Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Cross-Neutralizing Antibodies in HIV-1 Individuals Infected by Subtypes B, F1, C or the B/Bbr Variant in Relation to the Genetics and Biochemical Characteristics of the env Gene

Cross-Neutralizing Antibodies in HIV-1 Individuals Infected by Subtypes B, F1, C or the B/Bbr Variant in Relation to the Genetics and Biochemical Characteristics of the env Gene

  • Dalziza Victalina de Almeida, 
  • Karine Venegas Macieira, 
  • Beatriz Gilda Jegerhorn Grinsztejn, 
  • Valdiléa Gonçalves Veloso dos Santos, 
  • Monick Lindenmeyer Guimarães
PLOS
x

Abstract

Various HIV-1 env genetic and biochemical features impact the elicitation of cross-reactive neutralizing antibodies in natural infections. Thus, we aimed to investigate cross-neutralizing antibodies in individuals infected with HIV-1 env subtypes B, F1, C or the B/Bbr variant as well as env characteristics. Therefore, plasma samples from Brazilian chronically HIV-1 infected individuals were submitted to the TZM-bl neutralization assay. We also analyzed putative N-glycosylation sites (PNGLs) and the size of gp120 variable domains in the context of HIV-1 subtypes prevalent in Brazil. We observed a greater breadth and potency of the anti-Env neutralizing response in individuals infected with the F1 or B HIV-1 subtypes compared with the C subtype and the variant B/Bbr. We observed greater V1 B/Bbr and smaller V4 F1 than those of other subtypes (p<0.005), however neither was there a correlation verified between the variable region length and neutralization potency, nor between PNLG and HIV-1 subtypes. The enrichment of W at top of V3 loop in weak neutralizing response viruses and the P in viruses with higher neutralization susceptibility was statistically significant (p = 0.013). Some other signatures sites were associated to HIV-1 subtype-specific F1 and B/Bbr samples might influence in the distinct neutralizing response. These results indicate that a single amino acid substitution may lead to a distinct conformational exposure or load in the association domain of the trimer of gp120 and interfere with the induction power of the neutralizing response, which affects the sensitivity of the neutralizing antibody and has significant implications for vaccine design.

Introduction

A vaccine that aims to elicit strong HIV neutralizing antibodies (nAb) must overcome their genetic variability at least at the antigenic level. The neutralizing activity induced by HIV-1 should aid in the understanding of the immune response elicited by vaccine candidates [13]. Several studies have reported that antibodies from plasma obtained during chronic HIV-1 infection could potently neutralize primary isolates of HIV-1 and were able to neutralize genetically diverse and distinct HIV-1 strains [48]. These nAb primarily recognize five different epitopes on Env, including the CD4 biding site (CD4bs), V1/V2 loop, V3 loop, interface gp120/gp41 and the membrane-proximal external region (MPER) on gp41 [912].

In response to the constant HIV-1 genetic evolution, the epitope specificity of the nAb that is gradually developed during infection also influences the breadth of the nAb responses [13,14]. Some viral features, such as variable loop lengths and the number of glycosylation motifs, are associated with the neutralization breadth [3,1517]. Therefore, the characterization of neutralization specificities for distinct subtypes is a difficult but critical process to accumulate knowledge and develop a successful vaccine.

In Brazil, HIV-1 subtypes B, their B/Bbr variants, F1 and C, as well as diverse recombinants evolving these subtypes are prevalent [18,19]. The B/Bbr variant, which represents 37 to 57% of HIV-1 subtype B strains in the country, differs from the pandemic subtype B by the substitution of the amino acid proline by a tryptophan at the top of the V3 loop of gp120 (GWGR instead of the classical GPGR) [18,2022] and its antigenic characteristics [20,23,24]. HIV-1 subtype C is the most prevalent worldwide and is involved in 20 to 80% of HIV-1 infections in Southern Brazil [25]. This subtype is spreading in other Brazilian geographic regions, and most of these sequences formed a monophyletic cluster [26]. The F1 subtype has a prevalence of 8.4 to 24.4% in the Southeastern region of Brazil [27]. The F1 subtype is also highly prevalent in Romania [28] and Galicia [29] despite its reduced prevalence worldwide. In this context, the present study aimed to investigate possible env genetic characteristics related to broad and potent neutralization in plasma from individuals infected with HIV-1 predominant subtypes in Brazil.

Materials and Methods

Study group

HIV-1-infected patients undergoing clinical follow-up at the Evandro Chagas Nacional Institute of Infectious Diseases from the Oswaldo Cruz Foundation (INI-FIOCRUZ) were invited to participate in this study and selected for enrollment. The main criteria for inclusion were: having at least 6 months of HIV-1 infection, and plasma samples representing the following HIV-1 Brazilian subtypes (B, B/Bbr, F1 and C), which have been previously classified in other studies from our group, based on C2-V3 env region subtyping. All protocols in the present study were performed in accordance with institutional guidelines and resolutions and were approved by the Oswaldo Cruz Institute Ethics Committee (CAAE: 01080112.4.0000.5248). However, we were not able to obtain informed consent for all participants included in this study, but plasma samples have been de-identified prior to analysis in order to maintain participant confidentiality. Moreover, a confidentiality letter was signed by the research team responsible for the experiments, thus ensuring the patients anonymity.

Full-length env Sequencing

The env gene was amplified from PBMC by touchdown PCR [30] under the following conditions: 94°C×2’ for one cycle; 94°C×30”, 64°C×45” (decreasing 0.2°C per cycle) and 68°C×2’ for 20 cycles; 94°C×30”, 60°C×45”, 68°Cx2’ for 20 cycles and a final extension cycle of 68°Cx10’. The outer primers were BC1s (AGAAATGGAGCCAGTAGATC)/envM, and the inner primers were envAtopo and envM [31]. Sequences were generated using the BigDye Terminator v.3.1 Cycle Sequencing Ready Reaction Kit with an automated ABI 3100 Genetic Analyzer (Applied Biosystems, CA, USA).

