A novel recombinant variant of latent membrane protein 1 from Epstein Barr virus in Argentina denotes phylogeographical association

Magdalena Gantuz; Mario Alejandro Lorenzetti; Paola Andrea Chabay; María Victoria Preciado

doi:10.1371/journal.pone.0174221

Abstract

Epstein Barr virus (EBV) infection in Argentina occurs at an early age and occasionally develops infectious mononucleosis (IM). EBV is also related with lymphomas. LMP1, the viral oncoprotein is polymorphic and is used to define viral variants.

Aim

To study LMP1 variants distribution among children with EBV+ malignant and benign conditions as well as in healthy carriers.

Methods

Oral secretions and blood cells from 31 children with IM, and biopsies from 14 EBV+ reactive lymphoid hyperplasia and 33 EBV+ lymphomas were included. LMP1 was amplified by nested PCR and sequenced. Phylogenetic reconstructions were made under Maximun Likelihood, Bayesian and coalescent algorithms.

Results

Six clades were defined (China1, China2, Med-, Alaskan, B95.8 and Argentine). Argentine variants, the most prevalent (46%), harbored 3 distinctive mutations and were a recombination between Raji and China1. Despite no pathology or compartment associations were observed for LMP1, the Argentine clade showed a phylogeographic association with our region. LMP1 estimated evolution rate was 8.591x10^-5s/s/y and the estimated tMRCA for Raji and Argentine was 136ybp.

Conclusions

An LMP1 Argentine clade was defined. LMP1 evolutionary rate was higher than expected for herpesviruses. The tMRCA for Raji and the Argentine agrees with African immigration and could explain the recombinant nature of the Argentine variant.

Citation: Gantuz M, Lorenzetti MA, Chabay PA, Preciado MV (2017) A novel recombinant variant of latent membrane protein 1 from Epstein Barr virus in Argentina denotes phylogeographical association. PLoS ONE 12(3): e0174221. https://doi.org/10.1371/journal.pone.0174221

Editor: Edward Gershburg, Southern Illinois University School of Medicine, UNITED STATES

Received: December 23, 2016; Accepted: March 5, 2017; Published: March 22, 2017

Copyright: © 2017 Gantuz et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All sequence files are available from the GenBank database (accession number(s) KY118019 to KY118083).

Funding: This study was supported in part by grants from National Agency for Science and Technology Promotion (PICT 2012 N° 0291, PICT 2008 Nº 0052). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. There was no additional external funding received for this study.

Competing interests: The authors have declared that no competing interests exist.

Introduction

The Epstein Barr Virus (EBV), a member of the Herpesviridae family, was the first gammaherpervirus to be identified [1] and also the first human virus assumed to be oncogenic [2]. EBV is a ubiquitous virus that infects over 90% of the world’s population under two distinct epidemiological patterns. In developing regions, primary infection most commonly occurs during childhood, as the case of Argentina. Under this scenario, primary EBV infection takes place a few years after birth and seroconversion is almost universal by the age of 6 years. Primary EBV infection is usually asymptomatic but, in some cases, may develop into a mild case of infectious mononucleosis (IM) [3,4]. On the other hand, in developed regions or high socio-economic groups, less than 40% of the population becomes infected with EBV during childhood; however when primary infection is delayed until adolescence or early adulthood, it usually develops into a more severe case of IM [5]. EBV is also related to various tumors in humans, including Hodgkin lymphoma (HL), Burkitt lymphoma (BL), nasopharyngeal carcinoma (NPC), gastric carcinoma, T-cell lymphoma and lymphoproliferative disorders in immunocompromised individuals (PTLD).

After primary infection, EBV establishes a life-long latent infection in peripheral blood B-lymphocytes. During periodical reactivations, EBV is sheded into saliva at a low but continuous level. During latency, viral antigens are mostly down-regulated in order to avoid immune surveillance; in this context different viral latency programs are expressed under particular stimuli, related to the differentiation stage of the B cell. These differential latent antigen expression programs are also seen in EBV-associated diseases, and are defined according to the specific pattern of latent proteins expression.

Among latency proteins, EBV latent membrane protein 1 (LMP1) exhibits properties of a classical oncoprotein, since it induces both cell growth and inhibition of apoptosis in a variety of cell types in vitro [6]. Furthermore, it has also been demonstrated that LMP1 contributes to B cell and epithelial cell tumorigenesis in vivo in transgenic mice [7,8]. LMP1 is a 386 amino acid (~62kDa) integral membrane protein comprising a short N-terminal (N-ter) domain (amino acids 1 to 23), six transmembrane (TM) hydrophobic segments (amino acids24 to 186), and a long carboxy-terminal (C-ter) domain (amino acids 187 to 386). The N-ter region is required to ensure the correct orientation of LMP1 within the cellular membrane [9]. The TM domain is necessary for LMP1-LMP1 interaction, which enables protein oligomerization and localization into lipid rafts, and is also involved in protein signaling [10–13]. The C-ter region mediates LMP1 signals through the binding of adaptor molecules, including the TNF-receptor–associated factors (TRAFs) to the C-ter activations domain 1, 2, 3 (CTAR1, CTAR2, CTAR3). This interaction allows LMP1 to mimic a constitutively activated CD40 molecule, a cellular receptor that belongs to the TNF super family, in a ligand-independent manner. In consequence, LMP1 stimulates multiple cellular signaling pathways that in turn activate NF-κB, AP-1, inhibitor-of-differentiation 2 and 3 (Id2 and Id3), and STAT-mediated transcription [14].

Comparative genomic sequencing of herpesvirus isolates is revealing novel aspects of recent evolution, where recombination among strains has emerged as a general phenomenon. Also, certain latency genes from gammaherpesviruses show signs of widespread diversifying selection [15]. In particular, LMP1 displays more nucleotide diversity than other viral genes and, like other EBV latent genes such as EBNA-1, -3A, -3B, -3C, -LP and LMP2A, it seems to have experienced an accelerated protein evolution due to positive selection [16,17]. Furthermore, intra-host genetic variability of LMP1 observed in EBV-infected adults was comparable to whole genome variability seen in early infection with RNA viruses such as West Nile Virus and HIV-1 [18].

Previous reports described EBV genetic variability related to different EBV associated diseases and/or specific geographic locations [19]. In this context, concerning the analysis of the three different LMP1 regions, the C-ter was the most extensively studied [20]. Based solely on the latter, a classification scheme that categorizes variants into classes that consider signature amino acid changes relative to the prototypic B95.8 LMP-1 was developed [21]. Under this scheme, the variants are named according to the geographic region where they were first isolated: Alaskan, China 1, China 2, China 3, Mediterranean+ (Med+), Med−, and North Carolina (NC) (21). Since only few studies comprised LMP1 entire gene sequence, it is unknown whether this classification scheme could still be applicable or new approaches need to be developed to discuss the geographical distribution and/or the pathogenic role of LMP1 [22,23].

Given that the incidence of EBV-associated diseases differs among geographical regions and that EBV genetic variants also differ through these geographic zones, the characterization of those structural changes in LMP1 variants specifically associated to tumors is still a matter of interest and debate.

The vast majority of papers reporting sequence variation on LMP1 gene have been performed in adult patients but only a few considered pediatric samples. In the present study, variations in LMP1 gene complete sequence from pediatric isolates with benign (IM) and malignant EBV related lymphomas, as well as from pediatric healthy carriers were characterized and LMP1 evolution was inferred.

Materials and methods

Hospital’s ethic committee reviewed and approved this study, which is in accordance with the human experimentation guidelines of our institution and with the Helsinki Declaration of 1975, as revised in 1983. A written informed consent was obtained from all patient’s parents or tutors. The Review Board of our institution is: “Comité de Ética en Investigación del Hospital de Niños Ricardo Gutiérrez”.

Patients and samples

A total of 78 pediatric patients were enrolled: i) 31 cases were confirmed EBV+ IM, median age of 4.5 years (age range 1.5 to 17 years), 52% males, ii) 33 patients were diagnosed with EBV-associated lymphoma (T) [(26 HL and 7 Non-HL(NHL)], median age 9 years (age range 4 to 18 years), 70% males and iii) 14 cases of EBV+ reactive lymphoid hyperplasia (RLH), median age 8 years (age range, 3 to 16 years), 57% males (S1 Table). Peripheral blood (6 ml) and oral secretion (OS) samples were obtained from patients with presumptive acute IM at the time of diagnosis. Lymph node biopsies from presumptive lymphomas and RLH were collected for diagnosis. Lymphomas were treatment naïve. The biopsies were sectioned; one half was formalin-fixed and paraffin embedded and the other half was conserved at -80°C. Lymphoma diagnosis and histological classification, as well as RLH diagnosis were assessed at the Pathology Division.

Serological assays

IM was identified on clinical grounds and confirmed by an indirect immunofluorescent assay (IFA) for EBV-VCA antigen on substrate slides (MBL, Woburn, MA, USA). Patients with IgM antibodies against EBV-VCA were included in the study. As a differential diagnosis for other mononucleosis-like conditions, IgM anti-Cytomegalovirus and anti-Toxoplasma gondii were assessed by ELISA. All patients were negative for both of them. All patients were HIV negative as well.

EBERs in situ hybridization

EBV presence was assessed on formalin-fixed, paraffin embedded lymph node biopsy sections (lymphoma patients) and resected tonsils (RLH patients) by means of a commercial in situ hybridization (ISH) kit for EBERs according to the manufacturer’s instructions (Dako, Carpinteria, CA, USA). In lymphoma cases, those with positive nuclear staining in tumor cells without staining in infiltrating lymphocytes were included. Tonsils with positive nuclear staining in lymphocytes were selected.

