Identification of Transcription Factor AML-1 Binding Site Upstream of Human Cytomegalovirus UL111A Gene

Xiaoqun Zheng; Yan Gao; Qi Zhang; Yanqing Liu; Ying Peng; Miao Fu; Yanhong Ji

doi:10.1371/journal.pone.0117773

Abstract

Human cytomegalovirus (HCMV) interleukin-10 (hcmvIL-10), encoded by HCMV UL111A gene, is a homolog of human IL-10. It exerts immunomodulatory effects that allow HCMV to evade host defense mechanisms. However, the exact mechanism underlying the regulation of hcmvIL-10 expression is not well understood. The transcription factor acute myeloid leukemia 1 (AML-1) plays an important role in the regulation of various genes involved in the differentiation of hematopoietic lineages. A putative AML-1 binding site is present within the upstream regulatory region (URR) of UL111A gene. To provide evidence that AML-1 is involved in regulating UL111A gene expression, we examined the interaction of AML-1 with the URR of UL111A in HCMV-infected human monocytic THP-1 cells using a chromatin immunoprecipitation assay. HcmvIL-10 transcription was detected in differentiated THP-1 cells, but not in undifferentiated ones. Furthermore, the URR of UL111A showed a higher intensity of AML-1 binding, a higher level of histone H3 acetyl-K9, but a lower level of histone H3 dimethyl-K9 in differentiated THP-1 cells than undifferentiated cells. Down-regulation of AML1 by RNA interference decreased the expression of the UL111A gene. Our results suggest that AML-1 may contribute to the epigenetic regulation of UL111A gene via histone modification in HCMV-infected differentiated THP-1 cells. This finding could be useful for the development of new anti-viral therapies.

Citation: Zheng X, Gao Y, Zhang Q, Liu Y, Peng Y, Fu M, et al. (2015) Identification of Transcription Factor AML-1 Binding Site Upstream of Human Cytomegalovirus UL111A Gene. PLoS ONE 10(2): e0117773. https://doi.org/10.1371/journal.pone.0117773

Academic Editor: Zhefeng Meng, Fudan University, CHINA

Received: October 6, 2014; Accepted: December 30, 2014; Published: February 6, 2015

Copyright: © 2015 Zheng et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Data Availability: All relevant data are within the paper.

Funding: This study was supported by Chinese National Science Foundation Grant (NSFC) 81071365 (URL: http://isisn.nsfc.gov.cn/egrantindex/funcindex/prjsearch-list), and Zhejiang Provincial Natural Science Foundation Grant (ZJSFC) LY13H190006 (URL: http://www.zjnsf.gov.cn/1/xm/lx.aspx). Xiao-Qun Zheng received those two grants, and designed the project. In addition, both NSFC and ZJSFC also contributed to design this project.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Human cytomegalovirus (HCMV) encoding for more than 227 proteins, a member of the β-herpesvirus subfamily, has infected the majority of the world’s population as a consequence of its highly restricted host range [1,2]. Primary HCMV infection in healthy individuals is often asymptomatic, because HCMV can establish and maintain a lifelong latent infection in myeloid progenitor cells [3–5]. However, upon HCMV reactivation from latency, it can cause serious and even life-threatening diseases including retinitis, pneumonitis, hepatitis, and gastrointestinal disease in newborns and immunocompromised individuals, such as AIDS patients and allograft recipients [6,7]. One of the strategies that HCMV has developed to evade detection by the host immune system is to encode homologs of cytokines, chemokines, and their receptors [8–11]. Those properties, shared by all herpesviruses, may promote viral infection by manipulating and evading the host immune defense mechanisms.

HCMV interleukin-10 (hcmvIL-10), which consists of 175 amino acids encoded by HCMV UL111A gene, has been identified as a human IL-10 (hIL-10) homolog. It shares a 27% amino acid sequence identity with hIL-10, and has similar functions, which exerts a broad range of immunosuppressive effects [12,13]. HcmvIL-10 has been reported to inhibit dendritic cell (DC) maturation by reducing MHC class ΙΙ expression, and further increase apoptosis associated with DC maturation by blocking the upregulation of the anti-apoptotic, long isoform of cellular FLICE-like inhibitory protein [14–16]. Recently, M2 macrophages were demonstrated to possess increased permissiveness of HCMV productive infection, thus raising the intriguing possibility that hcmvIL-10 might mediate the polarization of monocytes to an M2c phenotype to enhance subsequent HCMV infection [17]. Taken together, these data suggest that hcmvIL-10 contributes significantly to the immune evasion strategies of HCMV. However, the exact mechanism underlying the regulation of UL111A gene expression is still not well understood.

Acute myeloid leukemia 1 (AML-1), a myeloid transcription factor, plays an important role in the regulation of various genes involved in the differentiation of hematopoietic lineages [18,19]. A putative AML-1 binding site is located within the upstream regulatory region (URR) of the UL111A gene. However, it is not yet clear whether AML-1 is involved in controlling the expression of UL111A.

In this study, we aimed to elucidate the role of myeloid transcription factors in regulating UL111A gene expression. For this purpose, we performed chromatin immunoprecipitation (ChIP) assays to measure binding of transcription factors to the URR of UL111A. Furthermore, the presence of histone H3 modifications was investigated in the transcription factor binding sites of the UL111A URR. We analyzed the DNA methylation pattern of the UL111A URR in both HCMV-infected differentiated and undifferentiated THP-1 cells using the bisulfite modification method, and further examined how shifts in the HCMV URR methylation may affect viral gene expression and replication. Our findings suggest that AML-1 may contribute to the epigenetic activation of UL111A via histone modification in HCMV-infected differentiated THP-1 cells.

Materials and Methods

Cells and viruses

HEL (human embryonic lung fibroblast) cells were obtained from the Kunming Institute of Zoology of the Chinese Academy of Sciences and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco), 2 mM L-glutamine, and 100 U/ml penicillin and 100 μg/ml streptomycin. THP-1 cells (a human acute monocytic leukemia cell line) were obtained from the cell bank of the Shanghai Institute, and maintained in RPMI-1640 medium (Gibco) with 10% FBS, 100 U/ml penicillin and 100 μg/ml streptomycin. All cells were cultured at 37°C in a 5% CO₂ humidified atmosphere. Towne strain of HCMV (HCMV-Towne), obtained from American Type Culture Collection (ATCC), was a gift from Dr. Shiqiang Shang (Zhejiang University).

Virus infection

HEL cells were used for virus production. HEL cells were typically infected at approximately 50~70% confluence with purified HCMV-Towne at a multiplicity of infection (MOI) of 5. As soon as cytopathic effects were evident, the culture supernatant containing virus was harvested and centrifuged at 4000× g for 5 min at 4°C. Virus stocks were stored at −80°C for future use. The supernatants from the infected HEL cells were assayed for infectivity, and viral titers were determined by plaque assay. For latency studies, THP-1 cells (1×10⁶/ml) were infected with HCMV-Towne at an MOI of 5 in 6-well plates. At 24 h post-infection, the medium was changed and the infection was allowed to proceed for 10 days, during which half of the medium was changed every 2 days. At each assay point, cells remaining in suspension were harvested and analyzed. For reactivation studies, macrophage differentiation of THP-1 cells was achieved by treating the infected cells with 100 ng/ml phorbol 12-myristate 13-acetate (PMA, Beyotime, China) for 24 h. PMA-treated cells became adherent and acquired a spindle-like morphology. The infection was allowed to proceed for 10 days, with changes of fresh medium containing PMA every 2 days. Cells and supernatants were collected separately at the indicated day post infection (dpi), and then analyzed. Viral genomes were quantified by real-time quantitative PCR (qPCR). The data presented are the averages from three independent experiments.

