Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Molecular and Genomic Characterization of Vibrio mimicus Isolated from a Frozen Shrimp Processing Facility in Mexico

  • Iliana Guardiola-Avila,

    Affiliation Centro de Investigación en Alimentación y Desarrollo, A.C Hermosillo, Sonora, México

  • Evelia Acedo-Felix,

    Affiliation Centro de Investigación en Alimentación y Desarrollo, A.C Hermosillo, Sonora, México

  • Itzel Sifuentes-Romero,

    Affiliation Mazatlán Unit for Aquaculture and Environmental Management. Centro de Investigación en Alimentación y Desarrollo, A.C. Mazatlán, Sinaloa, México

  • Gloria Yepiz-Plascencia,

    Affiliation Centro de Investigación en Alimentación y Desarrollo, A.C Hermosillo, Sonora, México

  • Bruno Gomez-Gil,

    Affiliation Mazatlán Unit for Aquaculture and Environmental Management. Centro de Investigación en Alimentación y Desarrollo, A.C. Mazatlán, Sinaloa, México

  • Lorena Noriega-Orozco

    lnoriega@ciad.mx

    Affiliation Guaymas Unit: Quality Assurance and Management of Natural Resources. Centro de Investigación en Alimentación y Desarrollo, A.C. Guaymas, Sonora, México

Molecular and Genomic Characterization of Vibrio mimicus Isolated from a Frozen Shrimp Processing Facility in Mexico

  • Iliana Guardiola-Avila, 
  • Evelia Acedo-Felix, 
  • Itzel Sifuentes-Romero, 
  • Gloria Yepiz-Plascencia, 
  • Bruno Gomez-Gil, 
  • Lorena Noriega-Orozco
PLOS
x

Abstract

Vibrio mimicus is a gram-negative bacterium responsible for diseases in humans. Three strains of V. mimicus identified as V. mimicus 87, V. mimicus 92 and V. mimicus 93 were isolated from a shrimp processing facility in Guaymas, Sonora, Mexico. The strains were analyzed using several molecular techniques and according to the cluster analysis they were different, their similarities ranged between 51.3% and 71.6%. ERIC-PCR and RAPD (vmh390R) were the most discriminatory molecular techniques for the differentiation of these strains. The complete genomes of two strains (V. mimicus 87, renamed as CAIM 1882, and V. mimicus 92, renamed as CAIM 1883) were sequenced. The sizes of the genomes were 3.9 Mb in both strains, with 2.8 Mb in ChI and 1.1 Mb in ChII. A 12.7% difference was found in the proteome content (BLAST matrix). Several virulence genes were detected (e.g. capsular polysaccharide, an accessory colonization factor and genes involved in quorum-sensing) which were classified in 16 categories. Variations in the gene content between these genomes were observed, mainly in proteins and virulence genes (e.g., hemagglutinin, mobile elements and membrane proteins). According to these results, both strains were different, even when they came from the same source, giving an insight of the diversity of V. mimicus. The identification of various virulence genes, including a not previously reported V. mimicus gene (acfD) in ChI in all sequenced strains, supports the pathogenic potential of this species. Further analysis will help to fully understand their potential virulence, environmental impact and evolution.

Introduction

Generally, Vibrio species are accountable for the diseases associated to the natural bacterial flora of aquatic environments or seafood [1]. Several species of this genus can produce illness in humans mainly Vibrio cholerae, Vibrio parahaemolyticus and Vibrio vulnificus. Vibrio mimicus has been associated with human diseases such as gastroenteritis, ear infections and severe cholera-like diarrhea; with symptoms such as diarrhea, nauseas, vomiting, abdominal pain and sometimes fever [29]. This bacterium has been isolated from a large variety of seafood, such as oysters, turtle eggs, shrimp, crabs, snails, lobsters, and fish, as well in water samples, sediment and plants [2,5,6,1013]. Similar to other Vibrio species, V. mimicus has two circular chromosomes of different size, a larger (ca. 3.0 Mb) chromosome and a smaller (ca. 1.5 Mb) chromosome [1416]. The genes required for growth and viability are in the larger chromosome, while the genes for adaptation to environmental change are in the smaller [16]. Also, multiple virulence factors had been detected in both chromosomes, combinations of which regulated the pathogenic potential [3,1617]. The genetic diversity of Vibrio species, including V. mimicus, isolated form different sources has been documented [16,18,19]. It has also been reported that V. mimicus could represent the genetic reservoir of virulence genes for other Vibrio species or to be recipients of gene transfers [1921]. Thus, the identification of their virulence factors could provide information of the biology and evolution of an organism [22], and also of genetic diversity in the same environmental niche.

Numerous molecular techniques such as random amplified polymorphic DNA (RAPD), repetitive extragenic palindromes (REP), and amplified ribosomal DNA restriction analysis (ARDRA), along with real-time PCR, DNA sequencing, and microarrays have been applied to detect, identify and characterizer microorganisms for epidemiological purposes and allow to study and understand their pathogenicity and virulence [23,24]. DNA sequencing technologies had become more available, thus the generation of genomic information is growing, therefore it is important to compare the new genomes with the existing sequences, comparative genomic, to identify both novel and conserved features, and be able to determine genotype-phenotype relationships and explore what organisms really do with their genetic potential [22,25].

A molecular characterization of three strains of V. mimicus isolated from a processing facility for frozen shrimp was conducted to analyze their similarity and/or differences. Additionally, the complete genome sequence of the two strains that showed less similarity was obtained to estimate their pathogenic potential, were bioinformatics analyses were performed. These molecular and genomic characterizations could give us insight of the diversity of this species.