Sequence analysis

Sequences were assembled and edited using the SeqMan software from the package DNASTAR Lasergene (MA, USA). Nucleotide and deduced amino acid sequences were initially aligned using ClustalW on Mega 6 [32] and then re-aligned with HXB2 on Gene Cutter tools of the HIV sequence database from Los Alamos National Laboratory (LANL). HIV-1 subtyping was obtained via the REGA HIV-1 subtyping tool [33] and confirmed using neighbor-joining phylogenetic trees from the env region. We also used the programs Variable Region Characteristics, N-linked glycosylation sites (PNLG) [34], and CATNAP (Compile, Analyze and Tally NAb Panels) [35]. For the analysis of HIV-1-specific signatures, VESPA (viral epidemiology signature pattern analysis) was used. All programs were available from LANL. For the analysis of HIV-1 subtype-specific and neutralization potency signatures, thresholds of 1.0 and 0.6 were used, respectively.

Sequence data

The 51 HIV-1 sequences obtained in the present study are available in the GenBank database (accession numbers KX181891-KX181941‏).

Pseudovirus (psV)

The psVB (plasmid Rhpa42597) [16] and psVC (plasmid Cap210.08) [15] from the NIH neutralization panel were selected based on minor genetic env distances to the Brazilian HIV-1 subtype B and C consensus 0.24 and 0.19 of divergence, respectively. Two pseudoviruses (psVGWGR and psVF1) were produced based on the consensus sequence obtained from Dambe software (http://dambe.bio.uottawa.ca/dambe.asp) using HIV-1 Env B/Bbr (n = 15) and F1 (n = 11) sequences. The psVGPGR was produced by site-directed mutagenesis of the tryptophan from the B/Bbr consensus sequence to the proline on the top of the V3 loop of gp120. All three consensus pseudovirus sequences were synthesized by GenScript (NJ, USA), and amplicons were cloned into the expression vector pcDNA3.1DV5-His TOPO TA (Thermo-Fisher Scientific, MA, USA). The plasmids were expanded in E. coli Top10, extracted using Wizard Plus Miniprep DNA Purification Systems (Promega, WI, USA) and quantified in a Nanodrop (Wilmington, USA) spectrophotometer. The viral stocks of single round HIV-1 env psVs infection were produced by co-transfecting 293T/17 cells (ATCC, VA, USA) (70% of confluent cells in T75) with 4 μg of an HIV-1 rev/env expression plasmid and 10 μg of pSG3ΔEnv. For transfections, 50 μL P3000 reagent and 35 μL Lipofectamine 3000 (Lipofectamine® 3000 reagent, Thermo-Fischer Scientific, MA, USA) were used in 715 μL of Opti-MEM® Reduce Serum Medium for each mix. After optimization, we followed proceedings according to the manufacturer’s recommendation. Using env amplification, the psVs were sequenced to confirm that they exactly matched the initial sequences.

Neutralization Assay

The 50% tissue culture infectious dose (TCID50) for each pseudovirus preparation was determined by infection of TZM-bl cells as previously described [16]. To determine the capacity of the assay to discriminate between neutralizing antibodies and possible plasma artifacts, we used normal human plasma samples and the plasmid murine leukemia virus (MuLV) env as controls. Plasma was inactivated after the neutralization assay at 56°C x 60’. TZM-bl cells were expanded and stored following the instructions provided at http://www.hiv.lanl.gov/content/nab-reference-strains/html/home.htm. TZM-bl is a HeLa cell that was engineered to express CD4 and CCR5 [36] and contains integrated reporter genes for firefly luciferase and Escherichia coli β-galactosidase under the control of an HIV-1 LTR [37], permitting sensitive and accurate measurements of the HIV-1 infection. The psVs (200 TCID50) were incubated with plasma in triplicate and added to TZM-bl cells in the presence of DEAE-dextran 20 μg/mL. Neutralizing antibodies titers were expressed by the reciprocal of plasma dilutions. The 50% inhibitory concentration (IC50) of the monoclonal antibodies (mAbs) 2F5, 2G12, 447-D, and CH01 and soluble CD4 inhibitor were used at a given range of dilutions (final concentration: 10 μg/mL), this experiment was repeated three times to generate the mean value. These values were measured and analyzed with Excel-based Macro [38]. The mAbs and sCD4 were obtained from the AIDS Research and Reference Program, Division of AIDS (DAIDS), National Institute of Allergy and Infectious Diseases (NIAID), National Institutes of Health (NIH).

Statistics

The statistical analysis was performed using GraphPad Prism (V-5.01-GraphPad, USA). One-away ANOVA followed by Bonferroni's multiple comparisons test for correction were used to analyze significant differences between the means of geometric media sensibility (GMS) according to the psV and the nAb titers of the different plasma samples grouped by subtype and neutralization potency. Additionally, one-way ANOVA followed by Dunnett’s multiple comparison tests was used to evaluate the differences in the length of variable regions and the PNLG of gp160. To indicate that there might be significant associations between amino acids in particular positions in the alignment and the neutralization susceptibility of a given Env, contingency tables and respective statistics were used (i.e. chi-square or Fisher’s exact test for categorical variables). P-values less than 0.05 were considered statistically significant.

Results

HIV-1 env diversity and phylogeny

Based on the REGA HIV subtyping tool and in the phylogenetic analyses of the 60 full-length env sequences (2.5 kb) from HIV-1 participants, 26 were reclassified as HIV-1 subtype B (12 HIV-1 B pandemic and 14 HIV-1 B/Bbr), 14 C subtype and 11 subtype F1 (Fig 1). In addition, nine subtypes, which were classified as HIV-1 unique recombinant forms (8 BF1 and 1 BC) were excluded from subsequent analysis. The following genetic divergence intersubypes/variants were observed: B and B/Bbr was 0.19, B-F1 = 0.31, B-C = 0.33, F1-C = 0.32, F1-B/Bbr = 0.32 and C-B/Bbr = 0.34.

thumbnail
Fig 1. Phylogenetic tree of env gene (nt-2574) was generated by the Neighbor-Joining method using HIV-1 reference sequences (Ref).