Viral DNA extraction and quantitative analysis by qPCR

Infected cells were harvested, washed twice with phosphate-buffered saline (PBS), and pelleted by low-speed centrifugation. Total DNA was extracted from the cells using a QIAamp DNA Mini Kit (QIAGEN, Germany) according to the manufacturer’s instructions. The DNA concentration was determined by a NanoDrop 2000 UV-vis spectrophotometer (Thermo Scientific, USA). Subsequently, a qPCR assay was performed with primers for the viral immediate-early 1(IE1) gene to determine the levels of viral DNA loads using an ABI 7500 Real Time PCR System (Applied Biosciences, USA).

RNA extraction and RT-PCR analysis

Total RNA was isolated using Trizol reagent (Invitrogen, USA) according to the manufacturer’s recommendations and quantified using a spectrophotometer. The expression level of associated HCMV transcripts was evaluated by reverse transcription-PCR (RT-PCR) using a PrimeScript RT-PCR Kit (Takara, Japan). The primer sets used for RT-PCR are listed in Table 1. The PCR products were separated on 1.5% agarose gels and visualized by ethidium bromide staining.

Download:

Table 1. Primers used for mRNA RT-PCR amplification of HCMV mRNAs.

https://doi.org/10.1371/journal.pone.0117773.t001

Identification of transcription factor binding sites

The MATCH program, which is provided with the TRANSFAC (version 9.4) database (http://www.gene-regulation.com/cgi-bin/pub/programs/match/bin/match.cgi;Biobase Biological Databases), was used to identify putative transcription factor binding sites within the URR of the UL111A gene. The MATCH program [20] sets a point (0–1) for each base using a single nucleotide weighted model in TRANSFAC Professional 9.4 library [21].

Chromatin immunoprecipitation (ChIP) assay and quantitative analysis of ChIP-PCR products

ChIP assays were carried out using an EZ ChIP Chromatin Immunoprecipitation Kit (Millipore, USA) according to the manufacturer’s recommendations. Briefly, the THP-1 cells (10⁶ cells/ml) infected with HCMV Towne strain (MOI = 5) for 4 days in the presence or absence of PMA, were cross-linked in 1% formaldehyde for 10 min at room temperature followed by glycine treatment for 5 min to quench unreacted formaldehyde. The cells were washed with PBS containing 5 μl 0.5% protease inhibitor cocktail and then lysed in 1 ml of SDS lysis buffer for 10 min on ice. The lysate was sonicated on ice to yield chromatin fragments of 200–1000 bp. Soluble chromatin was pre-cleared with 60 μl of Protein G agarose by rotation for 1 h at 4°C to remove proteins or DNA that may bind nonspecifically to Protein G agarose. Subsequently, the chromatin was incubated at 4°C overnight with the following primary antibodies: anti-AML-1 (Abcam, ab23980), anti-GATA1 (Abcam, ab11963), anti-C/EBP β (Abcam, ab32358), anti-histone H3 acetyl-K9 (Abcam, ab4441), anti-histone H3 dimethyl-K9 (Abcam, ab1220). The chromatin immunoprecipitates were harvested by adding 60 μl of Protein G agarose beads and washed sequentially with wash buffer. The cross-links of protein/DNA complexes were reversed by incubation in 5M NaCl at 65°C for 4–5 hours or overnight. Subsequently, the free DNA was purified using a DNA spin column. The immunoprecipitated DNA fractions were amplified by PCR with Ex Taq polymerase (Takara), and were used to detect the URR of HCMV UL111A gene. The primer sets used for ChIP-PCR are shown in Table 2. The PCR products were analyzed by 1.5% agarose gel electrophoresis, visualized by ethidium bromide staining, and quantified using Image J software.

Download:

Table 2. Primers used for ChIP-DNA PCR amplification.

https://doi.org/10.1371/journal.pone.0117773.t002

Western blot analysis

The nucleoproteins from THP-1 cells were extracted using a Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime) according to the manufacturer’s recommendations. Protein quantification was performed using a BCA Protein Assay Kit (Beyotime). Prior to western blot analysis, the extracted protein was diluted with sample buffer, and boiled for 10 min at 100°C. Protein samples (50 ug) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a nitrocellulose membrane. The blots were blocked in 5% skim milk in PBS containing 0.1% Tween-20 for 2 h at room temperature, and incubated with primary antibodies: anti-AML-1, anti-GATA, and anti-C/EBP β in dilution buffer (1:1000). Subsequently, the blots were washed, incubated with horseradish peroxidase-conjugated anti-mouse or anti-rabbit secondary antibodies (Beyotime), and detected using the beyoECL Plus (Beyotime). The signal intensity of indicated protein bands was quantified using the Image J software.

Bisulfite Sequencing PCR (BSP)

Bisulfite modification method was used to analyze the methylation of the HCMV genomic DNA. Bisulfite treatment converts unmethylated cytosine residues (C) to uracil (U), which are converted to thymine (T) after PCR amplification, while methylated C is protected from conversion. Bisulfite-treated DNA was amplified by PCR, cloned and then sequenced. In our study, DNA denaturation and bisulfite conversion processes was integrated into one-step by a EpiTect Plus DNA Bisulfite Kit (QIAGEN) according to the manufacturer’s instructions. Bisulfite-treated genomic DNA was amplified by PCR using HS Taq polymerase (Takara) and primers spanning the URR of UL111A gene (from-4231 to-4001 bp and-4511 to-4149 bp relative to the UL111A gene). The primer sequences were:

URR1 forward primer: 5′-AGTAGAATAGAGATTTTTTGTT-3′; URR1 reverse primer: 5′-CTTCCACTTATTTTTTATTATT-3′.

URR2 forward primer: 5′-TGTTTGGTAAAGGAATAATT-3′; URR2 reverse primer: 5′-TCTCTAATTCCCTAAAAAACAAA-3′.

The PCR reaction mixtures were performed in a total of 25 μl containing 2.5μl of 10× PCR buffer, 2 μl of 25mM MgCl₂, 2.5 μl of 25 mM deoxynucleotide triphosphates, 0.5 μl of each PCR primer (20 μM), 0.625 U of HS Taq (Takara) and 2 μl of the bisulfite modified DNA. The PCR amplification conditions were as follows: initial denaturation at 94°C for 5 min, followed by 35 cycles of 95°C for 30 s, annealing at 53.6°C (for the URR1 primer pair) or 43.3°C (for the URR2 primer pair) for 1 min, extension at 72°C for 1 min and finally 72°C for 10 min. The amplified fragment lengths were 212 bp (URR1 primer pair) and 362 bp (URR2 primer pair). PCR products were gel-purified by an Agarose Gel DNA Purification Kit (Takara) according to the manufacturer’s instructions. Purified PCR fragments were cloned into a pMD18-T simple vector (Takara), and the individual recombinant clones were sequenced to identify the presence of methylated CpGs within the URR of the UL111A gene. Sequencing of the bisulfite-modified DNA was performed by Invitrogen Biotechnology Co., Ltd. (USA), and the sequences of the PCR products were analyzed using DNAMAN software (Lynnon Biosoft, USA).

RNA interference analysis

The lentivirus-mediated short hairpin RNA (shRNA) was designed for triggering of the gene silencing RNA interference (RNAi) pathway. For the transfection experiments, HCMV-infected THP-1 cells were seeded at 1×10⁵ cells/ml in RPMI-1640 medium before transfection, then HCMV-infected THP-1 cells were transfected with LV-shRNA-AML-1 (CCAGGTTGCAAGATTTAATGA) or negative control (LV-shRNA-NC: TTCTCCGAACGTGTCACGT) (GenePharma, Shanghai, China) according to manufacturer’s protocol. After 24 h post-transfection, half of the medium was changed, and the transfection efficiency of lentivirus-mediated shRNA into cells expressing GFP proteins was observed by FACS analysis at 72 h post-transfection. Total RNA and protein were extracted for further analysis.