DNA extraction and amplification

Peripheral blood mononuclear cells (PBMC) were separated from whole blood with Ficoll-Paque plus (GE Healthcare, Little Chalfont, UK). Genomic DNA was extracted from PBMC, OS and fresh lymph node and tonsil biopsies using QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) following manufacturer’s instructions. EBV type was assessed by amplification of the EBNA3C gene as previously described [24]. The complete coding sequence of LMP1, 1390pb, was amplified by nested PCR. Primers used in the first round were LMP11 5' TGATTAGCTAAGGCATTCCCA 3' (B95.8 prototype EBV genome, GenBank accessions Nº V01555.2, coordinates 168075–95) and LMPEco 5' CCGTACTGCCTCCGGCAGAC 3' (169607–27) and in the second round A2 5' GCCTATGACATGGTAATGCCTA 3' (168124–45) and E2 5' CTTTCCTCAACTGCCTTGCT 3' (168124–45). PCR amplicons (1390bp, with variations according to structural polymorphisms) was separated by electrophoresis in 2% agarose gel, stained with ethidium bromide and visualized under UV light. The specific amplification product was recovered and purified with QIAEXII gel extraction kit (QIAGEN, Hilden, Germany) according to manufacturer’s instructions. These purified PCR products were directly sequenced using Big Dye Terminator v3.1 kit (Applied Biosystems, Foster City, CA, USA) in an automated Genetic Analyzer 3130xl (Applied Biosystems, Foster City, CA, USA) in four segments using a contig strategy with primer A2, E2, B 5`ATTGTCAGGACCACCTCCAG3' (168568–88) and C 5' TTCCTTCTCTAACGCACTTTCTC 3' (169141–63). Primers were designed within viral conserved regions and were tested in EBV+ cell lines (B95.8, Raji and P3HR1) and in an EBV- cell line (Ramos).

Sequence analysis

Sequences were aligned and edited with Bioedit software [25]. For phylogenetic analysis, the most appropriate model of evolution for this region was inferred using jModelTest [26] according to the Akaike Information Criterion (AIC) (S2 Table).

a) Phylogenetic analysis.

Maximum likelihood (ML) trees: The ML tree was estimated using the previously defined evolutionary model and bootstrapping was performed after 1000 replicates under the ML substitution model. Full length LMP1 reference sequences from EBV+ cell lines B95.8 (V01555.2), GD1 (AY961628.3), GD2 (HQ020558.1), Akata (KC207813.1), Cao (X58140.1), Raji (KF717093.1), AG876 (DQ279927.1) and Mutu (KC207814.1) and from isolates related to specific geographical regions previously described for C-ter classification, namely China 1 (AY337723.1), China 2 (AY337724.1), Med+ (AY337722.2), Med- (AY337721.2), NC (AY337726.2), Alaskan (AY337725.1), HKNPC1 (JQ009376.2), M81 (KF373730.1) were downloaded from GenBank. The whole phylogenetic analysis were performed using PhyML 3.0 [27] and the graphical representation and edition of the phylogenetic tree was performed with FigTree (version 1.3.1, http://tree.bio.ed.ac.uk/software/figtree/).

b) Recombination analysis.

Presumptive recombinant sequences were analyzed with Simplot software [28] under neighbor-joining algorithms with a 200bp fragment length (window), 20bp passes and 100 repetitions.

c) Phylogeographic analysis.

The degree of association between geographic origin and position of the sequence in the virus phylogeny was estimated using the program BaTS (Bayesian Tip-Significance testing); the Parsimony Score [PS], Association Index [AI] and the Monophyletic Clade Size [MC] statistics were determined (S3 Table). The BaTS program examines a posterior sample of trees generated by a Bayesian Markov Chain Monte Carlo (MCMC) approach implemented in BEAST (Bayesian Evolutionary Analysis Sampling Trees). The BaTS program was performed with 1,000 replications, p<0.05 was considered significant.

d) Co-estimate of substitution rate and the time to most recent common ancestor (tMRCA).

A Bayesian coalescent analysis was carried out on a set of 68 sequences from samples with an available sampling time with Beast2 [29]. Sequence analysis programs such as Bayesian Evolutionary Analysis by Sampling Trees (BEAST) utilize the genetic variation present in a sample to simultaneously estimate both demographic and evolutionary parameters in the context of time and space [30–33]. A minimum of two independent MCMC simulations for each model-clock combination were performed for no less than 50 million generations. Genealogies were estimated under: 1) strict molecular clock (Strict), 2) relaxed molecular clock with an “uncorrelated log-normal model” (UCLN) distribution of rates. The parameters were estimated under three different demographic models: hypothesis of a constant population size, coalescent exponential population and Bayesian skyline coalescent model under the general time-reversible (GTR) model of base substitution (S4 Table). After confirming MCMC convergence and congruence among parameter estimates from different prior sets, summary trees were created using TreeAnnotator [29] and edited in FigTree software.

Statistical analysis

Statistical analysis to infer the association between both LMP1 variants and polymorphisms with the different pathological conditions was performed using Graph-Pad InStat software. For the univariate analysis, Chi-square or Fisher’s exact test were used to assess the association between categorical variables. All tests were two sided, and a p value of less than 0.05 was considered statistically significant.

Results

Seventy eight pediatric patients were included in this study, 31 EBV+ IM cases, 33 EBV associated lymphomas [Tumors, (T)], and 14 EBV+ reactive lymphoid hyperplasia (RLH), as representatives of benign EBV primary infection, malignant EBV infection and normal healthy carriers, respectively. EBV association was properly confirmed by specific serological tests for IM cases and by EBERs in situ hybridization assay for the biopsy specimens. After PCR amplification and direct sequencing of the amplicons, full length LMP1 sequences could be assembled for 25/31 IM patients, 26/33 lymphoma cases and for 14/14 RLH cases. A total of 90 full length LMP1 sequences, considering both PBMC and OS compartments in IM cases, were analyzed. Unfortunately, due to the institution’s ethic committee guidelines, PBMC and OS samples were not available from child`s T and RLH. Only one LMP1 variant was detected in each sample by means of nested PCR followed by direct sequencing, but the presence of other underrepresented LMP1 variants cannot be ruled out. Additionally, there were no differences concerning variant distribution between both anatomical compartments (PBMC and OS) in each IM patient; so only one sequence per IM case was included in the following analysis.

Polymorphisms characterization

Concerning the N-ter region of LMP1, which has been studied to a lesser extent than the C-ter region, the most studied polymorphism comprehends the loss of an XhoI (CTCGAG) restriction site [34,35]. In our series, mutations in XhoI site were detected in 4/25 (16%) IM, 7/26 (27%) T and 1/14 (7%) RLH (Table 1) and no association between this polymorphism and malignancy was observed (p>0.05). Concerning the TM domain, in a previous report, two polymorphisms were identified within the TM domain in HIV patients as markers of increased NF-κB activity in vitro, namely I124V/I152L and F144I/D150A/L151I [36]. In our series I124V/I152L was detected in 9/25 (36%) IM, 15/26 (58%) T and 6/14 (43%) RLH. Meanwhile, F144I/D150A/L151I was detected in 2/25 (8%) IM, 3/26 (12%) T but was absent in RLH (Table 1). None of these polymorphisms was associated with a particular pathology (p>0.05 in each case). On the other hand, several signature hotspot mutations, along with a 30bp deletion (del30), a 15bp insertion (ins15) encoding a Janus Kinase 3 (JAK3) signaling motif and a variable numbers of 33bp tandem repeats (rep33), define LMP1 variants at the C-ter region, some of which have been described to alter LMP1 signaling activity [21,37]. The occurrence of del30 in IM was 13/25 (52%), 18/26 (69%) in T, and 7/14 (50%) among RLH. The ins15 was detected either within the third or the fourth repetitive unit, and was observed in 12/25 (48%) IM, 15/26 (57%) T, and 7/14 (50%) RLH. Finally, the number of rep33 ranged between 3 ½ and 8½ units, where 5½ repeats was the most frequently detected polymorphism in 13/25 (52%) IM, 21/26 (81%) tumor samples, and 6/14 RLH (42%) (Table 1). Only the presence of 5 ½ rep33 was significantly associated with tumors (p = 0.039 vs. IM and p = 0.0312 vs. RLH, Fisher´s exact test)

Download:

Table 1. Polymorphisms and variant characterization.

https://doi.org/10.1371/journal.pone.0174221.t001

LMP1 variants characterization

In order to examine genetic variability and evolutionary relationships, 65 LMP1 full length sequences, 25 IM, 26 T and 14 RLH, from pediatric isolates were aligned together with full length LMP1 sequences from EBV+ cell lines and from geographically-specific isolates obtained from GenBank. Phylogenetic reconstructions were inferred under maximum likelihood methods. LMP1 sequences included in our analysis clustered into six clades; four smaller ones related to China1, China2, Alaskan or B95.8 and to major clades, one related to Med+/Med- and a predominant clade related to Raji. Of notice, other than the reference Raji variant, this predominant clade only included isolates from our pediatric series, 9 IM, 15 T and 6 RLH (Fig 1A) which all contained three signature substitutions: C → T 169055 (intron), A → G 168951 (I124V in TM domain 4) and A → C 168867 (I152L in TM domain 5).

Download:

Fig 1. Phylogenetic reconstruction.

Phylogenetic tree obtained from the alignment of full length LMP1 sequences amplified from patients with IM, EBV positive lymphomas (T) and healthy donors (RLH). GenBank downloaded reference sequences were included (B95.8, GD1, GD2, Akata, Cao, Raji, AG876, China 1, China 2, Med+/-, NC, and Alaskan, HKNPC1, M81). (A) The tree was rooted by middlepoint method, bootstrap values were obtained after 1000 resamplings, and only bootstrap values over 60% are shown. (B) Unrooted tree. Raji clade (orange), Mediterranean clade (yellow), B95.8 clade (purple), Alaskan clade (green), China2 clade (red) and China 1 clade (blue).

https://doi.org/10.1371/journal.pone.0174221.g001

Strikingly, phylogenetic results were not in accordance with our previous analysis on LMP1 sequences when only the C-ter region was analyzed and where China1 related sequences were prevalent in our geographical region [38]. In order to test our previous results, phylogenetic reconstructions were inferred again but considering in the alignment only the N-ter and TM domains, and independently the C-ter domain (Fig 2). When analyzing the N-ter/TM phylogenetic tree, the topology of the predominant clade matched exactly with that of the full length LMP1 tree, clustering with Raji and significantly differing from the China1 clade (Fig 2A). On the other hand, the C-ter phylogenetic tree also displayed this predominant clade as a separate one, which included no reference sequence but didn’t differ significantly from the China1 clade either (bootstrap <60%). Hence, if only considering the C-ter region, this predominant clade could be considered as a China 1 related clade (China1*), in accordance with our previous observations (Fig 2B). When considering full length LMP1, the divergence of the China1* clade from the China1 clade is mainly due to the three signature polymorphisms (intron, TM4 and TM5) harbored by these isolates. In the same phylogenetic tree, Raji and the isolate IM31 clustered together in a separate clade. The latter fact suggested that this predominant clade could in fact be the result of a recombination process between Raji and China1 related variants. Since it was previously suggested that specific LMP1 variants could be associated with certain pathological conditions, we tested this hypothesis by comparing EBV+ tumor samples (HL and NHL) with EBV+ benign pathology (IM) and healthy carriers (RLH); however no statistical association was disclosed between any particular LMP1 variant and benign or malignant conditions (p>0.05 in each case).

