- Google Scholar
23. Krol E, de Sousa Borges A, da Silva I, Polaquini CR, Regasini LO, Ferreira H, et al. Antibacterial activity of alkyl gallates is a combination of direct targeting of FtsZ and permeabilization of bacterial membranes. Frontiers in microbiology. 2015;6:390. pmid:25972861
- View Article
- PubMed/NCBI
- Google Scholar
24. de Jong IG, Veening JW, Kuipers OP. Heterochronic phosphorelay gene expression as a source of heterogeneity in Bacillus subtilis spore formation. J Bacteriol. 2010;192(8):2053–67. pmid:20154131
- View Article
- PubMed/NCBI
- Google Scholar
25. Krol E, Scheffers DJ. FtsZ polymerization assays: simple protocols and considerations. Journal of visualized experiments: JoVE. 2013;(81):e50844. pmid:24300445
- View Article
- PubMed/NCBI
- Google Scholar
26. Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD, et al. Protein Identification and Analysis Tools on the ExPASy Server. In: Walker JM, editor. The Proteomics Protocols Handbook: Humana Press; 2005.
27. Sharpe ME, Hauser PM, Sharpe RG, Errington J. Bacillus subtilis cell cycle as studied by fluorescence microscopy: constancy of the cell length at initiation of DNA replication and evidence for active nucleoid partitioning. J Bacteriol. 1998;180:547–55. pmid:9457856
- View Article
- PubMed/NCBI
- Google Scholar
28. Scheffers DJ. Dynamic localization of penicillin-binding proteins during spore development in Bacillus subtilis. Microbiology. 2005;151:999–1012. pmid:15758244
- View Article
- PubMed/NCBI
- Google Scholar
29. Margalit DN, Romberg L, Mets RB, Hebert AM, Mitchison TJ, Kirschner MW, et al. Targeting cell division: small-molecule inhibitors of FtsZ GTPase perturb cytokinetic ring assembly and induce bacterial lethality. Proc Natl Acad Sci U S A. 2004;101(32):11821–6. pmid:15289600
- View Article
- PubMed/NCBI
- Google Scholar
30. Ingerman E, Nunnari J. A continuous, regenerative coupled GTPase assay for dynamin-related proteins. Methods Enzymol. 2005;404:611–9. pmid:16413304
- View Article
- PubMed/NCBI
- Google Scholar
31. Whittaker MM, Whittaker JW. Thermally triggered metal binding by recombinant Thermus thermophilus manganese superoxide dismutase, expressed as the apo-enzyme. J Biol Chem. 1999;274(49):34751–7. pmid:10574944
- View Article
- PubMed/NCBI
- Google Scholar
32. Lu X, Zhang Y, Shin YK. Supramolecular SNARE assembly precedes hemifusion in SNARE-mediated membrane fusion. Nat Struct Mol Biol. 2008;15(7):700–6. pmid:18552827
- View Article
- PubMed/NCBI
- Google Scholar
33. Irving H, Williams RJ. Order of stability of metal complexes. Nature. 1948;162:746–7.
- View Article
- Google Scholar
34. Foster AW, Osman D, Robinson NJ. Metal preferences and metallation. J Biol Chem. 2014;289(41):28095–103. pmid:25160626
- View Article
- PubMed/NCBI
- Google Scholar
35. Shemesh M, Chai Y. A combination of glycerol and manganese promotes biofilm formation in Bacillus subtilis via histidine kinase KinD signaling. J Bacteriol. 2013;195(12):2747–54. pmid:23564171
- View Article
- PubMed/NCBI
- Google Scholar
36. Mukhopadhyay D, Sen U, Zapf J, Varughese KI. Metals in the sporulation phosphorelay: manganese binding by the response regulator Spo0F. Acta Crystallogr D Biol Crystallogr. 2004;60(Pt 4):638–45. pmid:15039551
- View Article
- PubMed/NCBI
- Google Scholar
37. Kojetin DJ, Thompson RJ, Benson LM, Naylor S, Waterman J, Davies KG, et al. Structural analysis of divalent metals binding to the Bacillus subtilis response regulator Spo0F: the possibility for in vitro metalloregulation in the initiation of sporulation. Biometals. 2005;18(5):449–66. pmid:16333746
- View Article
- PubMed/NCBI
- Google Scholar
38. Levin PA, Losick R. Transcription factor Spo0A switches the localization of the cell division protein FtsZ from a medial to a bipolar pattern in Bacillus subtilis. Genes Dev. 1996;10:478–88. pmid:8600030
- View Article
- PubMed/NCBI
- Google Scholar
39. Scheffers DJ. The effect of MinC on FtsZ polymerization is pH dependent and can be counteracted by ZapA. FEBS Lett. 2008;582(17):2601–8. pmid:18588879
- View Article
- PubMed/NCBI
- Google Scholar
40. Mohammadi T, Ploeger GE, Verheul J, Comvalius AD, Martos A, Alfonso C, et al. The GTPase activity of Escherichia coli FtsZ determines the magnitude of the FtsZ polymer bundling by ZapA in vitro. Biochemistry. 2009;48(46):11056–66. pmid:19842714
- View Article
- PubMed/NCBI
- Google Scholar
41. Jeon YJ, Park SC, Song WS, Kim O-H, Oh B-C, Yoon S-i. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 2016; 195(1): 113–122. pmid:27062940
- View Article
- PubMed/NCBI
- Google Scholar
42. Dudev T, Lim C. Competition among metal ions for protein binding sites: determinants of metal ion selectivity in proteins. Chem Rev. 2014;114(1):538–56. pmid:24040963
- View Article
- PubMed/NCBI
- Google Scholar
43. Vasantha N, Freese E. The role of manganese in growth and sporulation of Bacillus subtilis. J Gen Microbiol. 1979;112(2):329–36. pmid:225409
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Errington J. Regulation of endospore formation in Bacillus subtilis. Nat Rev Microbiol. 2003;1(2):117–26. pmid:15035041
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Tan IS, Ramamurthi KS. Spore formation in Bacillus subtilis. Environ Microbiol Rep. 2014;6(3):212–25. pmid:24983526
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. Eichenberger P. Genomics and Cellular Biology of Endospore Formation. In: Graumann PL, editor. Bacillus Cellular and Molecular Biology. 2 ed: Caister Academic Press; 2012. p. 319–50.