Materials and Methods

Bacteria strains

Three strains of V. mimicus were isolated from the water at the washing step in a freezing-shrimp company in Guaymas, Sonora, Mexico during September 2012. Water samples were collected with the permission of the processing company owner. The strains were isolated in thiosulfate citrate bile salts sucrose (TCBS) agar, and biochemical characterization was performed before PCR identification. The strains were designated as V. mimicus 87 (Vm 87), V. mimicus 92 (Vm 92) and V. mimicus 93 (Vm 93). V. mimicus type strain CAIM 602T (ATCC 33653) was used as positive control for all the tests of this study.

DNA extraction and bacterial identification

DNA was obtained from a fresh pure culture in trypticase soy broth (TSB, 34°C/18 h), as described previously with some modifications [26]. The procedure basically consisted of enzymatic lysis of the cells, extraction with phenol/chloroform/isoamyl alcohol, ethanol precipitation, and resuspension of DNA in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) with RNAse (20 mg/ml). The DNA extraction was confirmed by agarose gel electrophoresis (0.8%), and DNA was stored at -20°C for further use.

V. mimicus isolates were confirmed by the amplification of the hemolysin (vmh) gen [27,28] using the following primers: vmh390F (GGTAGCCATCAGTCTTATCACG) and vmh390R (ATCGTGTCCCAATACTTCACCG). PCR amplification was performed in a thermal cycler (Perkin Elmer 480) with the following temperature profile: an initial denaturation at 95°C for 5 min; 35 cycles of 30 s at 95°C, 30 s at 53°C and 30 s at 72°C; and a final extension at 72°C for 5 min. Amplified DNA was visualized using agarose gel electrophoresis (1.8%).

Molecular analysis

PCR confirmed V. mimicus isolates were analyzed using the following molecular methodologies.

Amplified ribosomal DNA restriction analysis (ARDRA).

PCR amplification of the 16S rRNA using the universal primers 27-F (AGAGTTTGATCCTGGCTCAG) and 1492-R (GGTTACCTTGTTACGACTT) was performed. PCR amplification was done in a thermal cycler (Perkin Elmer 480) with the following temperature profile: an initial denaturation at 96°C for 5 min; 36 cycles of 1 min at 94°C, 1 min at 50°C and 1 min at 72°C; and a final extension at 72°C for 5 min. PCR products were visualized in 1.2% agarose electrophoresis gel. Afterwards, the amplified products were treated with the following restrictions enzymes: CfoI, HaeIII, HinfI, HapII and AluI. Ten microliters of PCR product were digested with restriction enzymes (1 μL of restriction enzyme, 2 μL of specific buffer 10X, 1 μL of albumin and 9 μL of sterile water) and incubated at 37°C for 18 hr according to the manufacturer´s instructions. The digested products were visualized by electrophoresis in an agarose gel (1.8%) at 95 V for 90 min.

Repetitive Element PCR (Rep-PCR).

Two different techniques were utilized: Enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) [29] and (GTG)5-PCR [30]. The primers used for the Rep-PCR were ERIC-1 (5′-ATGTAAGCTCCTGGGGATTCAC-3′) and ERIC-2 (5′-AAGTAAGTGACTGGGGTGAGCG-3′) for ERIC-PCR and (GTGGTGGTGGTGGTG) for (GTG)5-PCR. PCR amplification was performed in a thermal cycler (Perkin Elmer 480) with the following temperature profile: initial denaturation at 94°C for 6 min; 35 cycles of 30 s at 94°C, 60 s at 48°C and 5 min at 72°C; and a final extension at 72°C for 7 min. PCR products were separated by electrophoresis in an agarose gel (1.2%) at 90 V for 100 min.

Random Amplified Polymorphic DNA PCR (RAPD).

Two different primers were used: OPI-3 (5’CAGAAGCCCA3’) and vmh390R (ATCGTGTCCCAATACTTCACCG). The PCR amplifications were performed in a thermal cycler (Perkin Elmer 480), with the OPI-3 primer the following temperature profile was used: an initial denaturation at 94°C for 4 min; 30 cycles of 1 min at 94°C, 1 min at 37°C and 1 min at 72°C; and a final extension at 72°C for 6 min. For the vmh390R primer, the same program described by Bi et al. (2000) was used. PCR products were visualized by electrophoresis in an agarose gel (1.8%) at 95 V for 90min.

Fingerprint analysis.

Gel digital images were captured with Image Lab software (BIO-RAD, Molecular imager: Gel DocTM XR+) and were analyzed with BioNumerics software (Applied Maths, Inc.). A cluster analysis was performed by calculating a similarity/distance matrix with DICE, a similarity coefficient based on band presence or absence. Then, the resulting similarity matrix was converted into a dendrogram with a clustering algorithm by Unweighted Pair Group Method with the Arithmetic Mean (UPGMA) method with optimization set at 1%.

Genome Sequence

Based on the molecular characterization, two different V. mimicus strains were sequenced using a semiconductor NGS platform (Ion Torrent Personal Genome Machine sequencer, Life Technologies) with a 316 chip at CIAD Mazatlán. The reads were assembled with the program Newbler ver.2.3 mapping against CAIM 602T [31]. A genome-wide assembly and contig synteny was constructed with Mauve Genome Alignment software ver. 2.3.1 [32] using V. mimicus 451 as a reference strain[16]. The contigs were further reassembled with Geneious R6 ver. 6.0.3 (Biomatters Ltd) to obtain two chromosomes (ChI and ChII). Original contigs were annotated by RAST [33] (http://rast.nmpdr.org/) and by NCBI (http://www.ncbi.nlm.nih.gov). We constructed a data base with the information from the annotation for the study of the differences and similarities.