Results and Discussion

HCMV genome maintenance and highly restricted transcription of viral genes in HCMV-infected THP-1 cells

We evaluated the maintenance and transcription of HCMV genome in infected THP-1 cells over a 10-day course of infection. Microscopic examination of the HCMV-infected THP-1 cells revealed a round morphology (Fig. 1A). Total DNA and RNA were isolated to quantify viral genome and transcripts, respectively. The viral IE1 gene was evaluated by qPCR to monitor viral DNA maintenance. The levels of UL123 (IE1), UL83 (pp65) and LUNA mRNA were determined using RT-PCR to assess viral gene transcription levels. In the infected THP-1 cells, HCMV DNA was maintained but failed to accumulate (Fig. 1B). The level of UL123 mRNA increased initially after infection, but decreased over time until the signal was undetectable; whereas the LUNA mRNA was detectable throughout the course of infection. In contrast, the expression of UL83 mRNA was undetectable over the 10-day course of infection (Fig. 1C). These findings are consistent with previous reports that in ex vivo primary cells, viral IE1 gene expression becomes activated at early stages of infection, and is subsequently repressed [22,23]. Collectively, our data suggest that the HCMV genome is maintained in HCMV-infected THP-1 cells, but its transcription prior to viral DNA replication is highly restricted.

Download:

Fig 1. HCMV genome maintenance and transcription in infected THP-1 cells.

(A) Microscopic examination of THP-1 cells infected with HCMV-Towne and grown in suspension (original magnification ×200). (B) Real-time qPCR analysis revealed the maintenance but lack of accumulation of the HCMV genome in infected THP-1 cells. Each sample was analyzed in triplicate. (C) Expression of HCMV transcripts (UL123, UL83, and LUNA mRNA) in infected THP-1 cells over a 10-day course of infection analyzed by RT-PCR. RT− represents RNA without prior reverse transcription, employed as a negative control. Dpi: day post infection.

https://doi.org/10.1371/journal.pone.0117773.g001

HCMV transcription in infected THP-1 cells following the addition of PMA

PMA is commonly used to reactivate viral transcription in ex vivo herpesvirus latency model systems, including Epstein-Barr virus (EBV) [24] and Kaposi’s sarcoma-associated herpesvirus (KSHV) [25]. In this study, stimulation of HCMV- infected THP-1 cells with PMA resulted in differentiation of the cells into an adherent macrophage-like phenotype (Fig. 2A). Macrophages have been shown to be important in HCMV reactivation [26–28]. In fact, partial HCMV reactivation has been observed in THP-1 [29], and NTera2 [30] cell lines after treatment with PMA. Therefore, we next investigated whether the HCMV genes were transcribed in THP-1 cells following PMA stimulation. To achieve this, DNA and total RNA were extracted over 10 days from HCMV-infected cells cultured in the presence of PMA, and the replication of HCMV DNA and accumulation of UL123, UL83 and LUNA mRNAs were monitored as described above. As shown in Fig. 2B, the viral DNA loads started to increase at day 5 following PMA treatment, suggesting that the infection of differentiated THP-1 cells with the Towne strain of HCMV is productive. Notably, the UL123 mRNA level in the differentiated THP-1 cells gradually increased over time, and rapidly reached its peak at day 5. The expression of UL83 mRNA was detected at about day 3 post-induction with PMA and continued to increase thereafter. The expression of LUNA mRNA in the differentiated THP-1 cells was observed throughout the course of infection (Fig. 2C). Our results show that HCMV gene transcription is more abundant in THP-1 cells treated with PMA than untreated cells, suggesting that cell differentiation promotes HCMV reactivation in PMA-treated THP-1 cells.

Download:

Fig 2. Induction of viral transcription in infected THP-1 cells with PMA treatment.

(A) Microscope image showing differentiation of HCMV-infected THP-1 cells into an adherent and macrophage-like phenotype following stimulation with PMA (100 ng/μl) (original magnification ×200). (B) Viral DNA loads over time in HCMV-infected THP-1 cells following PMA treatment. Each sample was assayed in triplicate by qPCR. (C) Expression of viral transcripts in PMA-treated THP-1 cells infected with HCMV. RT− represents the RNA without prior reverse transcription, employed as a negative control.

https://doi.org/10.1371/journal.pone.0117773.g002

Upregulation of hcmvIL-10 expression in differentiated THP-1 cells

HcmvIL-10, a functional homolog of hIL-10, is transcribed from the HCMV UL111A gene during productive infection [12,31]. However, the expression of a similar transcript, the latency-associated cmvIL-10 (LAcmvIL-10) from the alternative splicing of the UL111A region has been reported both during latent infection [32] and productive infection [33], suggesting that LAcmvIL-10 is latency-associated rather than latency-specific [13]. To determine whether hcmvIL-10 was expressed in HCMV-infected THP-1 cells treated with PMA, RT-PCR was used to analyze total RNA isolated from infected cells cultured for 4 days in the presence or absence of PMA. Expectedly, the expression of hcmvIL-10 mRNA was undetectable in untreated THP-1 cells, whereas the expression of hcmvIL-10 mRNA was significantly increased in PMA-treated differentiated THP-1 cells (Fig. 3A, 3B). However, the expression of LAcmvIL-10 can be detected both in PMA untreated and treated infected THP-1 cells. These data suggest that macrophage differentiation of HCMV-infected THP-1 cells induced by PMA treatment may upregulate hcmvIL-10 expression.

Download:

Fig 3. Transcription of the UL111A gene and expression of transcription factors in PMA-treated and untreated THP-1 cells infected with HCMV.

(A) Expression levels of the hcmvIL-10 and LAcmvIL-10 transcripts in differentiated and undifferentiated HCMV-infected THP-1 cells, analyzed by RT-PCR. (B) Quantitative analysis of the data in (A) from three independent experiments. RNA transcripts were normalized to cellular GAPDH. (C) Western blots showing the expression level of AML-1, GATA-1, and C/EBP β proteins in differentiated and undifferentiated HCMV-infected THP-1 cells. (D) Quantitative analysis of the data in (C) from three independent experiments. Proteins were normalized to cellular β-actin. *P < 0.05, **P < 0.01, ***P < 0.001.

https://doi.org/10.1371/journal.pone.0117773.g003

Taken together, it is evident from our above findings that HCMV infection is not productive in untreated THP-1 cells. Monocytes differentiation is required for being permissive to HCMV replication [34]. The detection of hcmvIL-10 transcription in differentiated cells, but not in undifferentiated THP-1 cells, further suggests that hcmvIL-10 transcription might be facilitated by myeloid differentiation.

Expression of transcription factors in HCMV-infected THP-1 cells

We next sought to examine the changes in the expression levels of the transcription factors AML-1, GATA-1 and C/EBP β in PMA-treated and untreated HCMV-infected THP-1 cells. For this purpose, nucleoproteins were extracted from the infected cells at 4 dpi, and subjected to western blot analysis using specific antibodies. Strikingly, in uninfected cells, AML-1 and GATA-1 expression was similar in the PMA-treated and untreated cells, whereas in HCMV-infected cells, AML-1 and GATA-1 expression was much lower in PMA-treated cells than in untreated cells. Conversely, the expression of C/EBP β was significantly higher in PMA-treated cells compared to untreated cells (Fig. 3C, 3D). Therefore, our results indicate that a differential expression of transcription factors occurs in different phases of cell differentiation and development.

Identification of functional transcription factor binding sites in the UL111A gene promoter

In order to identify the transcription factors that may be responsible for regulating UL111A gene function during HCMV infection, we initially identified putative transcription factor binding sites in the URR of the UL111A gene by bioinformatics analysis. Notably, three adjacent putative transcription factor binding consensus sequences (AML-1, GATA-1 and C/EBP β) were identified in the URR of UL111A (Fig. 4A). We then conducted quantitative analyses to determine the binding of these three transcription factors to the UL111A URR using ChIP assays with antibodies against each transcription factor. The binding intensities of AML-1, GATA-1 and C/EBP β to the UL111A URR were found to be significantly higher in PMA-treated THP-1 cells than in untreated cells (P <0.05; Fig. 4B, 4C).