The bootstrap analysis was performed with 1000 replicates. The branches in red represent the recombinant samples.

https://doi.org/10.1371/journal.pone.0167690.g001

Neutralization phenotype

To characterize the neutralization phenotypes of HIV-1 Env-pseudoviruses (psVGWGR, psVGPGR and psVF1) obtained from Brazilian consensus sequences and those selected from the neutralization panel psVB (Rhpa) and psVC (Cap210), we characterized their phenotypes using mAbs and sCD4. The Brazilian psVs were inhibited by all mAbs and presented reduced IC50 geometric means when compared to psVB and psVC (Table 1). sCD4 neutralized all of the studied psVs, and mAbs 2F5, and CH01 were able to neutralize almost all of the psVs with the exception of the psVC and psVB, respectively. The mAbs 2G12 and 447-D inhibited only Brazilian psVs. Furthermore, the psVF1 had the strongest neutralization sensitivity for all mAbs.

thumbnail
Table 1. Mean inhibitory concentration (IC) 50 values (μg/mL) for triplicate assays with pseudoviruses (psVs) and the geometric mean (GM) as indicated.

https://doi.org/10.1371/journal.pone.0167690.t001

The results were plotted on CATNAP (http://hiv.lanl.gov/catnap). The cell color indicates the following categories: white, no neutralization (IC50>10 μg/mL); green, weak neutralization; orange and yellow, moderate neutralization; and red, strong neutralization. The psV MuLV was tested together as a negative control, and the IC50 was undetected.

Association of breadth of neutralizing antibody potency to HIV-1 ENV subtypes

The potential of the HIV-1 plasma samples to neutralize the psVs was displayed in magnitude sorting and grouped according to the geometric mean titer (GMT) ID50 values. Samples were grouped as with low neutralization potential (GMT 20–99), moderate potential (GMT 100–999) or high neutralization potential (GMT>1000) (S1 Table). Taken together, almost all of our 51 subjects exhibited nAb response; however, 18 (35%) of them had no nAb response for one or two psVs. Of the 51 plasma samples analyzed, 16 (31.4%) were classified as low potential, 19 (37.2%) as moderate potential and 16 (31.4%) as high neutralization potential (S1 Table). According to this analysis, plasma samples from all studied individuals infected with HIV-1 subtypes B and F1 presented high or moderate neutralization potency ID50 values, and most individuals from the B/Bbr variant and subtype C exhibited low and moderate neutralization potency, respectively (Fig 2). Additionally, the GMT of variant B/Bbr (144) was 11-fold smaller (p<0.001) than the GTM of subtype B samples (1605). This result reveals distinct immunogenic properties between HIV-1 subtypes. No significant nAb activity was observed when plasmas were tested against a negative control (psV MuLV).

thumbnail
Fig 2. Neutralization range according to HIV-1 subtypes.

The bars represent the percentage of potential neutralizing antibody for each plasma group, according to HIV-1 subtype.

https://doi.org/10.1371/journal.pone.0167690.g002

Cross neutralize reactive response to env psV

The psVGWGR had the strongest reactive response between analyzed psVs, with a geometric mean of sensibility (GMS) of 886, indicating similar sensitivity as psV tier 1. In addition, only one nAb B/Bbr plasma sample did not neutralize this psV. Interestingly, the GMS of psVGWGR is 3.7–fold higher compared with psVGPGR (p<0.01), even though they differ in only one single amino acid (W to P) (S1 Table). Following the sequence of susceptibility, the psVC (tier 2) exhibited a GMS of 572, which is approximately double the susceptibility of psVF1 (258), psVGPGR (238) and psVB (185) (S1 Table).

In addition to the potent nAb detected in subtype B (GMT 1605) and F1 plasma samples (GMT 777), broad cross neutralization to the psV was noted. Although subtype C plasma samples exhibited low neutralization antibody titers, the antibodies were more specific for the V3 GWGR epitope, and the GMT values from psVGWGR and psVC were 771 and 238, respectively (Table 2).

thumbnail
Table 2. Geometric mean titer of nAb from HIV-1 plasma samples B, B/Bbr, C and F1 against psVs.

https://doi.org/10.1371/journal.pone.0167690.t002

To assess the impact of the tryptophan to proline substitution, we compared the disagreement in the neutralization ranges between psVGWGR and psVGPGR in each plasma subtype group. From this analysis, we note that the disagreement in neutralization ranges were as follows: 28% of discordance in plasma samples from subtype F1, 34% for B, 50% for B/Bbr and 86% for C (Fig 3).

thumbnail
Fig 3. Dissonance of neutralization range between psVGWGR and psVGPGR.

The bars represent the percentage of dissonance in neutralization range for each HIV-1 subtype.

https://doi.org/10.1371/journal.pone.0167690.g003

Analysis of the PNLG sites and variable regions of HIV-1 in plasma samples

Here, we analyzed the Env protein characteristics described to influence HIV-1 neutralization sensitivity, such as the number of PNLG and length of gp120 variable regions in HIV-1 plasma samples grouped by subtypes. Our results showed that the size of each gp120 variable region among HIV-1 subtypes had a statistically significant difference. We observed greater V1 B/Bbr and smaller V4 F1 than those of other subtypes (p < 0.005) (Fig 4). However, neither was a correlation verified between variable region length and neutralization magnitude, nor between PNLG and HIV-1 subtypes (Table 3).

thumbnail
Fig 4. Comparison of variable region lengths among Brazilian HIV-1 (B, B/Bbr, F1 and C) subtypes.