Phylogenetic reconstruction.

Phylogenetic reconstructions of 28 core genome virulence genes of both chromosomes of V. mimicus CAIM 1882, 1883, 602 and V. mimicus 451 were done using two methods: Maximum likelihood (ML) and Neighbor joining (NJ). The ML and NL phylogenetic trees were obtained using MEGA (ver. 5.1) and the robustness of each topology was checked by 1000 bootstrap replicates. V. cholerae O1 biovar El Tor N16961 [34] was used as outgroup in both methodologies. Seventeen sequences of virulence genes were selected from ChI: an accessory colonization factor (AcfD), capsular polysaccharide synthesis enzyme (CpsABCD), chitinase, two hemolysins, MSHA biogenesis protein (MshEFGIJKLMN), MSHA pilin protein (MshABCD), outer membrane proteins (OmpK, OmpT, OmpU), polysaccharide export lipoprotein (Wza), protease IV, regulatory protein (LuxO), transcriptional activator (ToxR), transcriptional regulator (LuxR), transmembrane regulatory protein (ToxS) and type IV pilus (PilMNOPQ). While in ChII eleven sequences of virulence genes were chosen: an autoinducer 2 (LuxQ, LuxP), chitin binding protein, chitinase, hemolysin (HlyA), hemolysin, outer membrane protein (OmpW), putative hemolysin, sensor histidine kinase (CqsS), thermolabile hemolysin and transcriptional regulator (LuxR).

Comparative Microbial Genomics (CMG)

The genomes of V. mimicus were analyzed by the CMG-Biotools [35] to obtain a BLAST matrix. The BLAST hit was considered significant if 50% of the alignment consists of identical matches and the length of the alignment is 50% of the longest gene.

Results

All three isolates showed the 390 bp fragment corresponding to the vmh gene, and were thus confirmed as V. mimicus. The gels obtained from the different molecular fingerprinting methodologies (ERIC-PCR, RAPD, GTG-5 and ARDRA) showed different patterns between isolates and the type strain (CAIM 602T). The dendrograms from the cluster analysis of the gels from each methodology were obtained (Fig 1).

thumbnail
Fig 1. Dendrograms of ERIC-PCR, RAPD, GTG-5PCR and ARDRA used for the analysis of V. mimicus 87, 92, 93 and CAIM 602 (type strain).

The images were analyzed with Bionumerics software (Applied Maths, Inc.) with Dice correlation coefficient for the distance matrix and UPGMA with optimization set at 1% to create the dendrogram.

https://doi.org/10.1371/journal.pone.0144885.g001

With ERIC-PCR, the strains yielded 5 to 13 amplified products of different sizes ranging from approximately 0.1 kb to 4.0 kb, and the similarities ranged between 30% and 66% among the isolates. With RAPD-vmh390R the strains produced 3 to 5 bands ranging in size from approximately 0.3 kb to 2.0 kb, and the similarities ranged between 36% and 50%, and with RAPD-Opi3 the strains yielded 4 to 6 amplified products of different sizes ranging from approximately 0.2 kb to 3.0 kb, and the similarities ranged between 67% and 80% among the isolates. With ARDRA, the analysis results showed that Cfo-I and Hap-II were the most discriminatory enzymes; with both enzymes, the strains generated 3 to 4 amplified products with a size ranging from approximately 0.2 kb to 0.9 kb for Cfo-I, while for Hap-II sizes ranged from 0.1 kb to 0.6 kb; and the similarity among isolates were ranged between 0% and 35% for Cfo-I and 10% and 26% for Hap-II. With GTG5-PCR no differences among these isolates were found. In addition, a composite dendrogram and a similarity matrix was obtained by a cluster analysis of all the band patterns obtained from the different methodologies used (Fig 2). From these data, Vm 92 was the most different from the others, with Vm 87 presented only 54.5% similarity, and with Vm 93 showed 41.7% similarity; whereas Vm 87 and Vm 93 had 71.6% similarity.

thumbnail
Fig 2. Composite dendrogram for the three strains of V. mimicus isolated from frozen shrimp process (V. mimicus 87, 92 and 93) and V. mimicus CAIM 602T (type strain).

The dendrogram and a similarity matrix were obtained by a cluster analysis of ERIC-PCR, GTG-5, RAPD and ARDRA (Bionumerics, Applied Maths, Inc).

https://doi.org/10.1371/journal.pone.0144885.g002

From this molecular characterization, it was confirmed that these three isolates were indeed different strains of V. mimicus. Two of them (i.e., Vm 87 and Vm 92) were selected for sequencing so it can be estimate their pathogenic potential. These strains were deposited at the Collection of Aquatic Important Microorganisms (CAIM: www.ciad.mx/caim) and were registered as CAIM 1882 (Vm 87) and CAIM 1883 (Vm 92). Both genomes were deposited in GenBank under accession numbers PRJNA219179 and PRJNA219181, respectively.