Download:

Fig 4. Identification of transcription factor binding sites in the URR of the UL111A gene.

(A) Potential binding sites for the myeloid transcription factors AML-1, C/EBP β, and GATA-1 in the URR of the UL111A gene predicted using the MATCH program and TRANSFAC database. (B) ChIP analysis of three transcription factors binding to their corresponding sites. The lanes are designated as: “input”—PCR amplification of input DNA, “anti-TF”—PCR amplification of chromatin DNA fragments precipitated by antibodies against transcription factors, “isotype”—a control for non-specific reactions. (C) Comparison of transcription factor binding between undifferentiated and differentiated THP-1 cells. Quantitative analysis of the data is from three independent experiments. *** P < 0.001.

https://doi.org/10.1371/journal.pone.0117773.g004

Collectively, our results indicate that the three myeloid transcription factors, AML-1, GATA-1 and C/EBP β are recruited efficiently to the UL111A gene promoter upon PMA-induced differentiation in HCMV-infected THP-1 cells, and the recruit is independent of the expression level of the transcription factors.

Differential pattern of histone modification in the URR of UL111A in differentiated and undifferentiated THP-1 cells

Recently, it has been reported that histone modifications at the epigenetic level are associated with the transcriptional regulation of various herpesvirus genomes [35–38]. Histone posttranslational modifications are known to control gene expression. It is widely believed that methylation of histone H3 at the K9 position is usually associated with transcriptional repression, whereas acetylation at this position enhances gene transcription [39]. Therefore, we hypothesize that histone H3 K9 modifications may play an important role in the regulation of hcmvIL-10 mRNA expression. To test this hypothesis, a ChIP assay was used to examine the presence of histone H3 modifications in the transcription factor (AML-1, GATA-1 and C/EBP β) binding sites of UL111A URR with antibodies against H3 acetyl-K 9 or H3 dimethyl-K9. Stark differences in histone H3 modifications were observed between differentiated and undifferentiated THP-1 cells infected with HCMV (Fig. 5A, 5B). In the undifferentiated cells, the AML-1 and GATA-1 binding sites were predominantly associated with H3 dimethyl-K9 modification, while the C/EBP β binding site showed no histone H3 K9 modifications. However, in the differentiated cells, the AML-1 binding site was associated with a H3 acetyl-K9 modification, while the C/EBP β and GATA-1 binding sites showed no histone H3 K9 modifications. These results are consistent with previous studies, which showed that HCMV modulates the chromatin modification machinery of the host cellular system to control the expression of viral genes in both undifferentiated and differentiated monocytes [40–42]. Hence, our findings suggest that, histone H3 modifications of the AML-1 binding site may influence the activation of the UL111A gene.

Download:

Fig 5. Epigenetic modification status in the URR of UL111A from undifferentiated and differentiated HCMV-infected THP-1 cells.

(A) ChIP analysis showing the association of the transcription factors binding sites with histone H3 acetylated at K9 position (H3 acetyl-K9) and dimethylated at K9 position (H3 dimethyl-K9). The lanes are designated as: “input”—PCR amplification of input DNA, “anti-acetyl”—PCR amplification of the chromatin DNA fragments precipitated by antibody against H3 acetyl-K9, “anti-dimethyl”—PCR-amplification of the chromatin DNA fragments precipitated by antibody against H3 dimethyl-K9, “isotype”—a negative control for non-specific reactions. (B) Quantitative analysis of the data in (A) from three independent ChIP experiments. The results were normalized to the input signal, which was set to 1. (C) Methylation status of the CpG sites in the URR of the UL111A gene in undifferentiated and differentiated infected THP-1 cells infected with HCMV. The methylation status of individual CpG dinucleotides is indicated as: ○ and ●, which represent unmethylated and methylated cytosine, respectively. (D) Quantitative analysis of the total methylation data in (C) from three independent BSP experiments. **P < 0.01.

https://doi.org/10.1371/journal.pone.0117773.g005

Analysis of DNA methylation status in the URR of UL111A in PMA-treated and untreated THP-1 cells

To investigate whether DNA methylation occurs in the UL111A URR, methylation of the CpG dinucleotides in the UL111A URR (spanning from-4511 to-4001 bp relative to the UL111A gene) was analyzed using the bisulfite modification method. The DNA methylation status of the binding sites for AML-1, C/EBP β and GATA-1 was analyzed in HCMV genomic DNA extracted from undifferentiated and differentiated THP-1 cells at 4 dpi. Surprisingly, no significant difference was observed in the methylation status of each binding site between PMA treated and untreated cells (P > 0.05). However, there was a significant difference in the total methylation status of the region containing all three transcription factor binding sites (χ² = 5.18, P < 0.05) (Fig. 5C, 5D). These results suggest that hcmvIL-10 expression is not directly regulated by the DNA methylation of a specific transcription factor binding site, rather the total methylation status of the entire URR may be involved in such regulation.

AML-1 belongs to the CBF family of transcription factors, whose members are heterodimers consisting of a α-subunit (CBF α), which binds to the DNA consensus sequence TGT/CGGT, and a β-subunit (CBF β) that enhances the DNA-binding affinity through α-subunit rather than binding to DNA directly [18,19,43]. Interestingly, it has been reported that AML-1 cooperates synergistically with PU.1 and C/EBP proteins to regulate monocyte/macrophage differentiation in monocytic cells [44,45]. However, further investigation is needed to determine whether the three adjacent AML-1, GATA-1 and C/EBP β binding sites identified in the present study cooperate to regulate hcmvIL-10 expression.

AML1 suppression affects the UL111A gene expression

We investigated whether silencing of endogenously expressed AML-1 led to a decrease in the UL111A gene expression in HCMV-infected THP-1 cells. We designed a shRNA, LV-shRNA-AML-1, which targets the mRNA of human AML-1. The expressions of AML-1 protein and cmvIL-10 mRNA were detected in HCMV-infected THP-1 cells transfected with LV-shRNA-AML-1 or LV-shRNA-NC by western blot and RT-PCR, respectively. As revealed in Fig. 6A, almost 70% cells harbored GFP fluorescence 72 h after transfection, as detected by FACS. Expectedly, the transfection of LV-shRNA-AML-1 significantly decreased the endogenous AML-1 in these cells (Fig. 6B). Introduction of LV-shRNA-AML-1 also diminished about 70% amount of hcmvIL-10 mRNA compared with control shRNA (Fig. 6C). These results firmly convinced that AML-1 contributes to the enhanced expression of the UL111A gene by binding to the UUR.

Download:

Fig 6. AML-1 suppression affects the UL111A gene expression.

(A) FACS analysis of transfection efficiency. The infection efficiency was measured by FACS analysis in HCMV-infected THP-1 cells transfected with LV-shRNA-AML1 or LV-shRNA-NC at 72 h post-transfection. (B) Western blot was detected in HCMV-infected THP-1 cells transfected with LV-shRNA-AML1 or LV-shRNA-NC. **P<0.01 Verse LV-shRNA-NC. (C) HCMV-infected THP-1 cells stimulated with PMA were transfected with LV-shRNA-AML1 or LV-shRNA-NC for 72h. RT-PCR was taken to analyze the change of hcmvIL-10. *P<0.05. Verse LV-shRNA-NC.

https://doi.org/10.1371/journal.pone.0117773.g006

Conclusions

Our study presents the first evidence that the myeloid transcription factor, AML-1 may contribute to the epigenetic activation of the HCMV UL111A gene via histone modification in differentiated THP-1 cells. Based on our results and given the influence of hcmvIL-10 on macrophage polarization, we propose a working model for the contribution of AML-1-expressing myeloid cells to immune evasion in HCMV infection. We speculate that HCMV requires the differentiation of myeloid cells to sustain its replication, and utilizes myeloid transcription factors, such as AML-1, to activate the expression of the immune mediator homolog hcmvIL-10 to maintain immune evasion. Detailed future studies will aim at elucidating the precise mechanism underlying this process.