One-way ANOVA p-values in subsequent Dunnett’s multiple comparison tests indicating statistically significant difference (p<0.005) are marked with an asterisk. The horizontal bars at the top of each column indicate the means of length for each variable region.

https://doi.org/10.1371/journal.pone.0167690.g004

thumbnail
Table 3. Number of potential N-linked glycosylation (PNLG) sites of HIV-1 Env sequences according to the range of neutralization potency and HIV-1 subtypes.

https://doi.org/10.1371/journal.pone.0167690.t003

Neutralization signature patterns

Some authors have proposed that some Env features that elicit strong antibodies in natural infection might be useful to integrate vaccine design immunogens [39,40]. Thus, we verified possible association of some Env signatures patterns with neutralization potency and HIV-1 subtypes in an alignment of 937 amino acids sites containing all 51 ENV sequences (S2 Fig).

In order to verify the potential signatures related to neutralization susceptibility 16 Env sequences that presented a high neutralization range were compared with 16 sequences with lower neutralization ranges. From this analysis, three signatures were suggested to be enrichment, (68.8%) L14W (56.2%), (81.2%) P360W (68.8%), and (56.2%) R843H (62.5%). Here, the first amino acid represents high neutralization and the second amino acid represents low neutralization potency. The results of signature analyses were combined on contingency table (Chi-square or Fisher's exact tests) and only one statistically significant signature was identified, the site P360W (p = 0.013), position 313 in relation to HXB2.

Concerning HIV-1 subtype signatures, we verified seven to twelve signatures (substitution or insertions) in a pair-to-pair comparison. These signatures were localized in the signal peptide, C1, V2, C2, V3, and V4, with the majority located in gp41 (Fig 5 and S1 Fig). From this analysis, comparing HIV-1 subtype F1 samples (GMT 777), which showed better neutralizing response than B/Bbr samples (GMT 144), we verified subtype-specific signatures located in regions C2, V3 and gp41, which might influence in the distinct neutralizing response.

thumbnail
Fig 5. Scheme of viral envelope gene (gp120 and gp41) and representation of HIV-1 subtype-specific signatures.

The asterisk indicates insertions or deletions. The numbers represent the position of each HIV-1 subtype-specific signatures in reference to amino acid alignment.

https://doi.org/10.1371/journal.pone.0167690.g005

Discussion

We evaluated the neutralization breadth and potency of plasma samples from HIV-1-infected Brazilian individuals using a representative panel of psVs and attempted to correlate the antibody response to the genetic and biochemical characteristics of HIV-1 subtypes. Comparing the neutralizing phenotype of psVs, we verified that psVF1 and psVGPGR were the most cross-susceptible to the inhibitors. The resistance of psVC and psVB to some mAbs were also verified in others studies [39,4144], and in the present study this resistance could be associated with escape mutations. In the mAb 2F5, which recognizes the ELDKWA epitope [45] from gp41, we verified a change from an alanine to a glutamine in psVC. For the 2G12 mAb, which recognizes the mannose residues N295, N332, N339, and N392 and the V4 loop in relation to HXB2 positions [46], we observed that some asparagine residues are absent in psVC and psVB, leading to a phenotypical resistant profile (S2 Fig, alignment residues: N321, N359, N366, and N419) [41,4751]. Given that mAb 447-D is specific for viruses that carry the GPGR motif at the top of V3 loop [52], a strong neutralization of psVGPGR, psVB (Rhpa) and psV F1 was expected. However, the psVB (Rhpa) was not inhibited at 10 μg/mL (IC50), but in previous studies in concentrations of 48.9 μg/mL [52] and 46.2 μg/mL [53] a susceptibility was observed, indicating that this relevant epitope on the V3 loop was not easily exposed in this psV. The CH01 is a broad nAb used to target the second Env site of vulnerability by covering amino acid residues in V1V2 loops and sugar moieties at N160 (S2 Fig, N173 on V2) [53]. Given that this asparagine was present in all psVs, we suggested that the distinct neutralization susceptibility verified to CH01 could be associated with the V1V2 length [4951]. All psVs were sensitive to sCD4, which causes irreversible shedding of gp120 from and subsequently inactivates Env [54]. Therefore, our results are in full agreement with previous studies, confirming the reliability and accuracy of the assay. We also emphasize that the use of broadly neutralization panel including psVs based on local HIV consensus sequences is of paramount importance to better characterize HIV humoral immune response.

Screening the neutralizing activity of a panel of 51 HIV-1 plasmas samples against the five psV, we observed nAbs in 31.4% of the analyzed samples, which is consistent with the 10 to 30% values detected in recent studies [55,56]. Herein, nAbs were detected in most of the samples from HIV-1 subtypes F1 and B (GPGR). Although these subtypes are genetically distant, they are correlated immunologically as verified by V3 peptide seroreactivity [57] and IFN-γ ELISpot response to Gag and Nef [58].

We have not determined whether the serum neutralization breadth observed here is specifically prevalent in the plasma samples using assays. However, by dissonance analysis, we observed that subtype C plasma samples exhibited a specific response to GWGR that is increased when compared with GPGR or GPGQ motifs present in V3 of the psVs. Thus, we suggest that the conformational change deriving from amino acid substitution (GWGR) could result in a better accessibility of the epitope. As previously described, the influence of the modified variable regions on the adjacent protomers results in altered access to nAbs [12,59,60]. Additionally, in general, broad serum neutralization is characterized by the presence of one or very few antibody specificities [10,45].

We detected an increased amount of N-glycosylation sites in plasma sample sequences of low neutralization range and psVs with minor GMS, however it was not statistically significant. This finding suggests a masking of the nAb epitope by glycans on the surface of Env, forming a ‘‘glycan shield” that reduces access to protein epitopes and nAb induction. According to van Gils et al., [60] an increase in the length of the V1V2 loop and the number of PNLG on the glycoprotein is directly associated with the protection of HIV-1 against HIV-specific neutralizing antibodies. In relation to the psVs, we observed that psVGWGR and psVGPGR had the same number of PNLG but discordant GMS to plasma samples, and we assume that nAb in the plasma samples were more directional to the top of the V3 loop.