The sequencing yielded a total of 2,932,276 reads (mean length 183 bp) for a total of 540 Mb and an average coverage of 125.6X for CAIM 1882. For CAIM 1883, a total of 2,773,308 reads were obtained (mean length 193 bp) for a total of 536 Mb and an average coverage of 124.5X. The reads were assembled, and 434 contigs for CAIM 1882 (N50 40,957 bp, 92.58% reads mapped) and 455 contigs for CAIM 1883 (N50 41,061 bp, 92.76% reads mapped) were obtained. A summary of the general features from the assembled genomes by chromosome of CAIM 1882 and CAIM 1883 are shown in Table 1.

thumbnail
Table 1. Summary of the general features of V. mimicus CAIM 1882, CAIM 1883, CAIM 602T and V. mimicus 451.

https://doi.org/10.1371/journal.pone.0144885.t001

A genome atlas was generated with GeneWiz browser, where the differences between the genomes of V. mimicus CAIM 602, CAIM 1882, CAIM 1883 and V. mimicus 451 can be visualized (Fig 3). A major variability was observed in ChII than in ChI, some of the differences found in ChI were in genes such as Type IV fimbrial assembly (PilB), zona occludens toxin, accessory cholera enterotoxin, type II restriction enzymes, phage integrase, polysaccharide biosynthesis proteins, transcriptional regulators, and hypothetical proteins. While in ChII genes such as membrane proteins, transcriptional regulators, flagellar proteins, integron integrase, transport proteins, mobile elements, multidrug resistance efflux pumps, and hypothetical proteins were found.

thumbnail
Fig 3. Genome Atlas obtained of V. mimicus CAIM 602 (green), CAIM 1882 (red), CAIM 1883 (blue) and V. mimicus 451 (as control strain).

The atlas was constructed with GeneWiz Browser 0.94. From the inner ring to the outer ring: Percent AT, GC Skew, Global Inverted Repeats, Global Direct Repeats, Position Preference, Stacking Energy and Intrinsic Curvature.

https://doi.org/10.1371/journal.pone.0144885.g003

A proteome comparison was obtained with the four genomes of V. mimicus (> 50% homology) and represented in a BLAST matrix (Fig 4). The homology between the proteomes ranged from 75.8% to 87.3%; observing differences among clinical and environmental strains, and even between environmental strains. Whereas, the homology within proteomes (number of proteins that have homologous hits within the proteome itself) was among 1.5% and 2.4%, being the environmental strains (CAIM 1182 and 1183) those with the lowest percentages.

thumbnail
Fig 4. BLAST matrix (proteome comparison) of V. mimicus 451, V. mimicus CAIM 602, V. mimicus CAIM 1882 and V. mimicus CAIM 1883.

The BLAST matrix was obtained using CMG-biotools [35].

https://doi.org/10.1371/journal.pone.0144885.g004

A summary of the virulence genes found by category in each strain according to the classification used by Kimes et al. [36] is shown in Table 2. CAIM 1882 showed slightly more virulence genes than CAIM 1883. For chromosome I (ChI) a higher number of genes was present in the category type I secretion proteins, followed by flagellar proteins, extracellular components, potential regulators and type IV secretion proteins. While in chromosome II (ChII), the main categories were the type I secretion proteins, chemotaxis proteins, antibiotic resistance proteins and iron uptake.

thumbnail
Table 2. Summary of virulence genes detected in V. mimicus CAIM 1882 and CAIM 1883 by category.

https://doi.org/10.1371/journal.pone.0144885.t002

Moreover, examples of genes encoding virulence factors detected in ChI in both strains were hemolysins, proteases, outer membrane proteins [OmpU, OmpT, OmpK and OmpV], a type IV and MSHA pilus, an aerobactin siderophore, a capsular polysaccharide, an accessory colonization factor (acfD), the transmembrane regulatory protein ToxS, the transcriptional activator ToxR and presence of quorum-sensing regulation system (LuxS, LuxO, LuxR). In addition, some proteins and phage shock proteins were found. Whereas in ChII of both strains, examples of genes coding for virulence factors were metalloproteases, chemotaxis proteins, as well as various hemolysins (e.g., cytolysin and hemolysin HlyA, thermolabile hemolysin precursor and thermostable hemolysin delta-VPH), a putative phosphatase, an adhesin, a chitinase, a type II/IV/ and type VI secretion system proteins. Additionally, genes involved in quorum-sensing (autoinducer 2 (AI-2), CAI-1 autoinducer synthase, sensor histidine kinase CqsS), and various hypothetical proteins were found. In addition, both strains possessed an integron and two prophages in ChII, but no plasmids were detected in any of them.

Based on the virulence genes detected for V. mimicus (CAIM 1882 and 1883), 28 core genome genes of clinical importance in both chromosomes were selected for a phylogenetic study (Fig 5). As expected, a similar cluster pattern for the ML and NJ trees was observed, and both environmental strains were grouped together.

thumbnail
Fig 5. Maximum likelihood (ML) and Neighbor joining (NJ) phylogenetic trees of 28 core genome virulence genes.