Acknowledgments

We thank Dr. Shiqiang Shang (Zhejiang University) for gifting the HCMV-Towne strain, and Dr. Haihua Gu (University of Colorado, USA) for critical reading and editing the text of the manuscript.

Author Contributions

Conceived and designed the experiments: YJ XZ. Performed the experiments: YG QZ YL. Analyzed the data: XZ YP MF. Contributed reagents/materials/analysis tools: XZ YJ. Wrote the paper: XZ YG.

References

1. Murphy E, Rigoutsos I, Shibuya T, Shenk TE (2003) Reevaluation of human cytomegalovirus coding potential. Proc Natl Acad Sci U S A 100: 13585–13590. pmid:14593199
- View Article
- PubMed/NCBI
- Google Scholar
2. Sinclair J (2008) Human cytomegalovirus: Latency and reactivation in the myeloid lineage. J Clin Virol 41: 180–185. pmid:18164651
- View Article
- PubMed/NCBI
- Google Scholar
3. Retiere C, Prod’homme V, Imbert-Marcille BM, Bonneville M, Vie H, et al. (2000) Generation of cytomegalovirus-specific human T-lymphocyte clones by using autologous B-lymphoblastoid cells with stable expression of pp65 or IE1 proteins: a tool to study the fine specificity of the antiviral response. J Virol 74: 3948–3952. pmid:10756006
- View Article
- PubMed/NCBI
- Google Scholar
4. Tabi Z, Moutaftsi M, Borysiewicz LK (2001) Human cytomegalovirus pp65- and immediate early 1 antigen-specific HLA class I-restricted cytotoxic T cell responses induced by cross-presentation of viral antigens. J Immunol 166: 5695–5703. pmid:11313411
- View Article
- PubMed/NCBI
- Google Scholar
5. de la Hoz RE, Stephens G, Sherlock C (2002) Diagnosis and treatment approaches of CMV infections in adult patients. J Clin Virol 25 Suppl 2: S1–12. pmid:12361752
- View Article
- PubMed/NCBI
- Google Scholar
6. Vancikova Z, Dvorak P (2001) Cytomegalovirus infection in immunocompetent and immunocompromised individuals—a review. Curr Drug Targets Immune Endocr Metabol Disord 1: 179–187. pmid:12476798
- View Article
- PubMed/NCBI
- Google Scholar
7. Rawlinson W, Scott G (2003) Cytomegalovirus. A common virus causing serious disease. Aust Fam Physician 32: 789–793. pmid:14596071
- View Article
- PubMed/NCBI
- Google Scholar
8. Pleskoff O, Casarosa P, Verneuil L, Ainoun F, Beisser P, et al. (2005) The human cytomegalovirus-encoded chemokine receptor US28 induces caspase-dependent apoptosis. FEBS J 272: 4163–4177. pmid:16098198
- View Article
- PubMed/NCBI
- Google Scholar
9. Boomker JM, The TH, de Leij LF, Harmsen MC (2006) The human cytomegalovirus-encoded receptor US28 increases the activity of the major immediate-early promoter/enhancer. Virus Res 118: 196–200. pmid:16448715
- View Article
- PubMed/NCBI
- Google Scholar
10. Mao ZQ, He R, Sun M, Qi Y, Huang YJ, et al. (2007) The relationship between polymorphisms of HCMV UL144 ORF and clinical manifestations in 73 strains with congenital and/or perinatal HCMV infection. Arch Virol 152: 115–124. pmid:16896551
- View Article
- PubMed/NCBI
- Google Scholar
11. Paradowska E, Studzinska M, Nowakowska D, Wilczynski J, Rycel M, et al. (2012) Distribution of UL144, US28 and UL55 genotypes in Polish newborns with congenital cytomegalovirus infections. Eur J Clin Microbiol Infect Dis 31: 1335–1345. pmid:22048843
- View Article
- PubMed/NCBI
- Google Scholar
12. Lockridge KM, Zhou SS, Kravitz RH, Johnson JL, Sawai ET, et al. (2000) Primate cytomegaloviruses encode and express an IL-10-like protein. Virology 268: 272–280. pmid:10704336
- View Article
- PubMed/NCBI
- Google Scholar
13. Jenkins C, Garcia W, Godwin MJ, Spencer JV, Stern JL, et al. (2008) Immunomodulatory properties of a viral homolog of human interleukin-10 expressed by human cytomegalovirus during the latent phase of infection. J Virol 82: 3736–3750. pmid:18216121
- View Article
- PubMed/NCBI
- Google Scholar
14. Chang WL, Baumgarth N, Yu D, Barry PA (2004) Human cytomegalovirus-encoded interleukin-10 homolog inhibits maturation of dendritic cells and alters their functionality. J Virol 78: 8720–8731. pmid:15280480
- View Article
- PubMed/NCBI
- Google Scholar
15. Cheung AK, Gottlieb DJ, Plachter B, Pepperl-Klindworth S, Avdic S, et al. (2009) The role of the human cytomegalovirus UL111A gene in down-regulating CD4+ T-cell recognition of latently infected cells: implications for virus elimination during latency. Blood 114: 4128–4137. pmid:19706889
- View Article
- PubMed/NCBI
- Google Scholar
16. Raftery MJ, Wieland D, Gronewald S, Kraus AA, Giese T, et al. (2004) Shaping phenotype, function, and survival of dendritic cells by cytomegalovirus-encoded IL-10. J Immunol 173: 3383–3391. pmid:15322202
- View Article
- PubMed/NCBI
- Google Scholar
17. Avdic S, Cao JZ, McSharry BP, Clancy LE, Brown R, et al. (2013) Human Cytomegalovirus Interleukin-10 Polarizes Monocytes toward a Deactivated M2c Phenotype To Repress Host Immune Responses. J Virol 87: 10273–10282. pmid:23864618
- View Article
- PubMed/NCBI
- Google Scholar
18. Okuda T, van Deursen J, Hiebert SW, Grosveld G, Downing JR (1996) AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell 84: 321–330. pmid:8565077
- View Article
- PubMed/NCBI
- Google Scholar
19. Ogawa E, Maruyama M, Kagoshima H, Inuzuka M, Lu J, et al. (1993) PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AML1 gene. Proc Natl Acad Sci U S A 90: 6859–6863. pmid:8341710
- View Article
- PubMed/NCBI
- Google Scholar
20. Kel AE, Gossling E, Reuter I, Cheremushkin E, Kel-Margoulis OV, et al. (2003) MATCH: A tool for searching transcription factor binding sites in DNA sequences. Nucleic Acids Res 31: 3576–3579. pmid:12824369
- View Article
- PubMed/NCBI
- Google Scholar
21. Wingender E, Chen X, Fricke E, Geffers R, Hehl R, et al. (2001) The TRANSFAC system on gene expression regulation. Nucleic Acids Res 29: 281–283. pmid:11125113
- View Article
- PubMed/NCBI
- Google Scholar
22. Goodrum FD, Jordan CT, High K, Shenk T (2002) Human cytomegalovirus gene expression during infection of primary hematopoietic progenitor cells: a model for latency. Proc Natl Acad Sci U S A 99: 16255–16260. pmid:12456880
- View Article
- PubMed/NCBI
- Google Scholar
23. Penkert RR, Kalejta RF (2013) Human embryonic stem cell lines model experimental human cytomegalovirus latency. MBio 4: e00298–00213. pmid:23716573
- View Article
- PubMed/NCBI
- Google Scholar