Of the 937 amino acids compared between the 51 sequences, only three (L14W, P360W and R843H) amino acids positions were more frequent in a particular neutralizing response groups. The amino acid position 14, which is part of the signal peptide, plays a role in the efficiency of the protein secretion, in the orientation of Env protein to the membrane, impacting folding and the exit from the endoplasmic reticulum [61]. The amino acid change of proline to tryptophan at 360 position can directly interfere with the formation of bridging sheet and adjacent surfaces from the outer domain of gp120, and this also impact to V3-loop antibodies that block the binding of gp120–CD4 complexes [62]. Therefore, we observed that virus with W360 were more sensitive to neutralization and induced weak anti-Env response. The other signature pattern was observed on the cytoplasmic tail (R843H). The substitutions in this region can lead to effects on the binding of antibodies to the V1-V2 region, the V3 loop, or the C5 domain of gp120 [63]. This might suggest that alterations of amino acids composition in these regions (signal peptide, V3 loop and cytoplasmic tail) are an important determining factor in the induction of nAb, at least in our study population. Such changes could be influencing the expression or binding to antibodies in exposed regions of each protomer.

Currently, little is known about antibody affinity maturation in relation to the presented antigen. In this process, antibody-antigen interactions are of great importance for the selection of B cell characteristics, such as structural peptide size and charge of the amino acids surrounding the electrostatic forces (hydrogen bridges, hydrophobic interactions and Van der Waals force) [64]. Recently, Doria-Rose and Gordon report about the possibility of the recruitment of specific viral sequences to activate a "correct" BCR and facilitate the development of particular powerful antibodies [65].

The limitations of our study are the same shared by most authors working with neutralizing antibodies. In fact, studies addressing nAb could be influenced by host genetic characteristics, disease progression profile, HIV-1 viral load, and studies with small sample size due to the high costs of the experiments, especially in resource-limited settings. In our analysis, we considered only chronic HIV-1 infected individuals and explored viral characteristics such as HIV-1 subtypes, length of the variable regions, and differences on N-linked glycosylation sites (PNLG) that have been described to be implicated in the potency and breadth of nAb. We were able to observe that some individuals especially infected with HIV-1 subtypes B and F1 produce high titers of broadly reactive neutralizing antibodies, which are of particular interest for vaccine design. The presence of tryptophan instead of proline on the top of the V3 loop facilitates the exposure of the trimeric structural domain, contributing to viral neutralization. Therefore, it is important to highlight that these kinds of studies are able to increase understanding and add to the growing body of evidence that the antigenic and immunogenic properties of Env should facilitate the development of an effective HIV-1 vaccine.

Supporting Information

S1 Fig. Alignment of 51 HIV-1 envelope amino acid sequences according to B, B/Bbr F1 and C subtypes.

https://doi.org/10.1371/journal.pone.0167690.s001

(PDF)

S2 Fig. Alignment of env-psVs in relation to the HXB2 reference virus.

https://doi.org/10.1371/journal.pone.0167690.s002

(PDF)

S1 Table. Plasma samples from individuals infected with the different HIV-1 subtypes exhibit antibodies activity profiles against distinct pseudoviruses.

https://doi.org/10.1371/journal.pone.0167690.s003

(DOCX)

Acknowledgments

We thank the NIH AIDS Research & Reagent Program for donation of HIV-1 pseudovirus, mAbs, plasmids and TZM-bl cellsand to participants ofthestudy for donation of blood. Julio Lima and Marcel de Sousa B. Santana thanks for his support on the statistical analyses. Also, we thank Dr. V Bongertz and Dr. H Pilotto for helpful suggestions.

Author Contributions

  1. Conceptualization: DVA MLG.
  2. Formal analysis: DVA MLG BGJG VGVS.
  3. Funding acquisition: MLG.
  4. Investigation: DVA MLG BGJG VGVS.
  5. Methodology: DVA KVM.
  6. Project administration: DVA.
  7. Resources: MLG VGVS.
  8. Supervision: DVA MLG BGJG VGVS.
  9. Visualization: DVA MLG BGJG VGVS.
  10. Writing – original draft: DVA MLG.
  11. Writing – review & editing: DVA MLG.