Download:

Fig 2. Phylogenetic reconstruction.

(A) Phylogenetic tree obtained from the alignment of sequences from the N-ter and TM domain of LMP1 from patients with IM, EBV positive lymphomas (T) and healthy donors (RLH). GenBank downloaded reference sequences were included (B95.8, GD1, GD2, Akata, Cao, Raji, AG876, China 1, China 2, Med+/-, NC, and Alaskan, HKNPC1, M81). Raji clade (orange), Mediterranean clade (yellow), B95.8 clade (purple), Alaskan clade (green), China2 clade (red) and China 1 clade (blue). (B) Phylogenetic tree obtained from the alignment of sequences from the C-ter domain of LMP1. Raji clade (orange), Mediterranean clade (yellow), B95.8 clade (purple), Alaskan clade (green), China2 clade (red), China 1 clade (blue) and China1* clade (related to China1 (grey)). Bootstrap values were obtained after 1000 resampling, only bootstrap values over 60% are shown.

https://doi.org/10.1371/journal.pone.0174221.g002

Recombination analysis

As previously suggested by our results, and to assess the possibility of a recombination process, each parental sequence (Raji and China1) was tested against a representative sequence of the predominant clade, RLH14, and Cao reference sequence was used as an outgroup. A recombination point was detected in the C-ter domain within the region comprising the 33 bp tandem repeats (Fig 3). This result indicates that the predominant clade detected in our LMP1 complete sequence phylogenetic analysis could indeed be the result of a recombination between Raji and China1 sequences. This can be deduced by the fact that almost 100% of the generated trees during the bootscaning process (% permuted trees) were similar to Raji reference sequence through the N-ter and TM domain but were similar to China1 sequence after the recombination point in the C-ter domain. We also tested IM31 isolate since this sequence clustered together with Raji both in the N-ter and C-ter, but contains C→T 169055, A→G 168951 (I124V) and A→C 168867 (I152L) mutations in the N-ter and TM domains, characteristic of the sequences in the predominant clade. Variant IM31 showed no recombination point when tested against Raji, China1 and Cao (Fig 4A), but when tested against HR14 (as a representative of the predominant clade) recombination points were observed in the N-ter and TM domain (Fig 4B). Since isolate IM31 is identical to Raji, but contains the mentioned mutations, these results suggest that IM31 could be a parental sequence for the predominant clade isolates.

Download:

Fig 3. Recombination analysis.

Bootscan analysis of the Argentine variant represented by sequence RLH14, against Raji (blue), China1 (grey) and Cao (pink) parental sequences. The rep33 region was omitted from the alignment since they presented no mutations within and since the parental sequences had different rep33 units each. Analyses parameters were: 200pb window, 20pb paces and 100 repetitions under neighbour-joining algorithm.

https://doi.org/10.1371/journal.pone.0174221.g003

Download:

Fig 4. Recombination analysis.

(A) Bootscan analysis of sequence from isolate IM31 against Raji (blue), China1 (grey) and Cao (pink) parental sequences. (B) Bootscan analysis of sequence from isolate IM31 against Argentine variant, represented by sequence RLH14 (green) and Raji (blue), China1 (grey) and Cao (pink) parental sequences. The rep33 region was omitted from the alignment since they presented no mutations within and since the parental sequences had different rep33 units each. Analyses parameters were: 200pb window, 20pb paces and 100 repetitions under neighbour-joining algorithm.

https://doi.org/10.1371/journal.pone.0174221.g004

Phylogeographical analysis

Given that the sequences in the predominant clade described in Fig 1 represented 46% (30/65) of the pediatric isolates from our geographical region and were not described in other areas, we assessed the possibility that these sequences represent a distinctive LMP1 variant preferentially circulating in our region.

For phylogeographic analysis purposes, we retrieved from GenBank 177 full length LMP1 sequences from Asia (N = 59; 24.3%), Europe (N = 46; 18.9%), Africa (N = 33; 13.6%), North America (NA) (N = 17; 7%), Oceania (N = 22; 9%) and analyzed them along with the 65 sequences from our Argentinean pediatric isolates under maximum likelihood and Bayesian algorithms. As shown in Fig 5 those sequences in the predominant clade in Fig 1 still clustered together as a separate clade (posterior probability (pp = 1), which also included some sequences from NA, Africa and Europe. On the other hand, sequences from Asia, which included isolates from China, Vietnam and Japan also formed separate and independent clusters which included reference sequences China1 and China2 (pp = 0.99/63 and pp = 1, respectively). As well, African isolates segregated independently including reference sequences P3HR1 and Mutu (pp = 0.99/71 and pp = 1, respectively). European sequences formed 2 clusters which also included our pediatric isolates that previously clustered together with Med+/Med- reference sequences. In order to test for statistical significance of the phylogenetic reconstruction, a bayesian statistical association analysis (BaTS) was performed in BEAST. The Association Index (AI), significantly differed from that expected by chance (p<0.001). Monophyletic Clade index (MC), which denotes the association with the geographic origin of the clade, were statistically significant for Asian, African, NA, Oceania and the predominant clade from our pediatric series (p<0.001, p<0.001, p = 0.001, p = 0.002 and p = 0.004, respectively) (S2 Table).

Download:

Fig 5. Phylogeographic reconstruction.

Phylogenetic tree obtained from the alignment of the amplification fragment of LMP1 full length sequences from patients with IM, EBV positive lymphomas (T) and healthy donor (RLH) along isolates from distinct geographical regions reported in GeneBank. The variants were categorized according to their geographical origin as Asia (yellow), Europe (blue), Africa (green), North America (orange), Oceania (purple) and Argentina (red). Bayesian posterior probabilities over 0.85 and bootstrap over 60% are shown.

https://doi.org/10.1371/journal.pone.0174221.g005

Since the sequences in the predominant clade previously described in Fig 1 represents 46% (30/65) of the pediatric isolates from our geographical region, harbor 3 distinctive mutations, are a recombination between Raji and China1 variants, are evenly distributed among the studied population (IM, T and RLH) and have a monophyletic origin within our region, we decided to term them as the newly characterized Argentine variant.

LMP1 molecular evolution

LMP1 has been shown to be the viral gene with the highest degree of variation and has depicted a high number of polymorphisms at the amino acid level in our pediatric series (S1 Fig). The number of variants that are defined by LMP1 sequence variation exceeds by far that of any other EBV gene. Thus, LMP1 gene provides the most suitable genetic locus for EBV variants identification, and it is as well the one which displays the highest sensitivity and specificity for molecular epidemiology studies on EBV infection [39].

As for the substitution rate calculated for LMP1, although this is not a longitudinal study, advances in computational algorithms have enabled the incorporation of temporal information from time-structured sequence datasets into strict or relaxed molecular clock models [30–32], which can then be used to estimate the timing of epidemiologically important events. Therefore, we used temporally structured sequence data to estimate the evolutionary rate of LMP1 gene. A dataset was constructed with the sequences described here and other complete LMP1 sequences with available sampling dates (1972–2013) from other geographic regions, which were retrieved from GenBank. The sampling time, spanning 41 years, was incorporated in a Bayesian Markov Chain Monte Carlo (MCMC) analysis using BEAST 2 [29] in order to determine the evolution rate and the tMRCA. Genealogies were estimated under: 1) strict molecular clock, 2) relaxed molecular clock with an uncorrelated lognormal (UCLN) distribution of rates. The parameters were estimated under three different demographic models: 1) hypothesis of a constant population size, 2) coalescent exponential population and 3) Bayesian skyline coalescent model. The Bayesian MCMC inference for each combination converged efficiently on a posterior mean value for all parameters, independently of the demographic model applied. The Bayes Factor (BF) significantly supported the UCLN clock model over the others (S4 Table). The mean evolutionary rate estimated under UCLN and constant population size was 8.591 x 10–5 subs/site/year [4.779–12.89 x 10–5 subs/site/year, 95% Highest Posterior Density (HPD)]. In particular, the tMRCA of Argentine and Raji clades was 136 ybp (76–223 ybp, 95% HPD).

To test and confirm the temporal signature observed in our data, we performed a tip-date randomization test. The sequence-sampling time associations were randomized 20 times, and the evolutionary rates were re-estimated. The hypothesis of significant temporal structure is rejected when the value of the mean evolutionary rate estimated from the real data fell within the 95% HPDs of those estimated from the randomized data, as previously described [40,41]. In our analysis, the hypothesis of temporal structure was accepted since the value of the mean real evolutionary rate did not fell within the 95% HPDs of the randomized data (S2 Fig).

Discussion

In this work we aimed to study polymorphisms in LMP1 from pediatric samples because of the particular incidence of Hodgkin lymphoma (HL) in our geographic region, where our group has previously reported a high incidence in children below ten years of age in contrast to what is described in the United States and most European countries where HL shows an incidence peak between 15 and 30 years. Moreover, EBV was associated with 31% of adult HL cases, but rose up to 54% in pediatric patients. Furthermore, EBV + cases had a median age of 8 years, versus a median of 12 years observed in EBV- cases [3]. In parallel, we also described in a Burkitt lymphoma series from our country, an EBV association specifically observed in patients younger than 5 years old [3]. These findings prompted us to propose that EBV associated lymphomas in children from Argentina could be triggered as a complication from primary infection and, in consequence, to look forward for viral features that could possibly be related to these observations. Finally, the fact that only one EBV variant is usually detected in samples from pediatric patients with IM [42–44], allows us to identify the original infective variant, in contrast to what is frequently reported in adult patients where multiple variants may be detected due to subsequent re-infections during adolescence and early adulthood.