[ref4] 4. Ben-Yehuda S, Losick R. Asymmetric cell division in B. subtilis involves a spiral-like intermediate of the cytokinetic protein FtsZ. Cell. 2002;109:257–66. pmid:12007411
View Article
PubMed/NCBI
Google Scholar

[11] View Article

[12] PubMed/NCBI

[13] Google Scholar

[ref5] 5. Feucht A, Magnin T, Yudkin MD, Errington J. Bifunctional protein required for asymmetric cell division and cell-specific transcription in Bacillus subtilis. Genes Dev. 1996;10:794–803. pmid:8846916
View Article
PubMed/NCBI
Google Scholar

[15] View Article

[16] PubMed/NCBI

[17] Google Scholar

[ref6] 6. Khvorova A, Zhang L, Higgins ML, Piggot PJ. The spoIIE locus is involved in the Spo0A-dependent switch in the location of FtsZ rings in Bacillus subtilis. J Bacteriol. 1998;180:1256–60. pmid:9495766
View Article
PubMed/NCBI
Google Scholar

[19] View Article

[20] PubMed/NCBI

[21] Google Scholar

[ref7] 7. Carniol K, Ben-Yehuda S, King N, Losick R. Genetic dissection of the sporulation protein SpoIIE and its role in asymmetric division in Bacillus subtilis. J Bacteriol. 2005;187(10):3511–20. pmid:15866939
View Article
PubMed/NCBI
Google Scholar

[23] View Article

[24] PubMed/NCBI

[25] Google Scholar

[ref8] 8. Eswaramoorthy P, Winter PW, Wawrzusin P, York AG, Shroff H, Ramamurthi KS. Asymmetric division and differential gene expression during a bacterial developmental program requires DivIVA. PLoS genetics. 2014;10(8):e1004526. pmid:25101664
View Article
PubMed/NCBI
Google Scholar

[27] View Article

[28] PubMed/NCBI

[29] Google Scholar

[ref9] 9. Barák I, Youngman P. SpoIIE mutants of Bacillus subtilis comprise two distinct phenotypic classes consistent with a dual functional role for the SpoIIE protein. J Bacteriol. 1996;178:4984–9. pmid:8759864
View Article
PubMed/NCBI
Google Scholar

[31] View Article

[32] PubMed/NCBI

[33] Google Scholar

[ref10] 10. Illing N, Errington J. Genetic regulation of morphogenesis in Bacillus subtilis: roles of sE and sF in prespore engulfment. J Bacteriol. 1991;173:3159–69. pmid:1902463
View Article
PubMed/NCBI
Google Scholar

[35] View Article

[36] PubMed/NCBI

[37] Google Scholar

[ref11] 11. Bradshaw N, Losick R. Asymmetric division triggers cell-specific gene expression through coupled capture and stabilization of a phosphatase. eLife. 2015;4.
View Article
Google Scholar