24. Miller G, Heston L, Grogan E, Gradoville L, Rigsby M, et al. (1997) Selective switch between latency and lytic replication of Kaposi’s sarcoma herpesvirus and Epstein-Barr virus in dually infected body cavity lymphoma cells. J Virol 71: 314–324. pmid:8985352
- View Article
- PubMed/NCBI
- Google Scholar
25. Sarid R, Flore O, Bohenzky RA, Chang Y, Moore PS (1998) Transcription mapping of the Kaposi’s sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based lymphoma cell line (BC-1). J Virol 72: 1005–1012. pmid:9444993
- View Article
- PubMed/NCBI
- Google Scholar
26. Yurochko AD, Huang ES (1999) Human cytomegalovirus binding to human monocytes induces immunoregulatory gene expression. J Immunol 162: 4806–4816. pmid:10202024
- View Article
- PubMed/NCBI
- Google Scholar
27. Smith MS, Bentz GL, Alexander JS, Yurochko AD (2004) Human cytomegalovirus induces monocyte differentiation and migration as a strategy for dissemination and persistence. J Virol 78: 4444–4453. pmid:15078925
- View Article
- PubMed/NCBI
- Google Scholar
28. Duan YL, Ye HQ, Zavala AG, Yang CQ, Miao LF, et al. (2014) Maintenance of large numbers of virus genomes in human cytomegalovirus-infected T98G glioblastoma cells. J Virol 88: 3861–3873. pmid:24453365
- View Article
- PubMed/NCBI
- Google Scholar
29. Sanchez V, Dong JJ, Battley J, Jackson KN, Dykes BC (2012) Human cytomegalovirus infection of THP-1 derived macrophages reveals strain-specific regulation of actin dynamics. Virology 433: 64–72. pmid:22874068
- View Article
- PubMed/NCBI
- Google Scholar
30. Meier JL (2001) Reactivation of the human cytomegalovirus major immediate-early regulatory region and viral replication in embryonal NTera2 cells: role of trichostatin A, retinoic acid, and deletion of the 21-base-pair repeats and modulator. J Virol 75: 1581–1593. pmid:11160656
- View Article
- PubMed/NCBI
- Google Scholar
31. Kotenko SV, Saccani S, Izotova LS, Mirochnitchenko OV, Pestka S (2000) Human cytomegalovirus harbors its own unique IL-10 homolog (cmvIL-10). Proc Natl Acad Sci U S A 97: 1695–1700. pmid:10677520
- View Article
- PubMed/NCBI
- Google Scholar
32. Jenkins C, Abendroth A, Slobedman B (2004) A novel viral transcript with homology to human interleukin-10 is expressed during latent human cytomegalovirus infection. J Virol 78: 1440–1447. pmid:14722299
- View Article
- PubMed/NCBI
- Google Scholar
33. Jenkins C, Garcia W, Abendroth A, Slobedman B (2008) Expression of a human cytomegalovirus latency-associated homolog of interleukin-10 during the productive phase of infection. Virology 370: 285–294. pmid:17942134
- View Article
- PubMed/NCBI
- Google Scholar
34. Soderberg-Naucler C, Streblow DN, Fish KN, Allan-Yorke J, Smith PP, et al. (2001) Reactivation of latent human cytomegalovirus in CD14(+) monocytes is differentiation dependent. J Virol 75: 7543–7554. pmid:11462026
- View Article
- PubMed/NCBI
- Google Scholar
35. Chang LK, Liu ST (2000) Activation of the BRLF1 promoter and lytic cycle of Epstein-Barr virus by histone acetylation. Nucleic Acids Res 28: 3918–3925. pmid:11024171
- View Article
- PubMed/NCBI
- Google Scholar
36. Alazard N, Gruffat H, Hiriart E, Sergeant A, Manet E (2003) Differential hyperacetylation of histones H3 and H4 upon promoter-specific recruitment of EBNA2 in Epstein-Barr virus chromatin. J Virol 77: 8166–8172. pmid:12829856
- View Article
- PubMed/NCBI
- Google Scholar
37. Kubat NJ, Tran RK, McAnany P, Bloom DC (2004) Specific histone tail modification and not DNA methylation is a determinant of herpes simplex virus type 1 latent gene expression. J Virol 78: 1139–1149. pmid:14722269
- View Article
- PubMed/NCBI
- Google Scholar
38. Reeves MB, Sinclair JH (2010) Analysis of latent viral gene expression in natural and experimental latency models of human cytomegalovirus and its correlation with histone modifications at a latent promoter. J Gen Virol 91: 599–604. pmid:19906945
- View Article
- PubMed/NCBI
- Google Scholar
39. Stewart MD, Li J, Wong J (2005) Relationship between histone H3 lysine 9 methylation, transcription repression, and heterochromatin protein 1 recruitment. Mol Cell Biol 25: 2525–2538. pmid:15767660
- View Article
- PubMed/NCBI
- Google Scholar
40. Bain M, Mendelson M, Sinclair J (2003) Ets-2 Repressor Factor (ERF) mediates repression of the human cytomegalovirus major immediate-early promoter in undifferentiated non-permissive cells. J Gen Virol 84: 41–49. pmid:12533699
- View Article
- PubMed/NCBI
- Google Scholar
41. Chao SH, Harada JN, Hyndman F, Gao X, Nelson CG, et al. (2004) PDX1, a cellular homeoprotein, binds to and regulates the activity of human cytomegalovirus immediate early promoter. J Biol Chem 279: 16111–16120. pmid:14764605
- View Article
- PubMed/NCBI
- Google Scholar
42. Ioudinkova E, Arcangeletti MC, Rynditch A, De Conto F, Motta F, et al. (2006) Control of human cytomegalovirus gene expression by differential histone modifications during lytic and latent infection of a monocytic cell line. Gene 384: 120–128. pmid:16989963
- View Article
- PubMed/NCBI
- Google Scholar
43. Kumano K, Kurokawa M (2010) The role of Runx1/AML1 and Evi-1 in the regulation of hematopoietic stem cells. J Cell Physiol 222: 282–285. pmid:19847803
- View Article
- PubMed/NCBI
- Google Scholar
44. Valledor AF, Borras FE, Cullell-Young M, Celada A (1998) Transcription factors that regulate monocyte/macrophage differentiation. J Leukoc Biol 63: 405–417. pmid:9544570
- View Article
- PubMed/NCBI
- Google Scholar
45. Friedman AD (2007) C/EBPalpha induces PU.1 and interacts with AP-1 and NF-kappaB to regulate myeloid development. Blood Cells Mol Dis 39: 340–343. pmid:17669672
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Murphy E, Rigoutsos I, Shibuya T, Shenk TE (2003) Reevaluation of human cytomegalovirus coding potential. Proc Natl Acad Sci U S A 100: 13585–13590. pmid:14593199
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Sinclair J (2008) Human cytomegalovirus: Latency and reactivation in the myeloid lineage. J Clin Virol 41: 180–185. pmid:18164651
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. Retiere C, Prod’homme V, Imbert-Marcille BM, Bonneville M, Vie H, et al. (2000) Generation of cytomegalovirus-specific human T-lymphocyte clones by using autologous B-lymphoblastoid cells with stable expression of pp65 or IE1 proteins: a tool to study the fine specificity of the antiviral response. J Virol 74: 3948–3952. pmid:10756006
View Article
PubMed/NCBI
Google Scholar