Regarding LMP1 gene, a classification system to define its sequence variation, based on signature polymorphisms in the C-ter region was introduced by Edwards et al. in the year 1999 (21) and is still the most frequently used system until today [23]. But, since geographical restrictions have been proposed for LMP1 variants and that it is plausible that a portion of any given gene may not reflect its total degree of variation, we assessed its variability, molecular evolution, disease and geographic association in 65 full-length LMP1 sequences from pediatric patients with benign or malignant EBV diseases and healthy carriers. A novel local variant, present in 46% of the total isolates was phylogenetically and molecularly characterized as the Argentine variant. The high prevalence of this variant in our region could reflect features such as geographically restrained distribution, genetics and/or immunological factors of the host. Moreover, these observations are strengthened by the fact that Zuercher et al. previously described the two signature polymorphisms (I124V/I152L) in an HIV cohort, but in a very low proportion of isolates and did not describe any recombination events [36]. The analysis of the entire LMP1 coding sequence was proven as a better strategy than only the C-ter region, even if the highest amount of polymorphisms are harbored within the latter region. In our previous work, when analyzing exclusively the C-ter region of LMP1 in different compartments in children with IM and pediatric EBV-related lymphomas from Argentina, China1 seemed to be the most common variant in our region [38]. The current analysis of the complete coding sequence of LMP1 allowed us to re-classify these isolates as a distinctive group that clustered in proximity to China1, but harbored significant differences, which made it more closely related to Raji variant. Indeed, the polymorphic hallmarks of Argentine variant were located between the N-ter and TM domains; hence the importance of analyzing full length sequences in order to define LMP1 variants. None the less, it was within the C-ter domain, where a recombination point, another hallmark of the Argentine variant, was located.

Most EBV associated tumors and EBV+ cell lines contain monoclonal EBV genomes [45]. On the other hand, co-infection with several EBV variants was reported in adult patients with IM [46–48], probably given by a higher viral inoculum transmitted through kissing; however, in pediatric primary infection these co-infections are infrequent, as observed in our previous reports in other EBV genes [38,42,49] and by others [43,44]. Indeed, when studying chronic active EBV infection in children, Jin et al. found a small proportion of co-infections but failed to do so in IM samples [44]. We hypothesize that this high EBV dose may include multiple variants which will give rise to co-infection in the adult host. On the contrary, the magnitude of viral dose acquired by a child through salivary contact, mediated by unclean toys or fingers, is lower, so the chances of being infected by multiple viral variants are less frequent. Besides there are only few studies about EBV variants in EBV+ reactive hyperplasia, where co-infections are detected in a small number of tonsils [50]. In our study, only one LMP1 variant was detected per sample which meant that during pediatric primary infection (IM patients), no differences were observed between anatomical compartments. This was also in accordance with our prior observations in our pediatric cohort when studying other EBV genes [38,42]. Moreover, no significant association between a given LMP1 variant and a certain pathological condition was discerned, since they were all similarly distributed between both benign and malignant conditions.

Concerning specific polymorphisms, XhoI-loss was the predominant variant detected in NPC by Nguyen-Van D et al. and Lin SX et al. so the authors speculated that this mutation could be associated with nasopharyngeal carcinogenesis [34,35]; however, in the present series this polymorphism was evenly observed in lymphomas, IM and RLH suggesting no involvement in lymphomagenesis. In accordance with the low incidence of XhoI-loss observed in our series, a recent review by Neves et al. highlights that even though associated to NPC development, this polymorphism could also be a geographic or race associated variation in South Asian population [23]. Whichever the case, XhoI-loss seems not be related to lymphomagenesis in South America nor a predominant polymorphism in our region.

Additionally, amino acid substitutions in the TM domain, particularly in those involved in LMP1 signaling activity, were proved to increase NF-kB activation in vitro and were also described as markers related to malignant processes [36]. However, in our pediatric series the combination of polymorphisms I124V/I152L and F144I/D150A/L151I within the TM domains were not associated with EBV related lymphomas. Concerning the C-ter of LMP1, different polymorphisms have been profusely described (20). A 30bp deletion has been associated with a variety of EBV-related tumors by several groups [20,51,52]. Instead, some others suggested that the high prevalence of the deleted-LMP1 variant represents a geographical or race-associated polymorphism rather than a disease-associated polymorphism (reviewed in [19,20]). As was previously reported for Argentina [38], the 30bp deletion was evenly detected among all the studied groups, further suggesting that it is not involved in lymphomagenesis. On the other hand, an insertion of 15bp (ins15) and a variable number of repetitive units of 33bp (rep33) were previously described in relation to tumorigenesis [38]. In our studied group, ins15 was predominantly detected in the fourth unit of rep33, but still proved not to be statistically associated with lymphomas. Finally, 5½ repetitive units of rep33 were the most frequently detected number of repetitions but still significantly present in a higher proportion of tumors than in healthy carriers, suggesting that this polymorphism could be related to the lymphomagenesis process.

EBV can also be classified into type I and II based on sequence differences in EBNA genes. While type 1 is worldwide distributed, type 2 is predominant in Equatorial Africa and Southeast Asia, [reviewed in [19,20]]. Based on this geographical distribution, previous studies also suggested a geographical association of LMP1 variants from Southeast Asia, Papua, New Guinea, Africa, and Australia [53]. The phylogeographic analysis performed in this study, which included isolates from different locations, proved that some of the LMP1 variants have a global distribution, while others, like the Asian or Argentinean variants, were restricted to a particular geographic region. Moreover, the Argentine variant appeared to be an admixture between African and Asian viral variants. All these results are in accordance with a recent report by Chiara et al., who also described the clustering of “pure” sub-populations in different geographic regions, namely Asia and Europe, but also described admixed viral populations between American and African variants [54]. The reasons for the restricted geographic pattern of EBV-associated entities in different regions are poorly understood, but variation in host genetics, such as HLA polymorphisms in different populations, or environmental factors, such as diet, could be speculated to account for geographically associated variations in the viral genome [20,54].

The estimated evolutionary rate for LMP1 by MCMC analysis, 8.591x10^-5 subs/site/year over a period of 42 years, was higher than expected under the hypothesis of co-evolution with the host species, as compared to that for α-herpesvirus, which is estimated from 1x10^-7 to 1x10^-9 subs/site/year [55–57]. Additionally, 8 positively selected codons were detected in our isolates (data not shown) which could account for this augmented mutation rate; however, it should also be noted that this evolution rate applies only to the present dataset and does not necessarily apply to the rest of the EBV genome. In line with this, EBV latency genes were described to show greater diversity and faster evolution rates than lytic genes [16]. Moreover, the assumption that all DNA viruses evolve slower than RNA viruses, has been recently challenged [58–60]. In fact, by making use of this analysis Firth et al. estimated evolutionary parameters for double stranded DNA virus and concluded that given a dataset containing a large enough number of variable sites, it is possible to accurately estimate substitution rates that range from 10⁻⁴ to approximately 10⁻⁷ subs/site/year using temporally sampled viruses [58]. The authors suggested that two general mechanisms may influence the substitution rate of rapid evolving DNA viruses. First, as the rate of viral replication directly impacts in the long-term substitution rate, very high replication rates might increase the substitution rates of dsDNA viruses. Second, positive selection could also play a role in increasing the substitution rate over the expected mutation rate. Unfortunately, the replication rate of EBV during natural primary infections in the host is still unknown; however, the action of positive selection inferred from an increased proportion of non-synonymous variation has been already described in LMP1 and EBNA1 [39,53].

The tMRCA estimated for Raji and Argentine was 136 ybp (76–223 ybp, 95% HPD), which is coincident than the historical period of introduction of African slave into Argentina. In fact, during the 18-19^th centuries, 30% Buenos Aires citizens were of African origin, while in rural areas over 54% of the population were African slaves [61]. Moreover, the estimation is that 3–4% of the genetic ancestry of Buenos Aires City population is African [61]. It is then highly plausible that the LMP1 Argentine variant could occur from a recombination event between an ancestral worldwide distributed variant (China1) and an African one (Raji), following the introduction of African slaves.

In conclusion, our results highlight on the extent of EBV diversity, particularly in LMP1 gene which shows a complex evolutionary pattern that involves both selection and recombination processes. Furthermore, we characterized a predominant LMP1 variant potentially originated through recombination due to African migrations into our country.

In this way this work contributes to enlarge our present knowledge on structural variants or mutations from a still underrepresented geographic location [17,20,23], South America, which displays a characteristic epidemiology concerning EBV related diseases.

Supporting information

S1 Fig. Positional entropy.

Shannon information entropy values for full length LMP1 alignment from patients with IM, EBV positive lymphomas and RLH, were plotted according to values generated in BioEdit. Amino acid positions that do not exhibit any changes have entropy of 0, whereas positions of high variability are represented by peak in the plot.

https://doi.org/10.1371/journal.pone.0174221.s001

(TIF)

S2 Fig. Randomization test.

The first data point represents the substitution rate estimated for the entire set of data (grey circle) whereas the remaining 20 points (black circles) represent estimated rates with random isolation dates. Y axis is represented in a log₁₀ scale.

https://doi.org/10.1371/journal.pone.0174221.s002

(TIF)

S1 Table. Patient’s isolates description.

https://doi.org/10.1371/journal.pone.0174221.s003

(DOC)

S2 Table. Evolution model parameters for the different phylogenetic reconstructions as estimated with jModelTest.

https://doi.org/10.1371/journal.pone.0174221.s004

(DOCX)

S3 Table. Results of Bayesian tips-significance tests (BaTS).