[39] View Article

[40] Google Scholar

[ref12] 12. Arigoni F, Duncan L, Alper S, Losick R, Stragier P. SpoIIE governs the phosphorylation state of a protein regulating transcription factor sigma-F during sporulation in Bacillus subtilis. Proc Natl Acad Sci USA. 1996;93:3238–42. pmid:8622920
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref13] 13. Duncan L, Alper S, Arigoni F, Losick R, Stragier P. Activation of cell-specific transciption by a serine phosphatase at the site of asymmetric division. Science. 1995;270:641–4. pmid:7570023
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref14] 14. Clarkson J, Campbell ID, Yudkin MD. NMR studies of the interactions of SpoIIAA with its partner proteins that regulate sporulation in Bacillus subtilis. J Mol Biol. 2001;314(3):359–64. pmid:11846550
View Article
PubMed/NCBI
Google Scholar

[50] View Article

[51] PubMed/NCBI

[52] Google Scholar

[ref15] 15. Feucht A, Abbotts L, Errington J. The cell differentiation protein SpoIIE contains a regulatory site that controls its phosphatase activity in response to asymmetric septation. Mol Microbiol. 2002;45(4):1119–30. pmid:12180929
View Article
PubMed/NCBI
Google Scholar

[54] View Article

[55] PubMed/NCBI

[56] Google Scholar

[ref16] 16. Adler E, Donella-Deana A, Arigoni F, Pinna LA, Stragier P. Structural relationship between a bacterial developmental protein and eukaryotic PP2C protein phosphatases. Mol Microbiol. 1997;23:57–62. pmid:9004220
View Article
PubMed/NCBI
Google Scholar

[58] View Article

[59] PubMed/NCBI

[60] Google Scholar

[ref17] 17. Barák I, Behari J, Olmedo G, Guzman P, Brown DP, Castro E, et al. Structure and function of the Bacillus SpoIIE protein and its localization to sites of sporulation septum assembly. Mol Microbiol. 1996;19:1047–60. pmid:8830262
View Article
PubMed/NCBI
Google Scholar

[62] View Article

[63] PubMed/NCBI

[64] Google Scholar

[ref18] 18. Das AK, Helps NR, Cohen PT, Barford D. Crystal structure of the protein serine/threonine phosphatase 2C at 2.0 A resolution. EMBO J. 1996;15(24):6798–809. pmid:9003755
View Article
PubMed/NCBI
Google Scholar

[66] View Article

[67] PubMed/NCBI

[68] Google Scholar

[ref19] 19. Levdikov VM, Blagova EV, Rawlings AE, Jameson K, Tunaley J, Hart DJ, et al. Structure of the phosphatase domain of the cell fate determinant SpoIIE from Bacillus subtilis. J Mol Biol. 2012;415(2):343–58. pmid:22115775
View Article
PubMed/NCBI
Google Scholar

[70] View Article

[71] PubMed/NCBI

[72] Google Scholar

[ref20] 20. Rawlings AE, Levdikov VM, Blagova E, Colledge VL, Mas PJ, Tunaley J, et al. Expression of soluble, active fragments of the morphogenetic protein SpoIIE from Bacillus subtilis using a library-based construct screen. Protein Eng Des Sel. 2010;23(11):817–25. pmid:20817757
View Article
PubMed/NCBI
Google Scholar

[74] View Article

[75] PubMed/NCBI

[76] Google Scholar

[ref21] 21. Lucet I, Feucht A, Yudkin MD, Errington J. Direct interaction between the cell division protein FtsZ and the cell differentiation protein SpoIIE. EMBO J. 2000;19(7):1467–75. pmid:10747015
View Article
PubMed/NCBI
Google Scholar

[78] View Article

[79] PubMed/NCBI

[80] Google Scholar

[ref22] 22. Anagnostopoulos C, Spizizen J. Requirements for transformation in Bacillus subtilis. J Bacteriol. 1961;81:741–6. pmid:16561900
View Article
PubMed/NCBI
Google Scholar

[82] View Article

[83] PubMed/NCBI

[84] Google Scholar

[ref23] 23. Krol E, de Sousa Borges A, da Silva I, Polaquini CR, Regasini LO, Ferreira H, et al. Antibacterial activity of alkyl gallates is a combination of direct targeting of FtsZ and permeabilization of bacterial membranes. Frontiers in microbiology. 2015;6:390. pmid:25972861
View Article
PubMed/NCBI
Google Scholar