References

  1. 1. Klein F, Mouquet H, Dosenovic P, Scheid JF, Scharf L, Nussenzweig MC. Antibodies in HIV-1 vaccine development and therapy. Science. 2013;341: 1199–204. pmid:24031012
  2. 2. Hraber P, Seaman MS, Bailer RT, Mascola JR, Montefiori DC, Korber BT. Prevalence of broadly neutralizing antibody responses during chronic HIV-1 infection. AIDS. 2014;28: 163–9. pmid:24361678
  3. 3. Gnanakaran S, Daniels MG, Bhattacharya T, Lapedes AS, Sethi A, Li M, et al. Genetic signatures in the envelope glycoproteins of HIV-1 that associate with broadly neutralizing antibodies. PLoS Comput Biol. Public Library of Science; 2010;6: e1000955.
  4. 4. Almeida DV, Morgado MG, Côrtes FH, Guimarães ML, Mendonça-Lima L, Pilotto JH, et al. Short communication: neutralizing antibodies in HIV-1-infected Brazilian individuals. AIDS Res Hum Retroviruses. 2013;29: 488–92. pmid:23145941
  5. 5. Binley JM, Wrin T, Korber B, Zwick MB, Wang M, Chappey C, et al. Comprehensive cross-clade neutralization analysis of a panel of anti-human immunodeficiency virus type 1 monoclonal antibodies. J Virol. 2004;78: 13232–52. pmid:15542675
  6. 6. Walker LM, Simek MD, Priddy F, Gach JS, Wagner D, Zwick MB, et al. A limited number of antibody specificities mediate broad and potent serum neutralization in selected HIV-1 infected individuals. PLoS Pathog. 2010;6: e1001028. pmid:20700449
  7. 7. Asokan M, Rudicell RS, Louder M, McKee K, O’Dell S, Stewart-Jones G, et al. Bispecific Antibodies Targeting Different Epitopes on the HIV-1 Envelope Exhibit Broad and Potent Neutralization. J Virol. 2015;89: 12501–12. pmid:26446600
  8. 8. Kong R, Louder MK, Wagh K, Bailer RT, deCamp A, Greene K, et al. Improving neutralization potency and breadth by combining broadly reactive HIV-1 antibodies targeting major neutralization epitopes. J Virol. 2015;89: 2659–71. pmid:25520506
  9. 9. Guenaga J, Wyatt RT. Structure-guided alterations of the gp41-directed HIV-1 broadly neutralizing antibody 2F5 reveal new properties regarding its neutralizing function. PLoS Pathog. 2012;8: e1002806. pmid:22829767
  10. 10. Klein F, Gaebler C, Mouquet H, Sather DN, Lehmann C, Scheid JF, et al. Broad neutralization by a combination of antibodies recognizing the CD4 binding site and a new conformational epitope on the HIV-1 envelope protein. J Exp Med. 2012;209: 1469–79. pmid:22826297
  11. 11. West AP, Scharf L, Scheid JF, Klein F, Bjorkman PJ, Nussenzweig MC. Structural insights on the role of antibodies in HIV-1 vaccine and therapy. Cell. Elsevier Inc.; 2014;156: 633–648.
  12. 12. Gorman J, Soto C, Yang MM, Davenport TM, Guttman M, Bailer RT, et al. Structures of HIV-1 Env V1V2 with broadly neutralizing antibodies reveal commonalities that enable vaccine design. Nat Struct Mol Biol. 2015;23: 81–90. pmid:26689967
  13. 13. Mascola JR, Haynes BF. HIV-1 neutralizing antibodies: understanding nature’s pathways. Immunol Rev. 2013;254: 225–44. pmid:23772623
  14. 14. Wibmer CK, Bhiman JN, Gray ES, Tumba N, Abdool Karim SS, Williamson C, et al. Viral escape from HIV-1 neutralizing antibodies drives increased plasma neutralization breadth through sequential recognition of multiple epitopes and immunotypes. PLoS Pathog. 2013;9: e1003738. pmid:24204277
  15. 15. Li M, Salazar-Gonzalez JF, Derdeyn CA, Morris L, Williamson C, Robinson JE, et al. Genetic and neutralization properties of subtype C human immunodeficiency virus type 1 molecular env clones from acute and early heterosexually acquired infections in Southern Africa. J Virol. 2006;80: 11776–90. pmid:16971434
  16. 16. Li M, Gao F, Mascola JR, Stamatatos L, Polonis VR, Koutsoukos M, et al. Human immunodeficiency virus type 1 env clones from acute and early subtype B infections for standardized assessments of vaccine-elicited neutralizing antibodies. J Virol. 2005;79: 10108–25. pmid:16051804
  17. 17. Tang H, Robinson JE, Gnanakaran S, Li M, Rosenberg ES, Perez LG, et al. epitopes immediately below the base of the V3 loop of gp120 as targets for the initial autologous neutralizing antibody response in two HIV-1 subtype B-infected individuals. J Virol. 2011;85: 9286–99. pmid:21734041
  18. 18. Pimentel VF, Morgado MG, Bello G, Guimarães MDC, Castilho EA, Veloso VG, et al. Temporal trends and molecular epidemiology of HIV type 1 infection in Rio de Janeiro, Brazil. AIDS Res Hum Retroviruses. 2013;29: 1553–61. pmid:23987184
  19. 19. Guimarães ML, Marques BCL, Bertoni N, Teixeira SLM, Morgado MG, Bastos FI. Assessing the HIV-1 Epidemic in Brazilian Drug Users: A Molecular Epidemiology Approach. PLoS One. 2015;10: e0141372. pmid:26536040
  20. 20. Morgado MG, Sabino EC, Shpaer EG, Bongertz V, Brigido L, Guimaraes MD, et al. V3 region polymorphisms in HIV-1 from Brazil: prevalence of subtype B strains divergent from North American/European prototype and detection of subtype F. AIDS Res Hum Retroviruses. 1994;10: 569–76. Available: http://www.ncbi.nlm.nih.gov/pubmed/7522493 pmid:7522493
  21. 21. Morgado MG, Guimarães ML, Gripp CB, Costa CI, Neves I, Veloso VG, et al. Molecular epidemiology of HIV-1 in Brazil: high prevalence of HIV-1 subtype B and identification of an HIV-1 subtype D infection in the city of Rio de Janeiro, Brazil. Evandro Chagas Hospital AIDS Clinical Research Group. J Acquir Immune Defic Syndr Hum Retrovirol. 1998;18: 488–94. Available: http://www.ncbi.nlm.nih.gov/pubmed/9715846 pmid:9715846