Global association test between trait and tree topology.

https://doi.org/10.1371/journal.pone.0174221.s005

(DOC)

S4 Table. Mean and 95% HPD of the Bayesian Posterior Estimates of Substitution Rate (subs/site/year) and tMRCA.

https://doi.org/10.1371/journal.pone.0174221.s006

(DOC)

Acknowledgments

The authors thank Altcheh J and De Matteo E (Medical Staff at Instituto Multidisciplinario de Investigaciones en Patologías Pediátricas (IMIPP), CONICET-GCBA, Hospital de Niños Ricardo Gutiérrez, Buenos Aires, Argentina, for providing assistance in reviewing clinical and histological records. This study was supported in part by a grant from National Agency for Science and Technology Promotion (PICT 2012 N° 0291, PICT 2008 N° 0052). M.G. is a fellow from the National Research Council (CONICET) and M.A.L, P.A.C and M.V.P are members of the CONICET Research Career Program.

Author Contributions

Conceptualization: MG MAL PAC MVP.
Data curation: MG MAL.
Formal analysis: MG MAL.
Funding acquisition: MAL MVP.
Investigation: MG MAL.
Methodology: MG MAL PAC MVP.
Project administration: PAC MVP.
Resources: MAL PAC MVP.
Supervision: PAC MVP.
Validation: MVP.
Visualization: MG MAL PAC MVP.
Writing – original draft: MG MAL.
Writing – review & editing: MG MAL PAC MVP.

References

1. Epstein MA, Achong BG, Barr YM (1964) Virus Particles in Cultured Lymphoblasts from Burkitt's Lymphoma. Lancet 1: 702–703. pmid:14107961
- View Article
- PubMed/NCBI
- Google Scholar
2. IARC (1997) IARC Monographs on the evaluation of carcinogenic risks to humans: Epstein-Barr virus and Kaposi’s sarcoma herpesvirus/herpesvirus 8. Lyon: IARC press.
3. Chabay PA, Preciado MV (2013) EBV primary infection in childhood and its relation to B-cell lymphoma development: A mini-review from a developing region. Int J Cancer.
- View Article
- Google Scholar
4. Chan KH, Tam JS, Peiris JS, Seto WH, Ng MH (2001) Epstein-Barr virus (EBV) infection in infancy. J Clin Virol 21: 57–62. pmid:11255098
- View Article
- PubMed/NCBI
- Google Scholar
5. Vetsika EK, Callan M (2004) Infectious mononucleosis and Epstein-Barr virus. Expert Rev Mol Med 6: 1–16.
- View Article
- Google Scholar
6. Rickinson AB, Kieff ED (2007) Epstein Barr virus. In: D M Knipe PMH, editor. Fields Virology. 5th ed. Philadelphia: Lippincott Williams & Wilkins. pp. 2655–2700.
7. Stevenson D, Charalambous C, Wilson JB (2005) Epstein-Barr virus latent membrane protein 1 (CAO) up-regulates VEGF and TGF alpha concomitant with hyperlasia, with subsequent up-regulation of p16 and MMP9. Cancer Res 65: 8826–8835. pmid:16204053
- View Article
- PubMed/NCBI
- Google Scholar
8. Wilson JB, Bell JL, Levine AJ (1996) Expression of Epstein-Barr virus nuclear antigen-1 induces B cell neoplasia in transgenic mice. EMBO J 15: 3117–3126. pmid:8670812
- View Article
- PubMed/NCBI
- Google Scholar
9. Izumi KM, Kaye KM, Kieff ED (1994) Epstein-Barr virus recombinant molecular genetic analysis of the LMP1 amino-terminal cytoplasmic domain reveals a probable structural role, with no component essential for primary B-lymphocyte growth transformation. J Virol 68: 4369–4376. pmid:8207810
- View Article
- PubMed/NCBI
- Google Scholar
10. Higuchi M, Izumi KM, Kieff E (2001) Epstein-Barr virus latent-infection membrane proteins are palmitoylated and raft-associated: protein 1 binds to the cytoskeleton through TNF receptor cytoplasmic factors. Proc Natl Acad Sci U S A 98: 4675–4680. pmid:11296297
- View Article
- PubMed/NCBI
- Google Scholar
11. Meckes DG Jr., Menaker NF, Raab-Traub N (2013) Epstein-Barr virus LMP1 modulates lipid raft microdomains and the vimentin cytoskeleton for signal transduction and transformation. J Virol 87: 1301–1311. pmid:23152522
- View Article
- PubMed/NCBI
- Google Scholar
12. Soni V, Yasui T, Cahir-McFarland E, Kieff E (2006) LMP1 transmembrane domain 1 and 2 (TM1-2) FWLY mediates intermolecular interactions with TM3-6 to activate NF-kappaB. J Virol 80: 10787–10793. pmid:16928765
- View Article
- PubMed/NCBI
- Google Scholar
13. Yasui T, Luftig M, Soni V, Kieff E (2004) Latent infection membrane protein transmembrane FWLY is critical for intermolecular interaction, raft localization, and signaling. Proc Natl Acad Sci U S A 101: 278–283. pmid:14695890
- View Article
- PubMed/NCBI
- Google Scholar
14. Everly DN Jr., Mainou BA, Raab-Traub N (2004) Induction of Id1 and Id3 by latent membrane protein 1 of Epstein-Barr virus and regulation of p27/Kip and cyclin-dependent kinase 2 in rodent fibroblast transformation. J Virol 78: 13470–13478. pmid:15564458
- View Article
- PubMed/NCBI
- Google Scholar
15. McGeoch DJ, Davison AJ, Dolan A, Gatherer D, Sevilla-Raves EE (2008) Molecular Evolution of the Herpesvirales. In: Holland E, editor. Origin and Evolution of Viruses. SEcond ed. London: Academic Press. pp. 447–475.
16. Santpere G, Darre F, Blanco S, Alcami A, Villoslada P, et al. (2014) Genome-wide analysis of wild-type Epstein-Barr virus genomes derived from healthy individuals of the 1,000 Genomes Project. Genome Biol Evol 6: 846–860. pmid:24682154
- View Article
- PubMed/NCBI
- Google Scholar
17. Palser AL, Grayson NE, White RE, Corton C, Correia S, et al. (2015) Genome diversity of Epstein-Barr virus from multiple tumor types and normal infection. J Virol 89: 5222–5237. pmid:25787276
- View Article
- PubMed/NCBI
- Google Scholar
18. Renzette N, Somasundaran M, Brewster F, Coderre J, Weiss ER, et al. (2014) Epstein-Barr virus latent membrane protein 1 genetic variability in peripheral blood B cells and oropharyngeal fluids. J Virol 88: 3744–3755. pmid:24429365
- View Article
- PubMed/NCBI
- Google Scholar
19. Tzellos S, Farrell PJ (2012) Epstein-Barr Virus Sequence Variation—Biology and Disease Pathogens 1: 156–175. pmid:25436768
- View Article
- PubMed/NCBI
- Google Scholar
20. Chang CM, Yu KJ, Mbulaiteye SM, Hildesheim A, Bhatia K (2009) The extent of genetic diversity of Epstein-Barr virus and its geographic and disease patterns: a need for reappraisal. Virus Res 143: 209–221. pmid:19596032
- View Article
- PubMed/NCBI
- Google Scholar
21. Edwards RH, Seillier-Moiseiwitsch F, Raab-Traub N (1999) Signature amino acid changes in latent membrane protein 1 distinguish Epstein-Barr virus strains. Virology 261: 79–95. pmid:10441557
- View Article
- PubMed/NCBI
- Google Scholar
22. Feederle R, Klinke O, Kutikhin A, Poirey R, Tsai MH, et al. (2015) Epstein-Barr Virus: From the Detection of Sequence Polymorphisms to the Recognition of Viral Types. Curr Top Microbiol Immunol 390: 119–148. pmid:26424646
- View Article
- PubMed/NCBI
- Google Scholar
23. Neves M, Marinho-Dias J, Ribeiro J, Sousa H (2017) Epstein-Barr virus strains and variations: Geographic or disease-specific variants? J Med Virol 89: 373–387. pmid:27430663
- View Article
- PubMed/NCBI
- Google Scholar
24. Sample J, Young L, Martin B, Chatman T, Kieff E, et al. (1990) Epstein-Barr virus types 1 and 2 differ in their EBNA-3A, EBNA-3B, and EBNA-3C genes. J Virol 64: 4084–4092. pmid:2166806
- View Article
- PubMed/NCBI
- Google Scholar
25. Hall TA (1999) BioEdit: a user friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
- View Article
- Google Scholar
26. Posada D (2008) jModelTest: phylogenetic model averaging. Mol Biol Evol 25: 1253–1256. pmid:18397919
- View Article
- PubMed/NCBI
- Google Scholar
27. Guindon S, Gascuel O (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 52: 696–704. pmid:14530136
- View Article
- PubMed/NCBI
- Google Scholar
28. Lole KS, Bollinger RC, Paranjape RS, Gadkari D, Kulkarni SS, et al. (1999) Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. J Virol 73: 152–160. pmid:9847317
- View Article
- PubMed/NCBI
- Google Scholar
29. Bouckaert R, Heled J, Kuhnert D, Vaughan T, Wu CH, et al. (2014) BEAST 2: a software platform for Bayesian evolutionary analysis. PLoS Comput Biol 10: e1003537. pmid:24722319
- View Article
- PubMed/NCBI
- Google Scholar
30. Drummond AJ, Ho SY, Phillips MJ, Rambaut A (2006) Relaxed phylogenetics and dating with confidence. PLoS Biol 4: e88. pmid:16683862