The ML and NL phylogenetic trees of both chromosomes of V. mimicus CAIM 1882, 1883, 602 and V. mimicus 451 were obtained using MEGA, where V. cholerae O1 biovar El Tor N16961 [34] was used as outgroup.

https://doi.org/10.1371/journal.pone.0144885.g005

Furthermore, the complete list of gene variations in each strain is shown in Table 3. In ChI few differences were found, which included differences in virulence genes and hypothetical proteins; while in ChII, more genes were detected in CAIM 1882 than in CAIM 1883, and the differences were mainly in virulence genes, transcriptional regulators and hypothetical proteins.

thumbnail
Table 3. Differences in gene content in V. mimicus CAIM 1882 and CAIM 1883.

https://doi.org/10.1371/journal.pone.0144885.t003

Discussion

In recent years, molecular techniques have been used for the study of bacteria and to establish phylogenetic relationships among them. This study has employed various molecular methodologies to determine the differences between three strains of V. mimicus isolated from the washing step in a shrimp processing facility in Sonora, Mexico. The vmh gene is common to V. mimicus and is a useful marker for species identification [27,28]. Different studies have used some of these methods, but it has not been reported before, the simultaneous use of all these techniques for the purpose to study single species and establish which method is more useful to detected genetic variations [3740]. In this study, ERIC-PCR and RAPD (vmh390R) were the most discriminatory techniques for establishing differences, by obtaining the lowest percentages of similarities between the analyzed strains, while GTG5-PCR was the less discriminatory method. ERIC-PCR has been reported for the study of several bacteria, such as V. cholerae, where different patterns were detected, with up to 8 amplification products [38,41]. This is the first report where ERIC-PCR was used for the analysis of V. mimicus strains and by obtaining up to 13 amplified products; this method proved to be a powerful tool for the study of this species and can be used for the detection of genetic variability. Bi et al. [37] used the arbitrarily primed polymerase chain reaction (AP-PCR) to study several clinical strains of V. mimicus, and when comparing their results with those of this study, a similar number of band patterns were found, with the exception that their amplified products were of larger size. It is worth mentioning that the strains used in the previous study were clinical, while in this study, the strains were environmental. Additionally, it is know that there are differences in the genome of clinical and environmental strains of this species [16], so it is possible that these differences can explain the differences in the number of the amplified products. Urakawa et al. [39] performed an RFLP analysis with the 16S rRNA genes of several species of Vibrio, including V. mimicus type strain (CAIM 602T). Their study used several restriction enzymes, including Hae-III, Hin-fI and Alu-I, but the results using these enzymes were omitted because of ambiguous results. In this study, these same enzymes also showed a low level of differentiation between strains, compared with the enzymes Cfo-I and Hap-II, which showed a better differentiation between the strains isolated from the frozen shrimp processing facility. This is the first report in which the enzymes Cfo-I and Hap-II were used for the study of strains of V. mimicus. However, it was not possible to differentiate between V. mimicus CAIM 602T and V. mimicus 93 with these enzymes. In addition, with the cluster analysis that evaluated all the methodologies (ERIC-PCR, RAPD, GTG-5 and ARDRA); it was possible to confirm that the three analyzed strains were different even when they were isolated from the same source. In addition, it is important to consider that each method provides different patterns-resolution, and the selection of one should depend in the desired resolution.

Genome sequencing is opening a door for the understanding of bacteria pathogenesis and study evolutionary history [42]. This study found differences in the gene content in both environmental strains of V. mimicus (CAIM 1882 and CAIM 1883). Those differences were mostly in the ChII involving proteins and virulence genes. Furthermore, the proteome matrix point out differences between these genomes, even when the strains were obtained from the same niche at the same time. These findings give us an outlook of the genomic diversity of V. mimicus.

These environmental genomes presented several virulence genes that were classified into 16 categories, with type I secretion system proteins as the main category. Additionally, genes for type IV pilus proteins (MSHA pilus) and extracellular components such as the capsular polysaccharide (CPS) were present, which have been reported in few studies of V. mimicus [13,16]. Furthermore, this is the first report of an accessory colonization factor (acfD gene) found in V. mimicus, that is also present in others Vibrio species, such as V. cholerae, V. fischeri, V. vulnificus and V. parahaemolyticus, which have been documented to be required for an efficient intestinal colonization, and disruption of any of the four acf genes (acfA, B, C, D) can reduce the ability to colonize [4348]. Sultan et al. [49] found the presence of AI-2 activity and the luxS, luxO and luxR genes in clinical strains of V. mimicus, and in this study the same genes were found in environmental strains of V. mimicus. However, no assays were performed so it remains to be determined their exact roles in which they function. Also, various genes such as the aerobactin siderophore, the ferric aerobactin receptor, ToxR, ToxS, and several others genes found in these strains, have been previously reported in others strains of V. mimicus [27,50,51]. Recently, it was reported the adhesion function of the OmpU protein of V. mimicus [52]. Moreover, various virulence genes found in this study (e.g. OmpU, acfD, MSHA pilus, δ-VPH;, CPS, ToxS, ToxR, etc.) have been studied in other Vibrio species, where their pathogenic mechanisms had been reported, but in V. mimicus little is known about it and more studies are required for establishing the mechanisms that explain the virulence of V. mimicus [5357]. Additionally, a phylogenetic analysis of these virulence genes established a relationship between these environmental genomes. In spite of the lack of virulence mechanisms studies and because the close relationship between Vibrio species, we could expect that those genes will have similar virulence mechanisms in V. mimicus. Therefore the presence of this bacterium in environment could represent a risk to the health of the shrimp consumers, especially because this food can be consumed raw. In addition, the identification of several virulence genes in these strains, that are also present in other Vibrio species, support previous studies that suggest that V. mimicus could be a gene reservoir in the environment for Vibrio species [19,20].

In conclusion, the information described in this study substantiated the importance and effectiveness of the molecular and genomic methodologies to study and characterize microorganisms. Differences between the analyzed environmental strains were found, even though they came from the same source, offering a perspective of the genomic diversity of V. mimicus. Several virulence genes were identified, supporting the pathogenic potential of this species and a phylogenetic relationship between some core genome virulence genes were established. However, more studies are required to determine how these detected virulence genes may have or not an effect on the health of shrimp consumers. Further studies of genes of clinical importance will help to better understand their potential virulence, environmental impact and evolution.