[10] View Article

[11] PubMed/NCBI

[12] Google Scholar

[ref4] 4. Tabi Z, Moutaftsi M, Borysiewicz LK (2001) Human cytomegalovirus pp65- and immediate early 1 antigen-specific HLA class I-restricted cytotoxic T cell responses induced by cross-presentation of viral antigens. J Immunol 166: 5695–5703. pmid:11313411
View Article
PubMed/NCBI
Google Scholar

[14] View Article

[15] PubMed/NCBI

[16] Google Scholar

[ref5] 5. de la Hoz RE, Stephens G, Sherlock C (2002) Diagnosis and treatment approaches of CMV infections in adult patients. J Clin Virol 25 Suppl 2: S1–12. pmid:12361752
View Article
PubMed/NCBI
Google Scholar

[18] View Article

[19] PubMed/NCBI

[20] Google Scholar

[ref6] 6. Vancikova Z, Dvorak P (2001) Cytomegalovirus infection in immunocompetent and immunocompromised individuals—a review. Curr Drug Targets Immune Endocr Metabol Disord 1: 179–187. pmid:12476798
View Article
PubMed/NCBI
Google Scholar

[22] View Article

[23] PubMed/NCBI

[24] Google Scholar

[ref7] 7. Rawlinson W, Scott G (2003) Cytomegalovirus. A common virus causing serious disease. Aust Fam Physician 32: 789–793. pmid:14596071
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref8] 8. Pleskoff O, Casarosa P, Verneuil L, Ainoun F, Beisser P, et al. (2005) The human cytomegalovirus-encoded chemokine receptor US28 induces caspase-dependent apoptosis. FEBS J 272: 4163–4177. pmid:16098198
View Article
PubMed/NCBI
Google Scholar

[30] View Article

[31] PubMed/NCBI

[32] Google Scholar

[ref9] 9. Boomker JM, The TH, de Leij LF, Harmsen MC (2006) The human cytomegalovirus-encoded receptor US28 increases the activity of the major immediate-early promoter/enhancer. Virus Res 118: 196–200. pmid:16448715
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref10] 10. Mao ZQ, He R, Sun M, Qi Y, Huang YJ, et al. (2007) The relationship between polymorphisms of HCMV UL144 ORF and clinical manifestations in 73 strains with congenital and/or perinatal HCMV infection. Arch Virol 152: 115–124. pmid:16896551
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref11] 11. Paradowska E, Studzinska M, Nowakowska D, Wilczynski J, Rycel M, et al. (2012) Distribution of UL144, US28 and UL55 genotypes in Polish newborns with congenital cytomegalovirus infections. Eur J Clin Microbiol Infect Dis 31: 1335–1345. pmid:22048843
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref12] 12. Lockridge KM, Zhou SS, Kravitz RH, Johnson JL, Sawai ET, et al. (2000) Primate cytomegaloviruses encode and express an IL-10-like protein. Virology 268: 272–280. pmid:10704336
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref13] 13. Jenkins C, Garcia W, Godwin MJ, Spencer JV, Stern JL, et al. (2008) Immunomodulatory properties of a viral homolog of human interleukin-10 expressed by human cytomegalovirus during the latent phase of infection. J Virol 82: 3736–3750. pmid:18216121
View Article
PubMed/NCBI
Google Scholar

[50] View Article

[51] PubMed/NCBI

[52] Google Scholar

[ref14] 14. Chang WL, Baumgarth N, Yu D, Barry PA (2004) Human cytomegalovirus-encoded interleukin-10 homolog inhibits maturation of dendritic cells and alters their functionality. J Virol 78: 8720–8731. pmid:15280480
View Article
PubMed/NCBI
Google Scholar

[54] View Article

[55] PubMed/NCBI

[56] Google Scholar

[ref15] 15. Cheung AK, Gottlieb DJ, Plachter B, Pepperl-Klindworth S, Avdic S, et al. (2009) The role of the human cytomegalovirus UL111A gene in down-regulating CD4+ T-cell recognition of latently infected cells: implications for virus elimination during latency. Blood 114: 4128–4137. pmid:19706889
View Article
PubMed/NCBI
Google Scholar

[58] View Article

[59] PubMed/NCBI

[60] Google Scholar

[ref16] 16. Raftery MJ, Wieland D, Gronewald S, Kraus AA, Giese T, et al. (2004) Shaping phenotype, function, and survival of dendritic cells by cytomegalovirus-encoded IL-10. J Immunol 173: 3383–3391. pmid:15322202
View Article
PubMed/NCBI
Google Scholar

[62] View Article

[63] PubMed/NCBI

[64] Google Scholar

[ref17] 17. Avdic S, Cao JZ, McSharry BP, Clancy LE, Brown R, et al. (2013) Human Cytomegalovirus Interleukin-10 Polarizes Monocytes toward a Deactivated M2c Phenotype To Repress Host Immune Responses. J Virol 87: 10273–10282. pmid:23864618
View Article
PubMed/NCBI
Google Scholar

[66] View Article

[67] PubMed/NCBI

[68] Google Scholar

[ref18] 18. Okuda T, van Deursen J, Hiebert SW, Grosveld G, Downing JR (1996) AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell 84: 321–330. pmid:8565077
View Article
PubMed/NCBI
Google Scholar

[70] View Article

[71] PubMed/NCBI

[72] Google Scholar

[ref19] 19. Ogawa E, Maruyama M, Kagoshima H, Inuzuka M, Lu J, et al. (1993) PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AML1 gene. Proc Natl Acad Sci U S A 90: 6859–6863. pmid:8341710
View Article
PubMed/NCBI
Google Scholar

[74] View Article

[75] PubMed/NCBI

[76] Google Scholar

[ref20] 20. Kel AE, Gossling E, Reuter I, Cheremushkin E, Kel-Margoulis OV, et al. (2003) MATCH: A tool for searching transcription factor binding sites in DNA sequences. Nucleic Acids Res 31: 3576–3579. pmid:12824369
View Article
PubMed/NCBI
Google Scholar

[78] View Article

[79] PubMed/NCBI

[80] Google Scholar

[ref21] 21. Wingender E, Chen X, Fricke E, Geffers R, Hehl R, et al. (2001) The TRANSFAC system on gene expression regulation. Nucleic Acids Res 29: 281–283. pmid:11125113
View Article
PubMed/NCBI
Google Scholar

[82] View Article

[83] PubMed/NCBI

[84] Google Scholar

[ref22] 22. Goodrum FD, Jordan CT, High K, Shenk T (2002) Human cytomegalovirus gene expression during infection of primary hematopoietic progenitor cells: a model for latency. Proc Natl Acad Sci U S A 99: 16255–16260. pmid:12456880
View Article
PubMed/NCBI
Google Scholar

[86] View Article

[87] PubMed/NCBI

[88] Google Scholar

[ref23] 23. Penkert RR, Kalejta RF (2013) Human embryonic stem cell lines model experimental human cytomegalovirus latency. MBio 4: e00298–00213. pmid:23716573
View Article
PubMed/NCBI
Google Scholar

[90] View Article

[91] PubMed/NCBI

[92] Google Scholar

[ref24] 24. Miller G, Heston L, Grogan E, Gradoville L, Rigsby M, et al. (1997) Selective switch between latency and lytic replication of Kaposi’s sarcoma herpesvirus and Epstein-Barr virus in dually infected body cavity lymphoma cells. J Virol 71: 314–324. pmid:8985352
View Article
PubMed/NCBI
Google Scholar

[94] View Article

[95] PubMed/NCBI

[96] Google Scholar

[ref25] 25. Sarid R, Flore O, Bohenzky RA, Chang Y, Moore PS (1998) Transcription mapping of the Kaposi’s sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based lymphoma cell line (BC-1). J Virol 72: 1005–1012. pmid:9444993
View Article
PubMed/NCBI
Google Scholar

[98] View Article

[99] PubMed/NCBI

[100] Google Scholar

[ref26] 26. Yurochko AD, Huang ES (1999) Human cytomegalovirus binding to human monocytes induces immunoregulatory gene expression. J Immunol 162: 4806–4816. pmid:10202024
View Article
PubMed/NCBI
Google Scholar

[102] View Article

[103] PubMed/NCBI

[104] Google Scholar

[ref27] 27. Smith MS, Bentz GL, Alexander JS, Yurochko AD (2004) Human cytomegalovirus induces monocyte differentiation and migration as a strategy for dissemination and persistence. J Virol 78: 4444–4453. pmid:15078925
View Article
PubMed/NCBI
Google Scholar

[106] View Article

[107] PubMed/NCBI

[108] Google Scholar

[ref28] 28. Duan YL, Ye HQ, Zavala AG, Yang CQ, Miao LF, et al. (2014) Maintenance of large numbers of virus genomes in human cytomegalovirus-infected T98G glioblastoma cells. J Virol 88: 3861–3873. pmid:24453365
View Article
PubMed/NCBI
Google Scholar