- View Article
- PubMed/NCBI
- Google Scholar
31. Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol Biol 7: 214. pmid:17996036
- View Article
- PubMed/NCBI
- Google Scholar
32. Drummond AJ, Rambaut A, Shapiro B, Pybus OG (2005) Bayesian coalescent inference of past population dynamics from molecular sequences. Mol Biol Evol 22: 1185–1192. pmid:15703244
- View Article
- PubMed/NCBI
- Google Scholar
33. Lemey P, Rambaut A, Drummond AJ, Suchard MA (2009) Bayesian phylogeography finds its roots. PLoS Comput Biol 5: e1000520. pmid:19779555
- View Article
- PubMed/NCBI
- Google Scholar
34. Lin SX, Zong YS, Wu QL, Han AJ, Liang YJ (2003) Loss of an XhoI-site within N-terminal region of Epstein-Barr virus LMP1 gene in nasopharyngeal carcinoma. Ai Zheng 22: 1147–1151. pmid:14613641
- View Article
- PubMed/NCBI
- Google Scholar
35. Nguyen-Van D, Ernberg I, Phan-Thi Phi P, Tran-Thi C, Hu L (2008) Epstein-Barr virus genetic variation in Vietnamese patients with nasopharyngeal carcinoma: full-length analysis of LMP1. Virus Genes 37: 273–281. pmid:18663567
- View Article
- PubMed/NCBI
- Google Scholar
36. Zuercher E, Butticaz C, Wyniger J, Martinez R, Battegay M, et al. (2012) Genetic diversity of EBV-encoded LMP1 in the Swiss HIV Cohort Study and implication for NF-Kappab activation. PLoS One 7: e32168. pmid:22384168
- View Article
- PubMed/NCBI
- Google Scholar
37. Edwards RH, Sitki-Green D, Moore DT, Raab-Traub N (2004) Potential selection of LMP1 variants in nasopharyngeal carcinoma. J Virol 78: 868–881. pmid:14694118
- View Article
- PubMed/NCBI
- Google Scholar
38. Lorenzetti MA, Gantuz M, Altcheh J, De Matteo E, Chabay PA, et al. (2012) Distinctive Epstein-Barr virus variants associated with benign and malignant pediatric pathologies: LMP1 sequence characterization and linkage with other viral gene polymorphisms. J Clin Microbiol 50: 609–618. pmid:22205789
- View Article
- PubMed/NCBI
- Google Scholar
39. Walling DM, Shebib N, Weaver SC, Nichols CM, Flaitz CM, et al. (1999) The molecular epidemiology and evolution of Epstein-Barr virus: sequence variation and genetic recombination in the latent membrane protein-1 gene. J Infect Dis 179: 763–774. pmid:10068570
- View Article
- PubMed/NCBI
- Google Scholar
40. Duffy S, Holmes EC (2009) Validation of high rates of nucleotide substitution in geminiviruses: phylogenetic evidence from East African cassava mosaic viruses. J Gen Virol 90: 1539–1547. pmid:19264617
- View Article
- PubMed/NCBI
- Google Scholar
41. Ramsden C, Holmes EC, Charleston MA (2009) Hantavirus evolution in relation to its rodent and insectivore hosts: no evidence for codivergence. Mol Biol Evol 26: 143–153. pmid:18922760
- View Article
- PubMed/NCBI
- Google Scholar
42. Lorenzetti MA, Gantuz M, Altcheh J, De Matteo E, Chabay PA, et al. (2014) Epstein-Barr virus BZLF1 gene polymorphisms: malignancy related or geographically distributed variants? Clin Microbiol Infect 20: O861–869. pmid:24666405
- View Article
- PubMed/NCBI
- Google Scholar
43. Ai J, Xie Z, Liu C, Huang Z, Xu J (2012) Analysis of EBNA-1 and LMP-1 variants in diseases associated with EBV infection in Chinese children. Virol J 9: 13. pmid:22236445
- View Article
- PubMed/NCBI
- Google Scholar
44. Jin Y, Xie Z, Lu G, Yang S, Shen K (2010) Characterization of variants in the promoter of BZLF1 gene of EBV in nonmalignant EBV-associated diseases in Chinese children. Virol J 7: 92. pmid:20459737
- View Article
- PubMed/NCBI
- Google Scholar
45. Gulley ML, Eagan PA, Quintanilla-Martinez L, Picado AL, Smir BN, et al. (1994) Epstein-Barr virus DNA is abundant and monoclonal in the Reed-Sternberg cells of Hodgkin's disease: association with mixed cellularity subtype and Hispanic American ethnicity. Blood 83: 1595–1602. pmid:8123850
- View Article
- PubMed/NCBI
- Google Scholar
46. Sitki-Green D, Covington M, Raab-Traub N (2003) Compartmentalization and transmission of multiple epstein-barr virus strains in asymptomatic carriers. J Virol 77: 1840–1847. pmid:12525618
- View Article
- PubMed/NCBI
- Google Scholar
47. Sitki-Green DL, Edwards RH, Covington MM, Raab-Traub N (2004) Biology of Epstein-Barr virus during infectious mononucleosis. J Infect Dis 189: 483–492. pmid:14745706
- View Article
- PubMed/NCBI
- Google Scholar
48. Tierney RJ, Edwards RH, Sitki-Green D, Croom-Carter D, Roy S, et al. (2006) Multiple Epstein-Barr virus strains in patients with infectious mononucleosis: comparison of ex vivo samples with in vitro isolates by use of heteroduplex tracking assays. J Infect Dis 193: 287–297. pmid:16362894
- View Article
- PubMed/NCBI
- Google Scholar
49. Gantuz M, Lorenzetti MA, Altcheh J, De Matteo E, Moscatelli G, et al. (2013) LMP1 promoter sequence analysis in Epstein Barr virus pediatric infection reveals preferential circulation of B95.8 related variants in Argentina. Infect Genet Evol 14: 275–281. pmid:23305886
- View Article
- PubMed/NCBI
- Google Scholar
50. Ikeda T, Kobayashi R, Kogashiwa Y, Matsuda T, Kohno N (2014) Epstein-barr virus diversity in immunocompetent healthy persons: Reassessment of the distribution of genetic variants. J Med Virol.
- View Article
- Google Scholar
51. Knecht H, Berger C, Rothenberger S, Odermatt BF, Brousset P (2001) The role of Epstein-Barr virus in neoplastic transformation. Oncology 60: 289–302.
- View Article
- Google Scholar
52. Guiretti DM, Chabay PA, Valva P, Stefanoff CG, Barros MH, et al. (2007) Structural variability of the carboxy-terminus of Epstein-Barr virus encoded latent membrane protein 1 gene in Hodgkin's lymphomas. J Med Virol 79: 1730–1722. pmid:17854036
- View Article
- PubMed/NCBI
- Google Scholar
53. Burrows JM, Bromham L, Woolfit M, Piganeau G, Tellam J, et al. (2004) Selection pressure-driven evolution of the Epstein-Barr virus-encoded oncogene LMP1 in virus isolates from Southeast Asia. J Virol 78: 7131–7137. pmid:15194789
- View Article
- PubMed/NCBI
- Google Scholar
54. Chiara M, Manzari C, Lionetti C, Mechelli R, Anastasiadou E, et al. (2016) Geographic Population Structure in Epstein-Barr Virus Revealed by Comparative Genomics. Genome Biol Evol 8: 3284–3291. pmid:27635051
- View Article
- PubMed/NCBI
- Google Scholar
55. Holmes EC (2008) Evolutionary history and phylogeography of human viruses. Annu Rev Microbiol 62: 307–328. pmid:18785840
- View Article
- PubMed/NCBI
- Google Scholar
56. Kolb AW, Ane C, Brandt CR (2013) Using HSV-1 genome phylogenetics to track past human migrations. PLoS One 8: e76267. pmid:24146849
- View Article
- PubMed/NCBI
- Google Scholar
57. McGeoch DJ, Cook S (1994) Molecular phylogeny of the alphaherpesvirinae subfamily and a proposed evolutionary timescale. J Mol Biol 238: 9–22. pmid:8145260
- View Article
- PubMed/NCBI
- Google Scholar
58. Firth C, Kitchen A, Shapiro B, Suchard MA, Holmes EC, et al. (2010) Using time-structured data to estimate evolutionary rates of double-stranded DNA viruses. Mol Biol Evol 27: 2038–2051. pmid:20363828
- View Article
- PubMed/NCBI
- Google Scholar
59. Patricio AR, Herbst LH, Duarte A, Velez-Zuazo X, Santos Loureiro N, et al. (2012) Global phylogeography and evolution of chelonid fibropapilloma-associated herpesvirus. J Gen Virol 93: 1035–1045. pmid:22258862
- View Article
- PubMed/NCBI
- Google Scholar
60. Shackelton LA, Rambaut A, Pybus OG, Holmes EC (2006) JC virus evolution and its association with human populations. J Virol 80: 9928–9933. pmid:17005670
- View Article
- PubMed/NCBI
- Google Scholar
61. Avena S, Via M, Ziv E, Perez-Stable EJ, Gignoux CR, et al. (2012) Heterogeneity in genetic admixture across different regions of Argentina. PLoS One 7: e34695. pmid:22506044
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Epstein MA, Achong BG, Barr YM (1964) Virus Particles in Cultured Lymphoblasts from Burkitt's Lymphoma. Lancet 1: 702–703. pmid:14107961
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. IARC (1997) IARC Monographs on the evaluation of carcinogenic risks to humans: Epstein-Barr virus and Kaposi’s sarcoma herpesvirus/herpesvirus 8. Lyon: IARC press.