Acknowledgments

We are grateful to Elsa Evelia López Álvarez (CIAD-Guaymas) and Rosalva Pérez Morales (CIAD-Hermosillo) for the excellent support provided in the isolation, biochemical and molecular characterization of these strains.

Author Contributions

Conceived and designed the experiments: LNO EAF BGG. Performed the experiments: IGA ISR EAF BGG LNO. Analyzed the data: EAF BGG IGA LNO GYB. Contributed reagents/materials/analysis tools: LNO EAF BGG. Wrote the paper: IGA LNO EAF BGG GYB.

References

  1. 1. Faruque SM, Nair GB. 27. Epidemiology. In: Thompson FL, Austin B, Swings J, editors. The Biology of Vibrios. American Society of Microbiology; 2006. pp. 385–398.
  2. 2. Davis BR, Fanning R, Madden JM, Steigerwalt AG, Bradford HB Jr, Smith HL Jr, et al. Characterization of Biochemically Atypical Vibrio cholerae Strains and Designation of a New Pathogenic Species, Vibrio mimicus. J Clin Microbiol. 1981;14: 631–639. pmid:7037833
  3. 3. Gonzalez Vazquez E, Tercero Alburo JJ, Quiñones-Ramírez EI, Vazquez Salinas C. El hermano pequeño del cólera Vibrio mimicus. Rev Digit Univ. 2005;6: 1–8. Available: http://www.ru.tic.unam.mx:8080/handle/DGTIC/60274
  4. 4. Zamudio ML. Confirmación de Aislamientos de Vibrio Mimicus Del Brote de Intoxicación Alimentaria en Cuncashca, Carhuaz. Boletín Inst Nac Salud. 2005;11: 75–76. Available: http://www.ins.gob.pe/RepositorioAPS/0/0/par/BOLETIN_2005/BoletinMarzoAbril2005.pdf
  5. 5. Chitov T, Kirikaew P, Yungyune P, Ruengprapan N, Sontikun K. An incidence of large foodborne outbreak associated with Vibrio mimicus. Eur J Clin Microbiol Infect Dis. 2009;28: 421–4. pmid:18925423
  6. 6. Adeleye IA, Daniels FV, Enyinnia VA. Characterization And Pathogenicity of Vibrio spp. Contaminating Seafoods In Lagos, Nigeria. Internet J Food Saf. 2010;12: 1–9. Available: http://www.internetjfs.org/articles/ijfsv12-1.pdf
  7. 7. Lee KH, Heo ST, Kim YR, Pang I. Isolation of Vibrio vulnificus from Seawater and Emerging Vibrio vulnificus Septicemia on Jeju Island. Infect Chemother. 2014;46: 106. pmid:25024873
  8. 8. Mala E, Oberoi A, Alexander VS. Vibrio isolates from cases of acute diarrhea and their antimicrobial susceptibility pattern in a tertiary care hospital. Int J Basic Appl Sci. 2013;3: 35–37.
  9. 9. Wu Y, Wen J, Ma Y, Ma X, Chen Y. Epidemiology of foodborne disease outbreaks caused by Vibrio parahaemolyticus, China, 2003–2008. Food Control. 2014;46: 197–202.
  10. 10. Campos E, Bolaños H, Acuña MT, Díaz G, Matamoros MC, Raventós H, et al. Vibrio mimicus diarrhea following ingestion of raw turtle eggs. Appl Environ Microbiol. 1996;62: 1141–1144. Available: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=167879&tool=pmcentrez&rendertype=abstract pmid:8919774
  11. 11. Begum A, Khan SI. Abundance of Vibrio cholerae non-O1 and Vibrio mimicus in Various Aquatic Components of the Pond Ecosystem in Matlab, Bangladesh. Microbes Environ. 2001;16: 19–23.
  12. 12. Eyisi OAL, Nwodo UU, Iroegbu CU. Distribution of Vibrio species in Shellfish and Water Samples Collected from the Atlantic Coastline of South-East Nigeria. J Health Popul Nutr. 2013;31: 314–20. Available: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3805880&tool=pmcentrez&rendertype=abstract pmid:24288944
  13. 13. Tercero-Alburo JJ, González-Márquez H, Bonilla-González E, Quiñones-Ramírez EI, Vázquez-Salinas C. Identification of capsule, biofilm, lateral flagellum, and type IV pili in Vibrio mimicus strains. Microb Pathog. 2014;76: 77–83. pmid:25246027
  14. 14. Egan ES, Fogel MA, Waldor MK. Divided genomes: Negotiating the cell cycle in prokaryotes with multiple chromosomes. Molecular Microbiology. 2005. pp. 1129–1138. pmid:15882408
  15. 15. Okada K, Iida T, Kita-Tsukamoto K, Honda T. Vibrios commonly possess two chromosomes. J Bacteriol. 2005;187: 752–757. pmid:15629946
  16. 16. Hasan NA, Grim CJ, Haley BJ, Chun J, Alam M, Taviani E, et al. Comparative genomics of clinical and environmental Vibrio mimicus. Proc Natl Acad Sci United States Am. 2010;107: 21134–9.
  17. 17. Thompson JR, Marcelino LA, Polz MF. Diversity, Sources and Detection of Human Bacterial Pathogens in the Marine Environment. In: Belkin S, Colwell RR, editors. Oceans and Health: Pathogens in the Marine Environment. New York: Springer; 2005. pp. 29–69.