  22. 22. Covas DT, Bíscaro TA, Kashima S, Duarte G, Machado AA. High frequency of the GWG (Pro Trp) envelope variant of HIV-1 in Southeast Brazil. J Acquir Immune Defic Syndr Hum Retrovirol. 1998;19: 74–9. Available: http://www.ncbi.nlm.nih.gov/pubmed/9732073 pmid:9732073
  23. 23. Bongertz V, Jansson M, Flodby P, Morgado MG, Galvão-Castro B, Wigzell H. Analysis of antibody specificity against the third variable region of the envelope glycoprotein gp120 of HIV-1 in plasma from HIV-1-positive individuals residing in Brazil. Brazilian J Med Biol Res = Rev Bras Pesqui médicas e biológicas / Soc Bras Biofísica. [et al]. 1994;27: 1225–36. Available: http://www.ncbi.nlm.nih.gov/pubmed/8000344
  24. 24. Bongertz V, Wigzell H, Rossi P. Production of human monoclonal antibodies against HIV-1 peptides. Brazilian J Med Biol Res = Rev Bras Pesqui médicas e biológicas / Soc Bras Biofísica. [et al]. 1991;24: 815–8. Available: http://www.ncbi.nlm.nih.gov/pubmed/1797270
  25. 25. Gräf T, Pinto AR. The increasing prevalence of HIV-1 subtype C in Southern Brazil and its dispersion through the continent. Virology. 2013;435: 170–8. pmid:22999094
  26. 26. Delatorre E, Couto-Fernandez JC, Guimarães ML, Vaz Cardoso LP, de Alcantara KC, Stefani MM de A, et al. Tracing the origin and northward dissemination dynamics of HIV-1 subtype C in Brazil. PLoS One. Public Library of Science; 2013;8: e74072.
  27. 27. Guimarães ML, Bastos FI, Telles PR, Galvão-Castro B, Diaz RS, Bongertz V, et al. Retrovirus infections in a sample of injecting drug users in Rio de Janeiro City, Brazil: prevalence of HIV-1 subtypes, and co-infection with HTLV-I/II. J Clin Virol. 2001;21: 143–51. Available: http://www.ncbi.nlm.nih.gov/pubmed/11378495 pmid:11378495
  28. 28. Niculescu I, Paraschiv S, Paraskevis D, Abagiu A, Batan I, Banica L, et al. Recent HIV-1 Outbreak Among Intravenous Drug Users in Romania: Evidence for Cocirculation of CRF14_BG and Subtype F1 Strains. AIDS Res Hum Retroviruses. 2015;31: 488–95. pmid:25369079
  29. 29. Delgado E, Cuevas MT, Domínguez F, Vega Y, Cabello M, Fernández-García A, et al. Phylogeny and Phylogeography of a Recent HIV-1 Subtype F Outbreak among Men Who Have Sex with Men in Spain Deriving from a Cluster with a Wide Geographic Circulation in Western Europe. PLoS One. 2015;10: e0143325. pmid:26599410
  30. 30. Korbie DJ, Mattick JS. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat Protoc. Nature Publishing Group; 2008;3: 1452–6.
  31. 31. Gao F, Morrison SG, Robertson DL, Thornton CL, Craig S, Karlsson G, et al. Molecular cloning and analysis of functional envelope genes from human immunodeficiency virus type 1 sequence subtypes A through G. The WHO and NIAID Networks for HIV Isolation and Characterization. J Virol. 1996;70: 1651–67. Available: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=189989&tool=pmcentrez&rendertype=abstract pmid:8627686
  32. 32. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol. 2013;30: 2725–9. pmid:24132122
  33. 33. Alcantara LCJ, Cassol S, Libin P, Deforche K, Pybus OG, Van Ranst M, et al. A standardized framework for accurate, high-throughput genotyping of recombinant and non-recombinant viral sequences. Nucleic Acids Res. 2009;37: 1–9.
  34. 34. Zhang M, Gaschen B, Blay W, Foley B, Haigwood N, Kuiken C, et al. Tracking global patterns of N-linked glycosylation site variation in highly variable viral glycoproteins: HIV, SIV, and HCV envelopes and influenza hemagglutinin. Glycobiology. 2004;14: 1229–46. pmid:15175256
  35. 35. Yoon H, Macke J, West AP, Foley B, Bjorkman PJ, Korber B, et al. CATNAP: a tool to compile, analyze and tally neutralizing antibody panels. Nucleic Acids Res. 2015;43: W213–9. pmid:26044712
  36. 36. Platt EJ, Wehrly K, Kuhmann SE, Chesebro B, Kabat D. Effects of CCR5 and CD4 Cell Surface Concentrations on Infections by Macrophagetropic Isolates of Human Immunodeficiency Virus Type 1. J Virol. 1998;72: 2855–2864. pmid:9525605
  37. 37. Wei X, Decker JM, Wang S, Hui H, Kappes JC, Wu X, et al. Antibody neutralization and escape by HIV-1. Nature. 2003;422: 307–12. pmid:12646921
  38. 38. Sarzotti-Kelsoe M, Bailer RT, Turk E, Lin C, Bilska M, Greene KM, et al. Optimization and validation of the TZM-bl assay for standardized assessments of neutralizing antibodies against HIV-1. J Immunol Methods. 2014;409: 131–46. pmid:24291345
  39. 39. Chuang G-Y, Acharya P, Schmidt SD, Yang Y, Louder MK, Zhou T, et al. Residue-level prediction of HIV-1 antibody epitopes based on neutralization of diverse viral strains. J Virol. 2013;87: 10047–58. pmid:23843642
  40. 40. Bonsignori M, Montefiori DC, Wu X, Chen X, Hwang K-K, Tsao C-Y, et al. Two distinct broadly neutralizing antibody specificities of different clonal lineages in a single HIV-1-infected donor: implications for vaccine design. J Virol. American Society for Microbiology (ASM); 2012;86: 4688–92.
  41. 41. Li M, Salazar-Gonzalez JF, Derdeyn CA, Morris L, Williamson C, Robinson JE, et al. Genetic and neutralization properties of subtype C human immunodeficiency virus type 1 molecular env clones from acute and early heterosexually acquired infections in Southern Africa. J Virol. 2006;80: 11776–90. pmid:16971434