[110] View Article

[111] PubMed/NCBI

[112] Google Scholar

[ref29] 29. Sanchez V, Dong JJ, Battley J, Jackson KN, Dykes BC (2012) Human cytomegalovirus infection of THP-1 derived macrophages reveals strain-specific regulation of actin dynamics. Virology 433: 64–72. pmid:22874068
View Article
PubMed/NCBI
Google Scholar

[114] View Article

[115] PubMed/NCBI

[116] Google Scholar

[ref30] 30. Meier JL (2001) Reactivation of the human cytomegalovirus major immediate-early regulatory region and viral replication in embryonal NTera2 cells: role of trichostatin A, retinoic acid, and deletion of the 21-base-pair repeats and modulator. J Virol 75: 1581–1593. pmid:11160656
View Article
PubMed/NCBI
Google Scholar

[118] View Article

[119] PubMed/NCBI

[120] Google Scholar

[ref31] 31. Kotenko SV, Saccani S, Izotova LS, Mirochnitchenko OV, Pestka S (2000) Human cytomegalovirus harbors its own unique IL-10 homolog (cmvIL-10). Proc Natl Acad Sci U S A 97: 1695–1700. pmid:10677520
View Article
PubMed/NCBI
Google Scholar

[122] View Article

[123] PubMed/NCBI

[124] Google Scholar

[ref32] 32. Jenkins C, Abendroth A, Slobedman B (2004) A novel viral transcript with homology to human interleukin-10 is expressed during latent human cytomegalovirus infection. J Virol 78: 1440–1447. pmid:14722299
View Article
PubMed/NCBI
Google Scholar

[126] View Article

[127] PubMed/NCBI

[128] Google Scholar

[ref33] 33. Jenkins C, Garcia W, Abendroth A, Slobedman B (2008) Expression of a human cytomegalovirus latency-associated homolog of interleukin-10 during the productive phase of infection. Virology 370: 285–294. pmid:17942134
View Article
PubMed/NCBI
Google Scholar

[130] View Article

[131] PubMed/NCBI

[132] Google Scholar

[ref34] 34. Soderberg-Naucler C, Streblow DN, Fish KN, Allan-Yorke J, Smith PP, et al. (2001) Reactivation of latent human cytomegalovirus in CD14(+) monocytes is differentiation dependent. J Virol 75: 7543–7554. pmid:11462026
View Article
PubMed/NCBI
Google Scholar

[134] View Article

[135] PubMed/NCBI

[136] Google Scholar

[ref35] 35. Chang LK, Liu ST (2000) Activation of the BRLF1 promoter and lytic cycle of Epstein-Barr virus by histone acetylation. Nucleic Acids Res 28: 3918–3925. pmid:11024171
View Article
PubMed/NCBI
Google Scholar

[138] View Article

[139] PubMed/NCBI

[140] Google Scholar

[ref36] 36. Alazard N, Gruffat H, Hiriart E, Sergeant A, Manet E (2003) Differential hyperacetylation of histones H3 and H4 upon promoter-specific recruitment of EBNA2 in Epstein-Barr virus chromatin. J Virol 77: 8166–8172. pmid:12829856
View Article
PubMed/NCBI
Google Scholar

[142] View Article

[143] PubMed/NCBI

[144] Google Scholar

[ref37] 37. Kubat NJ, Tran RK, McAnany P, Bloom DC (2004) Specific histone tail modification and not DNA methylation is a determinant of herpes simplex virus type 1 latent gene expression. J Virol 78: 1139–1149. pmid:14722269
View Article
PubMed/NCBI
Google Scholar

[146] View Article

[147] PubMed/NCBI

[148] Google Scholar

[ref38] 38. Reeves MB, Sinclair JH (2010) Analysis of latent viral gene expression in natural and experimental latency models of human cytomegalovirus and its correlation with histone modifications at a latent promoter. J Gen Virol 91: 599–604. pmid:19906945
View Article
PubMed/NCBI
Google Scholar

[150] View Article

[151] PubMed/NCBI

[152] Google Scholar

[ref39] 39. Stewart MD, Li J, Wong J (2005) Relationship between histone H3 lysine 9 methylation, transcription repression, and heterochromatin protein 1 recruitment. Mol Cell Biol 25: 2525–2538. pmid:15767660
View Article
PubMed/NCBI
Google Scholar

[154] View Article

[155] PubMed/NCBI

[156] Google Scholar

[ref40] 40. Bain M, Mendelson M, Sinclair J (2003) Ets-2 Repressor Factor (ERF) mediates repression of the human cytomegalovirus major immediate-early promoter in undifferentiated non-permissive cells. J Gen Virol 84: 41–49. pmid:12533699
View Article
PubMed/NCBI
Google Scholar

[158] View Article

[159] PubMed/NCBI

[160] Google Scholar

[ref41] 41. Chao SH, Harada JN, Hyndman F, Gao X, Nelson CG, et al. (2004) PDX1, a cellular homeoprotein, binds to and regulates the activity of human cytomegalovirus immediate early promoter. J Biol Chem 279: 16111–16120. pmid:14764605
View Article
PubMed/NCBI
Google Scholar

[162] View Article

[163] PubMed/NCBI

[164] Google Scholar

[ref42] 42. Ioudinkova E, Arcangeletti MC, Rynditch A, De Conto F, Motta F, et al. (2006) Control of human cytomegalovirus gene expression by differential histone modifications during lytic and latent infection of a monocytic cell line. Gene 384: 120–128. pmid:16989963
View Article
PubMed/NCBI
Google Scholar

[166] View Article

[167] PubMed/NCBI

[168] Google Scholar

[ref43] 43. Kumano K, Kurokawa M (2010) The role of Runx1/AML1 and Evi-1 in the regulation of hematopoietic stem cells. J Cell Physiol 222: 282–285. pmid:19847803
View Article
PubMed/NCBI
Google Scholar

[170] View Article

[171] PubMed/NCBI

[172] Google Scholar

[ref44] 44. Valledor AF, Borras FE, Cullell-Young M, Celada A (1998) Transcription factors that regulate monocyte/macrophage differentiation. J Leukoc Biol 63: 405–417. pmid:9544570
View Article
PubMed/NCBI
Google Scholar

[174] View Article

[175] PubMed/NCBI

[176] Google Scholar

[ref45] 45. Friedman AD (2007) C/EBPalpha induces PU.1 and interacts with AP-1 and NF-kappaB to regulate myeloid development. Blood Cells Mol Dis 39: 340–343. pmid:17669672
View Article
PubMed/NCBI
Google Scholar

[178] View Article

[179] PubMed/NCBI

[180] Google Scholar

Figures

Abstract

Introduction

Materials and Methods

Cells and viruses

Virus infection

Viral DNA extraction and quantitative analysis by qPCR

RNA extraction and RT-PCR analysis

Identification of transcription factor binding sites

Chromatin immunoprecipitation (ChIP) assay and quantitative analysis of ChIP-PCR products

Western blot analysis

Bisulfite Sequencing PCR (BSP)

RNA interference analysis

Results and Discussion

HCMV genome maintenance and highly restricted transcription of viral genes in HCMV-infected THP-1 cells

HCMV transcription in infected THP-1 cells following the addition of PMA

Upregulation of hcmvIL-10 expression in differentiated THP-1 cells

Expression of transcription factors in HCMV-infected THP-1 cells

Identification of functional transcription factor binding sites in the UL111A gene promoter

Differential pattern of histone modification in the URR of UL111A in differentiated and undifferentiated THP-1 cells

Analysis of DNA methylation status in the URR of UL111A in PMA-treated and untreated THP-1 cells

AML1 suppression affects the UL111A gene expression

Conclusions

Acknowledgments

Author Contributions

References