  18. 18. Thompson FL, Thompson CC, Vicente ACP, Theophilo GND, Hofer E, Swings J. Genomic Diversity of Clinical and Environmental Vibrio cholerae Strains Isolated in Brazil between 1991 and 2001 as Revealed by Fluorescent Amplified Fragment Length Polymorphism Analysis. J Clin Microbiol. 2003;41: 1946–1950. pmid:12734232
  19. 19. Ramamurthy T, Albert MJ, Huq A, Colwell RR, Takeda Y, Takeda T, et al. Vibrio-Mimicus with Multiple Toxin Types Isolated from Human and Environmental Sources. J Med Microbiol. 1994;40: 194–196. pmid:8114069
  20. 20. Yuan P, Ogawa A, Ramamurthy T, Nair GB, Shimada T, Shinoda S, et al. Vibrio mimicus are the reservoirs of the heat-stable enterotoxin gene (nag-st) among species of the genus Vibrio. World J Microbiol Biotechnol. 1994;10: 59–63. pmid:24420888
  21. 21. Guardiola-Avila I, Noriega-Orozco L, Gomez-Gil B, Acedo-Felix E. Factores de virulencia de Vibrio mimicus—Vibrio mimicus Virulence Factors. Biotecnia. 2015;XVII: 38–49. Available: www.biotecnia.uson.mx
  22. 22. Field D, Hughes J, Moxon RE. Using the GEnome to Understand Pathogenicity. In: Woodford N, Johnson AP, editors. Methods in Molecular Biology Vol 266: Genomics, Proteomics, and Clinical Bacteriology. Totowa, NJ: Humana Press; 2004. pp. 261–287.
  23. 23. Roberts I. 8.1 Gene Expression and Analysis. In: Williams P, Ketley J, Salmond G, editors. Methods in Microbiology: Bacteria Pathogenesis. Academic Press; 1998. pp. 467–483.
  24. 24. Ochman H. Evolution of Bacterial Pathogens. In: Groisman EA, editor. Principles of Bacterial Pathogenesis. Academic P. San Diego, California; 2001. p. 41.
  25. 25. Hallin PF, Stærfeldt H-H, Rotenberg E, Binnewies TT, Benham CJ, Ussery DW. GeneWiz browser: An Interactive Tool for Visualizing Sequenced Chromosomes. Stand Genomic Sci. 2009;1: 204–215. pmid:21304658
  26. 26. Noriega-Orozco L, Acedo-Félix E, Higuera-Ciapara I, Jiménez-Flores R, Cano R. Pathogenic and non pathogenic Vibrio species in aquaculture shrimp ponds. Rev Latinoam Microbiol. 2007;49: 60–67. Available: http://www.medigraphic.com/pdfs/lamicro/mi-2007/mi07-3_4d.pdf
  27. 27. Shinoda S, Nakagawa T, Shi L, Bi K, Kanoh Y, Tomochika K, et al. Distribution of Virulence-Associated Genes in Vibrio mimicus Isolates from Clinical and Environmental Origins. Microbiol Immunol. 2004;48: 547–551. pmid:15272201
  28. 28. Sultan Z, Mizuno T, Sakurai A, Takata N, Okamoto K, Miyoshi S. Growth Phase Dependant Activation of the Precursor of Vibrio mimicus Hemolysin (Pro-VMH). J Heal Sci. 2007;53: 430–434.
  29. 29. Versalovic J, Schneider M, De Bruijn FJ, Lupski JR. Genomic Fingerprinting of Bacteria Using Repetitive Sequence-Based Polymerase Chain Reaction. Methods Mol Cell Biol. 1994;5: 25–40.
  30. 30. Doll L, Moshitch S, Frankel G. Poly(GTG)5-associated profiles of Salmonella and Shigella genomic DNA. Res Microbiol. 1993;144: 17–24. pmid:8327779
  31. 31. Guardiola-Avila I, Acedo Félix E, Noriega-Orozco L, Yepiz-Plascencia G, Sifuentes-Romero I, Gomez-Gil B. Draft genome sequence of Vibrio mimicus strain CAIM 602T. Genome Announc. 2013;1: 3–4.
  32. 32. Darling ACE, Mau B, Blattner FR, Perna NT. Mauve: Multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 2004;14: 1394–1403. pmid:15231754
  33. 33. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 2008;9: 75. pmid:18261238
  34. 34. Heidelberg JF, Eisen JA, Nelson WC, Clayton RA, Gwinn ML, Dodson RJ, et al. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature. 2000;406: 477–483. pmid:10952301
  35. 35. Vesth T, Lagesen K, Acar Ö, Ussery D. CMG-Biotools, a Free Workbench for Basic Comparative Microbial Genomics. PLoS One. 2013;8.
  36. 36. Kimes NE, Grim CJ, Johnson WR, Hasan NA, Tall BD, Kothary MH, et al. Temperature regulation of virulence factors in the pathogen Vibrio coralliilyticus. The ISME Journal. Nature Publishing Group; 2012. pp. 835–846. pmid:22158392
  37. 37. Bi K, Shi L, Maehara Y, Miyoshi S, Tomochika K, Shinoda S. Analysis of Vibrio mimicus clinical strains by arbitrarily primed polymerase chain reaction. Microbiol Immunol. 2000;44: 149–153. pmid:10803502