  42. 42. Li M, Gao F, Mascola JR, Stamatatos L, Polonis VR, Koutsoukos M, et al. Human immunodeficiency virus type 1 env clones from acute and early subtype B infections for standardized assessments of vaccine-elicited neutralizing antibodies. J Virol. 2005;79: 10108–25. pmid:16051804
  43. 43. Zhu Z, Qin HR, Chen W, Zhao Q, Shen X, Schutte R, et al. Cross-reactive HIV-1-neutralizing human monoclonal antibodies identified from a patient with 2F5-like antibodies. J Virol. 2011;85: 11401–8. pmid:21880764
  44. 44. Huang J, Ofek G, Laub L, Louder MK, Doria-Rose NA, Longo NS, et al. Broad and potent neutralization of HIV-1 by a gp41-specific human antibody. Nature. 2012;491: 406–12. pmid:23151583
  45. 45. Mouquet H, Scheid JF, Zoller MJ, Krogsgaard M, Ott RG, Shukair S, et al. Polyreactivity increases the apparent affinity of anti-HIV antibodies by heteroligation. Nature. 2010;467: 591–5. pmid:20882016
  46. 46. Scanlan CN, Pantophlet R, Wormald MR, Ollmann Saphire E, Stanfield R, Wilson IA, et al. The broadly neutralizing anti-human immunodeficiency virus type 1 antibody 2G12 recognizes a cluster of alpha1—>2 mannose residues on the outer face of gp120. J Virol. 2002;76: 7306–21. Available: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=136327&tool=pmcentrez&rendertype=abstract pmid:12072529
  47. 47. Corti D, Langedijk JPM, Hinz A, Seaman MS, Vanzetta F, Fernandez-Rodriguez BM, et al. Analysis of memory B cell responses and isolation of novel monoclonal antibodies with neutralizing breadth from HIV-1-infected individuals. PLoS One. 2010;5: e8805. pmid:20098712
  48. 48. McLellan JS, Pancera M, Carrico C, Gorman J, Julien J-P, Khayat R, et al. Structure of HIV-1 gp120 V1/V2 domain with broadly neutralizing antibody PG9. Nature. 2011;480: 336–43. pmid:22113616
  49. 49. Georgiev IS, Doria-Rose NA, Zhou T, Kwon Y Do, Staupe RP, Moquin S, et al. Delineating antibody recognition in polyclonal sera from patterns of HIV-1 isolate neutralization. Science. 2013;340: 751–6. pmid:23661761
  50. 50. Hraber P, Seaman MS, Bailer RT, Mascola JR, Montefiori DC, Korber BT. Prevalence of broadly neutralizing antibody responses during chronic HIV-1 infection. AIDS. 2014;28: 163–9. pmid:24361678
  51. 51. Doria-Rose NA, Schramm CA, Gorman J, Moore PL, Bhiman JN, DeKosky BJ, et al. Developmental pathway for potent V1V2-directed HIV-neutralizing antibodies. Nature. 2014;509: 55–62. pmid:24590074
  52. 52. Zolla-Pazner S. Identifying epitopes of HIV-1 that induce protective antibodies. Nat Rev Immunol. 2004;4: 199–210. pmid:15039757
  53. 53. McLellan JS, Pancera M, Carrico C, Gorman J, Julien J-P, Khayat R, et al. Structure of HIV-1 gp120 V1/V2 domain with broadly neutralizing antibody PG9. Nature. 2011;480: 336–43. pmid:22113616
  54. 54. Moore JP, McKeating JA, Weiss RA, Sattentau QJ. Dissociation of gp120 from HIV-1 virions induced by soluble CD4. Science. 1990;250: 1139–42. Available: http://www.ncbi.nlm.nih.gov/pubmed/2251501 pmid:2251501
  55. 55. Li Y, Svehla K, Louder MK, Wycuff D, Phogat S, Tang M, et al. Analysis of neutralization specificities in polyclonal sera derived from human immunodeficiency virus type 1-infected individuals. J Virol. 2009;83: 1045–59. pmid:19004942
  56. 56. Sather DN, Armann J, Ching LK, Mavrantoni A, Sellhorn G, Caldwell Z, et al. Factors associated with the development of cross-reactive neutralizing antibodies during human immunodeficiency virus type 1 infection. J Virol. 2009;83: 757–69. pmid:18987148
  57. 57. Bongertz V, Bou-Habib DC, Brígido LF, Caseiro M, Chequer PJ, Couto-Fernandez JC, et al. HIV-1 diversity in Brazil: genetic, biologic, and immunologic characterization of HIV-1 strains in three potential HIV vaccine evaluation sites. Brazilian Network for HIV Isolation and Characterization. J Acquir Immune Defic Syndr. 2000;23: 184–93. Available: http://www.ncbi.nlm.nih.gov/pubmed/10737434 pmid:10737434
  58. 58. Côrtes FH, Bello G, Vorsatz C, Pilotto JH, Guimarães ML, Grinsztejn B, et al. Higher cross-subtype IFN-γ ELISpot responses to Gag and Nef peptides in Brazilian HIV-1 subtype B- and F1- than in C-infected subjects. Vaccine. 2013;31: 1106–12. pmid:23261042
  59. 59. Ward AB, Wilson IA. Insights into the trimeric HIV-1 envelope glycoprotein structure. Trends Biochem Sci. Elsevier Ltd; 2015;40: 101–107.
  60. 60. van Gils MJ, Bunnik EM, Boeser-Nunnink BD, Burger JA, Terlouw-Klein M, Verwer N, et al. Longer V1V2 region with increased number of potential N-linked glycosylation sites in the HIV-1 envelope glycoprotein protects against HIV-specific neutralizing antibodies. J Virol. 2011;85: 6986–95. pmid:21593147
  61. 61. Boyd D, Beckwith J. The role of charged amino acids in the localization of secreted and membrane proteins. Cell. Cell Press; 1990;62: 1031–1033.
  62. 62. Hendrickson WA, Kwong PD, Wyatt R, Robinson J, Sweet RW, Sodroski J. Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody. Nature. Nature Publishing Group; 1998;393: 648–659.
  63. 63. Edwards TG, Wyss S, Reeves JD, Zolla-Pazner S, Hoxie JA, Doms RW, et al. Truncation of the Cytoplasmic Domain Induces Exposure of Conserved Regions in the Ectodomain of Human Immunodeficiency Virus Type 1 Envelope Protein. J Virol. American Society for Microbiology; 2002;76: 2683–2691.
  64. 64. MacLennan IC. Germinal centers. Annu Rev Immunol. 1994;12: 117–39. pmid:8011279
  65. 65. Doria-Rose NA, Joyce MG. Strategies to guide the antibody affinity maturation process. Curr Opin Virol. 2015;11: 137–47. pmid:25913818