[86] View Article

[87] PubMed/NCBI

[88] Google Scholar

[ref24] 24. de Jong IG, Veening JW, Kuipers OP. Heterochronic phosphorelay gene expression as a source of heterogeneity in Bacillus subtilis spore formation. J Bacteriol. 2010;192(8):2053–67. pmid:20154131
View Article
PubMed/NCBI
Google Scholar

[90] View Article

[91] PubMed/NCBI

[92] Google Scholar

[ref25] 25. Krol E, Scheffers DJ. FtsZ polymerization assays: simple protocols and considerations. Journal of visualized experiments: JoVE. 2013;(81):e50844. pmid:24300445
View Article
PubMed/NCBI
Google Scholar

[94] View Article

[95] PubMed/NCBI

[96] Google Scholar

[ref26] 26. Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD, et al. Protein Identification and Analysis Tools on the ExPASy Server. In: Walker JM, editor. The Proteomics Protocols Handbook: Humana Press; 2005.

[ref27] 27. Sharpe ME, Hauser PM, Sharpe RG, Errington J. Bacillus subtilis cell cycle as studied by fluorescence microscopy: constancy of the cell length at initiation of DNA replication and evidence for active nucleoid partitioning. J Bacteriol. 1998;180:547–55. pmid:9457856
View Article
PubMed/NCBI
Google Scholar

[99] View Article

[100] PubMed/NCBI

[101] Google Scholar

[ref28] 28. Scheffers DJ. Dynamic localization of penicillin-binding proteins during spore development in Bacillus subtilis. Microbiology. 2005;151:999–1012. pmid:15758244
View Article
PubMed/NCBI
Google Scholar

[103] View Article

[104] PubMed/NCBI

[105] Google Scholar

[ref29] 29. Margalit DN, Romberg L, Mets RB, Hebert AM, Mitchison TJ, Kirschner MW, et al. Targeting cell division: small-molecule inhibitors of FtsZ GTPase perturb cytokinetic ring assembly and induce bacterial lethality. Proc Natl Acad Sci U S A. 2004;101(32):11821–6. pmid:15289600
View Article
PubMed/NCBI
Google Scholar

[107] View Article

[108] PubMed/NCBI

[109] Google Scholar

[ref30] 30. Ingerman E, Nunnari J. A continuous, regenerative coupled GTPase assay for dynamin-related proteins. Methods Enzymol. 2005;404:611–9. pmid:16413304
View Article
PubMed/NCBI
Google Scholar

[111] View Article

[112] PubMed/NCBI

[113] Google Scholar

[ref31] 31. Whittaker MM, Whittaker JW. Thermally triggered metal binding by recombinant Thermus thermophilus manganese superoxide dismutase, expressed as the apo-enzyme. J Biol Chem. 1999;274(49):34751–7. pmid:10574944
View Article
PubMed/NCBI
Google Scholar

[115] View Article

[116] PubMed/NCBI

[117] Google Scholar

[ref32] 32. Lu X, Zhang Y, Shin YK. Supramolecular SNARE assembly precedes hemifusion in SNARE-mediated membrane fusion. Nat Struct Mol Biol. 2008;15(7):700–6. pmid:18552827
View Article
PubMed/NCBI
Google Scholar

[119] View Article

[120] PubMed/NCBI

[121] Google Scholar

[ref33] 33. Irving H, Williams RJ. Order of stability of metal complexes. Nature. 1948;162:746–7.
View Article
Google Scholar

[123] View Article

[124] Google Scholar

[ref34] 34. Foster AW, Osman D, Robinson NJ. Metal preferences and metallation. J Biol Chem. 2014;289(41):28095–103. pmid:25160626
View Article
PubMed/NCBI
Google Scholar

[126] View Article

[127] PubMed/NCBI

[128] Google Scholar

[ref35] 35. Shemesh M, Chai Y. A combination of glycerol and manganese promotes biofilm formation in Bacillus subtilis via histidine kinase KinD signaling. J Bacteriol. 2013;195(12):2747–54. pmid:23564171
View Article
PubMed/NCBI
Google Scholar

[130] View Article

[131] PubMed/NCBI

[132] Google Scholar

[ref36] 36. Mukhopadhyay D, Sen U, Zapf J, Varughese KI. Metals in the sporulation phosphorelay: manganese binding by the response regulator Spo0F. Acta Crystallogr D Biol Crystallogr. 2004;60(Pt 4):638–45. pmid:15039551
View Article
PubMed/NCBI
Google Scholar