  38. 38. Rivera I, Chowdhury M, Huq A, Jacobs D, Martins M, Colwell R. Enterobacterial repetitive intergenic consensus sequences and the PCR to generate fingerprints of genomic DNAs from Vibrio cholerae O1, O139, and non-O1 strains. Appl Envir Microbiol. 1995;61: 2898–2904. Available: http://aem.asm.org/cgi/content/long/61/8/2898
  39. 39. Urakawa H, Kita-Tsukamoto K, Ohwada K. 16S rDNA genotyping using PCR/RFLP (restriction fragment length polymorphism) analysis among the family Vibrionaceae. FEMS Microbiol Lett. 1997;152: 125–132. pmid:9228779
  40. 40. Gomez-Gil B, Soto-Rodŕiguez S, García-Gasca A, Roque A, Vazquez-Juarez R, Thompson FL, et al. Molecular identification of Vibrio harveyi-related isolates associated with diseased aquatic organisms. Microbiology. 2004;150: 1769–1777. pmid:15184563
  41. 41. Waturangi DE, Joanito I, Yogi Y, Thomas S. Use of REP- and ERIC-PCR to reveal genetic heterogeneity of Vibrio cholerae from edible ice in Jakarta, Indonesia. Gut Pathogens. BioMed Central Ltd; 2012. p. 2. pmid:24576322
  42. 42. Dale JW, Park SF. Molecular Genetics of Bacteria. 4th Editio. Dale JW, Park SF, editors. West Sussex, England: John Willey & Sons Ltd.; 2004.
  43. 43. Peterson KM, Mekalanos JJ. Characterization of the Vibrio cholerae ToxR regulon: Identification of Novel Genes Involved in Intestinal Colonization. 1988;56: 2822–2829. pmid:2902009
  44. 44. Trucksis M, Galen JE, Michalski J, Fasano A, Kaper JB. Accessory cholera enterotoxin (Ace), the third toxin of a Vibrio cholerae virulence cassette. Proc Natl Acad Sci U S A. 1993;90: 5267–5271. pmid:8389476
  45. 45. Everiss KD, Hughes KJ, Kovach ME, Peterson KM. The Vibrio cholerae acfB colonization determinant encodes an inner membrane protein that is related to a family of signal-transducing proteins. Infect Immun. 1994;62: 3289–3298. pmid:8039900
  46. 46. Ruby EG, Urbanowski M, Campbell J, Dunn A, Faini M, Gunsalus R, et al. Complete genome sequence of Vibrio fischeri: a symbiotic bacterium with pathogenic congeners. Proc Natl Acad Sci U S A. 2005;102: 3004–3009. pmid:15703294
  47. 47. Park JH, Cho Y-J, Chun J, Seok Y-J, Lee JK, Kim K-S, et al. Complete genome sequence of Vibrio vulnificus MO6-24/O. J Bacteriol. 2011;193: 2062–2063. pmid:21317338
  48. 48. Jensen RV, DePasquale SM, Harbolick EA, Hong T, Kernell AL, Kruchko DH, et al. Complete Genome Sequence of Prepandemic Vibrio parahaemolyticus BB22OP. Genome Announc. 2013;1: 1–2.
  49. 49. Sultan Z, Miyoshi S, Shinoda S. Presence of LuxS/AI-2 Based Quorum-Sensing System in Vibrio mimicus: LuxO Controls Protease Activity. Microbiol Immunol. 2006;50: 407–417. doi:JST.JSTAGE/mandi/50.407 [pii] pmid:16714849
  50. 50. Okujo N, Yamamoto S. Identification of the siderophores from Vibrio hollisae and Vibrio mimicus as aerobactin. FEMS Microbiol Lett. 1994;118: 187–192. pmid:8013878
  51. 51. Bi K, Miyoshi S, Tomochika K, Shinoda S. Detection of Virulence Associated Genes in Clinical Strains of Vibrio mimicus. Microbiol Immunol. 2001;45: 613–616. pmid:11592635
  52. 52. Liu X, Gao H, Xiao N, Liu Y, Li J, Li L. Outer Membrane Protein U (OmpU) Mediates Adhesion of Vibrio mimicus to Host Cells via Two Novel N-Terminal Motifs. PLoS One. 2015;10: e0119026. pmid:25742659
  53. 53. Wright AC, Powell JL, Tanner MK, Ensor LA, Karpas AB, Morris JG, et al. Differential expression of Vibrio vulnificus capsular polysaccharide. Infect Immun. 1999;67: 2250–2257. pmid:10225881
  54. 54. Provenzano D, Schuhmacher DA, Barker JL, Klose KE. The Virulence Regulatory Protein ToxR Mediates Enhanced Bile Resistance in Vibrio cholerae and Other Pathogenic Vibrio Species. Infect Immun. 2000;68: 1491–1497. pmid:10678965
  55. 55. Peterson KM. Expression of Vibrio cholerae Virulence Genes in Response to Environmental Signals. Curr Issues Intest Microbiol. 2002;3: 29–38. pmid:12400636
  56. 56. Wibbenmeyer JA, Provenzano D, Landry CF, Klose KE, Delcour AH. Vibrio cholerae OmpU and OmpT Porins Are Differentially Affected by Bile. Infect Immun. 2002;70: 121–126. pmid:11748172
  57. 57. Zhang XH, Austin B. Haemolysins in Vibrio species. Journal of Applied Microbiology. 2005. pp. 1011–1019. pmid:15836469