[ref3] 3. Chabay PA, Preciado MV (2013) EBV primary infection in childhood and its relation to B-cell lymphoma development: A mini-review from a developing region. Int J Cancer.
View Article
Google Scholar

[7] View Article

[8] Google Scholar

[ref4] 4. Chan KH, Tam JS, Peiris JS, Seto WH, Ng MH (2001) Epstein-Barr virus (EBV) infection in infancy. J Clin Virol 21: 57–62. pmid:11255098
View Article
PubMed/NCBI
Google Scholar

[10] View Article

[11] PubMed/NCBI

[12] Google Scholar

[ref5] 5. Vetsika EK, Callan M (2004) Infectious mononucleosis and Epstein-Barr virus. Expert Rev Mol Med 6: 1–16.
View Article
Google Scholar

[14] View Article

[15] Google Scholar

[ref6] 6. Rickinson AB, Kieff ED (2007) Epstein Barr virus. In: D M Knipe PMH, editor. Fields Virology. 5th ed. Philadelphia: Lippincott Williams & Wilkins. pp. 2655–2700.

[ref7] 7. Stevenson D, Charalambous C, Wilson JB (2005) Epstein-Barr virus latent membrane protein 1 (CAO) up-regulates VEGF and TGF alpha concomitant with hyperlasia, with subsequent up-regulation of p16 and MMP9. Cancer Res 65: 8826–8835. pmid:16204053
View Article
PubMed/NCBI
Google Scholar

[18] View Article

[19] PubMed/NCBI

[20] Google Scholar

[ref8] 8. Wilson JB, Bell JL, Levine AJ (1996) Expression of Epstein-Barr virus nuclear antigen-1 induces B cell neoplasia in transgenic mice. EMBO J 15: 3117–3126. pmid:8670812
View Article
PubMed/NCBI
Google Scholar

[22] View Article

[23] PubMed/NCBI

[24] Google Scholar

[ref9] 9. Izumi KM, Kaye KM, Kieff ED (1994) Epstein-Barr virus recombinant molecular genetic analysis of the LMP1 amino-terminal cytoplasmic domain reveals a probable structural role, with no component essential for primary B-lymphocyte growth transformation. J Virol 68: 4369–4376. pmid:8207810
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref10] 10. Higuchi M, Izumi KM, Kieff E (2001) Epstein-Barr virus latent-infection membrane proteins are palmitoylated and raft-associated: protein 1 binds to the cytoskeleton through TNF receptor cytoplasmic factors. Proc Natl Acad Sci U S A 98: 4675–4680. pmid:11296297
View Article
PubMed/NCBI
Google Scholar

[30] View Article

[31] PubMed/NCBI

[32] Google Scholar

[ref11] 11. Meckes DG Jr., Menaker NF, Raab-Traub N (2013) Epstein-Barr virus LMP1 modulates lipid raft microdomains and the vimentin cytoskeleton for signal transduction and transformation. J Virol 87: 1301–1311. pmid:23152522
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref12] 12. Soni V, Yasui T, Cahir-McFarland E, Kieff E (2006) LMP1 transmembrane domain 1 and 2 (TM1-2) FWLY mediates intermolecular interactions with TM3-6 to activate NF-kappaB. J Virol 80: 10787–10793. pmid:16928765
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref13] 13. Yasui T, Luftig M, Soni V, Kieff E (2004) Latent infection membrane protein transmembrane FWLY is critical for intermolecular interaction, raft localization, and signaling. Proc Natl Acad Sci U S A 101: 278–283. pmid:14695890
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref14] 14. Everly DN Jr., Mainou BA, Raab-Traub N (2004) Induction of Id1 and Id3 by latent membrane protein 1 of Epstein-Barr virus and regulation of p27/Kip and cyclin-dependent kinase 2 in rodent fibroblast transformation. J Virol 78: 13470–13478. pmid:15564458
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref15] 15. McGeoch DJ, Davison AJ, Dolan A, Gatherer D, Sevilla-Raves EE (2008) Molecular Evolution of the Herpesvirales. In: Holland E, editor. Origin and Evolution of Viruses. SEcond ed. London: Academic Press. pp. 447–475.

[ref16] 16. Santpere G, Darre F, Blanco S, Alcami A, Villoslada P, et al. (2014) Genome-wide analysis of wild-type Epstein-Barr virus genomes derived from healthy individuals of the 1,000 Genomes Project. Genome Biol Evol 6: 846–860. pmid:24682154
View Article
PubMed/NCBI
Google Scholar

[51] View Article

[52] PubMed/NCBI

[53] Google Scholar

[ref17] 17. Palser AL, Grayson NE, White RE, Corton C, Correia S, et al. (2015) Genome diversity of Epstein-Barr virus from multiple tumor types and normal infection. J Virol 89: 5222–5237. pmid:25787276
View Article
PubMed/NCBI
Google Scholar

[55] View Article

[56] PubMed/NCBI

[57] Google Scholar

[ref18] 18. Renzette N, Somasundaran M, Brewster F, Coderre J, Weiss ER, et al. (2014) Epstein-Barr virus latent membrane protein 1 genetic variability in peripheral blood B cells and oropharyngeal fluids. J Virol 88: 3744–3755. pmid:24429365
View Article
PubMed/NCBI
Google Scholar

[59] View Article

[60] PubMed/NCBI

[61] Google Scholar

[ref19] 19. Tzellos S, Farrell PJ (2012) Epstein-Barr Virus Sequence Variation—Biology and Disease Pathogens 1: 156–175. pmid:25436768
View Article
PubMed/NCBI
Google Scholar

[63] View Article

[64] PubMed/NCBI

[65] Google Scholar

[ref20] 20. Chang CM, Yu KJ, Mbulaiteye SM, Hildesheim A, Bhatia K (2009) The extent of genetic diversity of Epstein-Barr virus and its geographic and disease patterns: a need for reappraisal. Virus Res 143: 209–221. pmid:19596032
View Article
PubMed/NCBI
Google Scholar

[67] View Article

[68] PubMed/NCBI

[69] Google Scholar

[ref21] 21. Edwards RH, Seillier-Moiseiwitsch F, Raab-Traub N (1999) Signature amino acid changes in latent membrane protein 1 distinguish Epstein-Barr virus strains. Virology 261: 79–95. pmid:10441557
View Article
PubMed/NCBI
Google Scholar

[71] View Article

[72] PubMed/NCBI

[73] Google Scholar

[ref22] 22. Feederle R, Klinke O, Kutikhin A, Poirey R, Tsai MH, et al. (2015) Epstein-Barr Virus: From the Detection of Sequence Polymorphisms to the Recognition of Viral Types. Curr Top Microbiol Immunol 390: 119–148. pmid:26424646
View Article
PubMed/NCBI
Google Scholar

[75] View Article

[76] PubMed/NCBI

[77] Google Scholar

[ref23] 23. Neves M, Marinho-Dias J, Ribeiro J, Sousa H (2017) Epstein-Barr virus strains and variations: Geographic or disease-specific variants? J Med Virol 89: 373–387. pmid:27430663
View Article
PubMed/NCBI
Google Scholar

[79] View Article

[80] PubMed/NCBI

[81] Google Scholar

[ref24] 24. Sample J, Young L, Martin B, Chatman T, Kieff E, et al. (1990) Epstein-Barr virus types 1 and 2 differ in their EBNA-3A, EBNA-3B, and EBNA-3C genes. J Virol 64: 4084–4092. pmid:2166806
View Article
PubMed/NCBI
Google Scholar

[83] View Article

[84] PubMed/NCBI

[85] Google Scholar

[ref25] 25. Hall TA (1999) BioEdit: a user friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
View Article
Google Scholar

[87] View Article

[88] Google Scholar

[ref26] 26. Posada D (2008) jModelTest: phylogenetic model averaging. Mol Biol Evol 25: 1253–1256. pmid:18397919
View Article
PubMed/NCBI
Google Scholar

[90] View Article

[91] PubMed/NCBI

[92] Google Scholar

[ref27] 27. Guindon S, Gascuel O (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 52: 696–704. pmid:14530136
View Article
PubMed/NCBI
Google Scholar

[94] View Article

[95] PubMed/NCBI

[96] Google Scholar

[ref28] 28. Lole KS, Bollinger RC, Paranjape RS, Gadkari D, Kulkarni SS, et al. (1999) Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. J Virol 73: 152–160. pmid:9847317
View Article
PubMed/NCBI
Google Scholar

[98] View Article

[99] PubMed/NCBI

[100] Google Scholar

[ref29] 29. Bouckaert R, Heled J, Kuhnert D, Vaughan T, Wu CH, et al. (2014) BEAST 2: a software platform for Bayesian evolutionary analysis. PLoS Comput Biol 10: e1003537. pmid:24722319
View Article
PubMed/NCBI
Google Scholar

[102] View Article

[103] PubMed/NCBI

[104] Google Scholar

[ref30] 30. Drummond AJ, Ho SY, Phillips MJ, Rambaut A (2006) Relaxed phylogenetics and dating with confidence. PLoS Biol 4: e88. pmid:16683862
View Article
PubMed/NCBI
Google Scholar

[106] View Article

[107] PubMed/NCBI

[108] Google Scholar

[ref31] 31. Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol Biol 7: 214. pmid:17996036
View Article
PubMed/NCBI
Google Scholar

[110] View Article

[111] PubMed/NCBI

[112] Google Scholar

[ref32] 32. Drummond AJ, Rambaut A, Shapiro B, Pybus OG (2005) Bayesian coalescent inference of past population dynamics from molecular sequences. Mol Biol Evol 22: 1185–1192. pmid:15703244
View Article
PubMed/NCBI
Google Scholar

[114] View Article

[115] PubMed/NCBI

[116] Google Scholar

[ref33] 33. Lemey P, Rambaut A, Drummond AJ, Suchard MA (2009) Bayesian phylogeography finds its roots. PLoS Comput Biol 5: e1000520. pmid:19779555
View Article
PubMed/NCBI
Google Scholar

[118] View Article

[119] PubMed/NCBI

[120] Google Scholar

[ref34] 34. Lin SX, Zong YS, Wu QL, Han AJ, Liang YJ (2003) Loss of an XhoI-site within N-terminal region of Epstein-Barr virus LMP1 gene in nasopharyngeal carcinoma. Ai Zheng 22: 1147–1151. pmid:14613641
View Article
PubMed/NCBI
Google Scholar

[122] View Article

[123] PubMed/NCBI

[124] Google Scholar

[ref35] 35. Nguyen-Van D, Ernberg I, Phan-Thi Phi P, Tran-Thi C, Hu L (2008) Epstein-Barr virus genetic variation in Vietnamese patients with nasopharyngeal carcinoma: full-length analysis of LMP1. Virus Genes 37: 273–281. pmid:18663567
View Article
PubMed/NCBI
Google Scholar

[126] View Article

[127] PubMed/NCBI

[128] Google Scholar

[ref36] 36. Zuercher E, Butticaz C, Wyniger J, Martinez R, Battegay M, et al. (2012) Genetic diversity of EBV-encoded LMP1 in the Swiss HIV Cohort Study and implication for NF-Kappab activation. PLoS One 7: e32168. pmid:22384168
View Article
PubMed/NCBI
Google Scholar

[130] View Article

[131] PubMed/NCBI

[132] Google Scholar

[ref37] 37. Edwards RH, Sitki-Green D, Moore DT, Raab-Traub N (2004) Potential selection of LMP1 variants in nasopharyngeal carcinoma. J Virol 78: 868–881. pmid:14694118
View Article
PubMed/NCBI
Google Scholar