[134] View Article

[135] PubMed/NCBI

[136] Google Scholar

[ref37] 37. Kojetin DJ, Thompson RJ, Benson LM, Naylor S, Waterman J, Davies KG, et al. Structural analysis of divalent metals binding to the Bacillus subtilis response regulator Spo0F: the possibility for in vitro metalloregulation in the initiation of sporulation. Biometals. 2005;18(5):449–66. pmid:16333746
View Article
PubMed/NCBI
Google Scholar

[138] View Article

[139] PubMed/NCBI

[140] Google Scholar

[ref38] 38. Levin PA, Losick R. Transcription factor Spo0A switches the localization of the cell division protein FtsZ from a medial to a bipolar pattern in Bacillus subtilis. Genes Dev. 1996;10:478–88. pmid:8600030
View Article
PubMed/NCBI
Google Scholar

[142] View Article

[143] PubMed/NCBI

[144] Google Scholar

[ref39] 39. Scheffers DJ. The effect of MinC on FtsZ polymerization is pH dependent and can be counteracted by ZapA. FEBS Lett. 2008;582(17):2601–8. pmid:18588879
View Article
PubMed/NCBI
Google Scholar

[146] View Article

[147] PubMed/NCBI

[148] Google Scholar

[ref40] 40. Mohammadi T, Ploeger GE, Verheul J, Comvalius AD, Martos A, Alfonso C, et al. The GTPase activity of Escherichia coli FtsZ determines the magnitude of the FtsZ polymer bundling by ZapA in vitro. Biochemistry. 2009;48(46):11056–66. pmid:19842714
View Article
PubMed/NCBI
Google Scholar

[150] View Article

[151] PubMed/NCBI

[152] Google Scholar

[ref41] 41. Jeon YJ, Park SC, Song WS, Kim O-H, Oh B-C, Yoon S-i. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 2016; 195(1): 113–122. pmid:27062940
View Article
PubMed/NCBI
Google Scholar

[154] View Article

[155] PubMed/NCBI

[156] Google Scholar

[ref42] 42. Dudev T, Lim C. Competition among metal ions for protein binding sites: determinants of metal ion selectivity in proteins. Chem Rev. 2014;114(1):538–56. pmid:24040963
View Article
PubMed/NCBI
Google Scholar

[158] View Article

[159] PubMed/NCBI

[160] Google Scholar

[ref43] 43. Vasantha N, Freese E. The role of manganese in growth and sporulation of Bacillus subtilis. J Gen Microbiol. 1979;112(2):329–36. pmid:225409
View Article
PubMed/NCBI
Google Scholar

[162] View Article

[163] PubMed/NCBI

[164] Google Scholar

Figures

Abstract

Introduction

Methods

Plasmids and strains

Protein expression and purification

ICP-OES measurement

Light scattering

Oligomerization of fluorescent ms-SpoIIEcyt

Sedimentation assay

Electron microscopy

Fluorescence microscopy

Promoter-reporter fusion monitoring

GTPase assay

Results

Metal binding enhances SpoIIE oligomerization

The absence of manganese delays polar Z-ring formation in vivo

FtsZ polymers are stabilized by SpoIIE

Discussion

Supporting information

S1 Table. Percentages represented in the piechart in Fig 3.

S2 Table. Percentages represented in the piechart in S4 Fig.

S1 Fig. Absorption spectra of purified ms-SpoIIEcyt (A), the same material to which 2 mM EDTA was added, after incubation for 24 hours (B), and the same material after MnCl2 was added to 4 mM, after incubation for 16 hrs (C).

S2 Fig. Light scattering measurement of 1,5 μM s-SpoIIEcyt in the presence of 10 mM MnCl2 or buffer (control) added after 60 sec.

S3 Fig. The activation of the sporulation phosphorelay is delayed in the absence of Mn2+.

S4 Fig. The absence of Mn2+ from the sporulation medium delays asymmetric Z-ring formation in cells with a hypercharged phosphorelay.

S5 Fig.

Acknowledgments

Author Contributions

References

Oligomerization of fluorescent ms-SpoIIE_cyt

S1 Fig. Absorption spectra of purified ms-SpoIIE_cyt (A), the same material to which 2 mM EDTA was added, after incubation for 24 hours (B), and the same material after MnCl₂ was added to 4 mM, after incubation for 16 hrs (C).

S2 Fig. Light scattering measurement of 1,5 μM s-SpoIIE_cyt in the presence of 10 mM MnCl₂ or buffer (control) added after 60 sec.

S3 Fig. The activation of the sporulation phosphorelay is delayed in the absence of Mn²⁺.

S4 Fig. The absence of Mn²⁺ from the sporulation medium delays asymmetric Z-ring formation in cells with a hypercharged phosphorelay.