[134] View Article

[135] PubMed/NCBI

[136] Google Scholar

[ref38] 38. Lorenzetti MA, Gantuz M, Altcheh J, De Matteo E, Chabay PA, et al. (2012) Distinctive Epstein-Barr virus variants associated with benign and malignant pediatric pathologies: LMP1 sequence characterization and linkage with other viral gene polymorphisms. J Clin Microbiol 50: 609–618. pmid:22205789
View Article
PubMed/NCBI
Google Scholar

[138] View Article

[139] PubMed/NCBI

[140] Google Scholar

[ref39] 39. Walling DM, Shebib N, Weaver SC, Nichols CM, Flaitz CM, et al. (1999) The molecular epidemiology and evolution of Epstein-Barr virus: sequence variation and genetic recombination in the latent membrane protein-1 gene. J Infect Dis 179: 763–774. pmid:10068570
View Article
PubMed/NCBI
Google Scholar

[142] View Article

[143] PubMed/NCBI

[144] Google Scholar

[ref40] 40. Duffy S, Holmes EC (2009) Validation of high rates of nucleotide substitution in geminiviruses: phylogenetic evidence from East African cassava mosaic viruses. J Gen Virol 90: 1539–1547. pmid:19264617
View Article
PubMed/NCBI
Google Scholar

[146] View Article

[147] PubMed/NCBI

[148] Google Scholar

[ref41] 41. Ramsden C, Holmes EC, Charleston MA (2009) Hantavirus evolution in relation to its rodent and insectivore hosts: no evidence for codivergence. Mol Biol Evol 26: 143–153. pmid:18922760
View Article
PubMed/NCBI
Google Scholar

[150] View Article

[151] PubMed/NCBI

[152] Google Scholar

[ref42] 42. Lorenzetti MA, Gantuz M, Altcheh J, De Matteo E, Chabay PA, et al. (2014) Epstein-Barr virus BZLF1 gene polymorphisms: malignancy related or geographically distributed variants? Clin Microbiol Infect 20: O861–869. pmid:24666405
View Article
PubMed/NCBI
Google Scholar

[154] View Article

[155] PubMed/NCBI

[156] Google Scholar

[ref43] 43. Ai J, Xie Z, Liu C, Huang Z, Xu J (2012) Analysis of EBNA-1 and LMP-1 variants in diseases associated with EBV infection in Chinese children. Virol J 9: 13. pmid:22236445
View Article
PubMed/NCBI
Google Scholar

[158] View Article

[159] PubMed/NCBI

[160] Google Scholar

[ref44] 44. Jin Y, Xie Z, Lu G, Yang S, Shen K (2010) Characterization of variants in the promoter of BZLF1 gene of EBV in nonmalignant EBV-associated diseases in Chinese children. Virol J 7: 92. pmid:20459737
View Article
PubMed/NCBI
Google Scholar

[162] View Article

[163] PubMed/NCBI

[164] Google Scholar

[ref45] 45. Gulley ML, Eagan PA, Quintanilla-Martinez L, Picado AL, Smir BN, et al. (1994) Epstein-Barr virus DNA is abundant and monoclonal in the Reed-Sternberg cells of Hodgkin's disease: association with mixed cellularity subtype and Hispanic American ethnicity. Blood 83: 1595–1602. pmid:8123850
View Article
PubMed/NCBI
Google Scholar

[166] View Article

[167] PubMed/NCBI

[168] Google Scholar

[ref46] 46. Sitki-Green D, Covington M, Raab-Traub N (2003) Compartmentalization and transmission of multiple epstein-barr virus strains in asymptomatic carriers. J Virol 77: 1840–1847. pmid:12525618
View Article
PubMed/NCBI
Google Scholar

[170] View Article

[171] PubMed/NCBI

[172] Google Scholar

[ref47] 47. Sitki-Green DL, Edwards RH, Covington MM, Raab-Traub N (2004) Biology of Epstein-Barr virus during infectious mononucleosis. J Infect Dis 189: 483–492. pmid:14745706
View Article
PubMed/NCBI
Google Scholar

[174] View Article

[175] PubMed/NCBI

[176] Google Scholar

[ref48] 48. Tierney RJ, Edwards RH, Sitki-Green D, Croom-Carter D, Roy S, et al. (2006) Multiple Epstein-Barr virus strains in patients with infectious mononucleosis: comparison of ex vivo samples with in vitro isolates by use of heteroduplex tracking assays. J Infect Dis 193: 287–297. pmid:16362894
View Article
PubMed/NCBI
Google Scholar

[178] View Article

[179] PubMed/NCBI

[180] Google Scholar

[ref49] 49. Gantuz M, Lorenzetti MA, Altcheh J, De Matteo E, Moscatelli G, et al. (2013) LMP1 promoter sequence analysis in Epstein Barr virus pediatric infection reveals preferential circulation of B95.8 related variants in Argentina. Infect Genet Evol 14: 275–281. pmid:23305886
View Article
PubMed/NCBI
Google Scholar

[182] View Article

[183] PubMed/NCBI

[184] Google Scholar

[ref50] 50. Ikeda T, Kobayashi R, Kogashiwa Y, Matsuda T, Kohno N (2014) Epstein-barr virus diversity in immunocompetent healthy persons: Reassessment of the distribution of genetic variants. J Med Virol.
View Article
Google Scholar

[186] View Article

[187] Google Scholar

[ref51] 51. Knecht H, Berger C, Rothenberger S, Odermatt BF, Brousset P (2001) The role of Epstein-Barr virus in neoplastic transformation. Oncology 60: 289–302.
View Article
Google Scholar

[189] View Article

[190] Google Scholar

[ref52] 52. Guiretti DM, Chabay PA, Valva P, Stefanoff CG, Barros MH, et al. (2007) Structural variability of the carboxy-terminus of Epstein-Barr virus encoded latent membrane protein 1 gene in Hodgkin's lymphomas. J Med Virol 79: 1730–1722. pmid:17854036
View Article
PubMed/NCBI
Google Scholar

[192] View Article

[193] PubMed/NCBI

[194] Google Scholar

[ref53] 53. Burrows JM, Bromham L, Woolfit M, Piganeau G, Tellam J, et al. (2004) Selection pressure-driven evolution of the Epstein-Barr virus-encoded oncogene LMP1 in virus isolates from Southeast Asia. J Virol 78: 7131–7137. pmid:15194789
View Article
PubMed/NCBI
Google Scholar

[196] View Article

[197] PubMed/NCBI

[198] Google Scholar

[ref54] 54. Chiara M, Manzari C, Lionetti C, Mechelli R, Anastasiadou E, et al. (2016) Geographic Population Structure in Epstein-Barr Virus Revealed by Comparative Genomics. Genome Biol Evol 8: 3284–3291. pmid:27635051
View Article
PubMed/NCBI
Google Scholar

[200] View Article

[201] PubMed/NCBI

[202] Google Scholar

[ref55] 55. Holmes EC (2008) Evolutionary history and phylogeography of human viruses. Annu Rev Microbiol 62: 307–328. pmid:18785840
View Article
PubMed/NCBI
Google Scholar

[204] View Article

[205] PubMed/NCBI

[206] Google Scholar

[ref56] 56. Kolb AW, Ane C, Brandt CR (2013) Using HSV-1 genome phylogenetics to track past human migrations. PLoS One 8: e76267. pmid:24146849
View Article
PubMed/NCBI
Google Scholar

[208] View Article

[209] PubMed/NCBI

[210] Google Scholar

[ref57] 57. McGeoch DJ, Cook S (1994) Molecular phylogeny of the alphaherpesvirinae subfamily and a proposed evolutionary timescale. J Mol Biol 238: 9–22. pmid:8145260
View Article
PubMed/NCBI
Google Scholar

[212] View Article

[213] PubMed/NCBI

[214] Google Scholar

[ref58] 58. Firth C, Kitchen A, Shapiro B, Suchard MA, Holmes EC, et al. (2010) Using time-structured data to estimate evolutionary rates of double-stranded DNA viruses. Mol Biol Evol 27: 2038–2051. pmid:20363828
View Article
PubMed/NCBI
Google Scholar

[216] View Article

[217] PubMed/NCBI

[218] Google Scholar

[ref59] 59. Patricio AR, Herbst LH, Duarte A, Velez-Zuazo X, Santos Loureiro N, et al. (2012) Global phylogeography and evolution of chelonid fibropapilloma-associated herpesvirus. J Gen Virol 93: 1035–1045. pmid:22258862
View Article
PubMed/NCBI
Google Scholar

[220] View Article

[221] PubMed/NCBI

[222] Google Scholar

[ref60] 60. Shackelton LA, Rambaut A, Pybus OG, Holmes EC (2006) JC virus evolution and its association with human populations. J Virol 80: 9928–9933. pmid:17005670
View Article
PubMed/NCBI
Google Scholar

[224] View Article

[225] PubMed/NCBI

[226] Google Scholar

[ref61] 61. Avena S, Via M, Ziv E, Perez-Stable EJ, Gignoux CR, et al. (2012) Heterogeneity in genetic admixture across different regions of Argentina. PLoS One 7: e34695. pmid:22506044
View Article
PubMed/NCBI
Google Scholar

[228] View Article

[229] PubMed/NCBI

[230] Google Scholar

Figures

Abstract

Aim

Methods

Results

Conclusions

Introduction

Materials and methods

Patients and samples

Serological assays

EBERs in situ hybridization

DNA extraction and amplification

Sequence analysis

a) Phylogenetic analysis.

b) Recombination analysis.

c) Phylogeographic analysis.

d) Co-estimate of substitution rate and the time to most recent common ancestor (tMRCA).

Statistical analysis

Results

Polymorphisms characterization

LMP1 variants characterization

Recombination analysis

Phylogeographical analysis

LMP1 molecular evolution

Discussion

Supporting information

S1 Fig. Positional entropy.

S2 Fig. Randomization test.

S1 Table. Patient’s isolates description.

S2 Table. Evolution model parameters for the different phylogenetic reconstructions as estimated with jModelTest.

S3 Table. Results of Bayesian tips-significance tests (BaTS).

S4 Table. Mean and 95% HPD of the Bayesian Posterior Estimates of Substitution Rate (subs/site/year) and tMRCA.

Acknowledgments

Author Contributions

References