Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Alternative Functions of Arabidopsis YELLOW STRIPE-LIKE3: From Metal Translocation to Pathogen Defense

  • Chyi-chuann Chen,

    Current address: Department of Agricultural Chemistry, National Taiwan University, Taipei, Taiwan.

    Affiliation Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan

  • Wei-Fu Chien,

    Affiliation Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan

  • Nai-Chun Lin,

    Affiliation Department of Agricultural Chemistry, National Taiwan University, Taipei, Taiwan

  • Kuo-Chen Yeh

    kcyeh@gate.sinica.edu.tw

    Affiliation Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan

Alternative Functions of Arabidopsis YELLOW STRIPE-LIKE3: From Metal Translocation to Pathogen Defense

  • Chyi-chuann Chen, 
  • Wei-Fu Chien, 
  • Nai-Chun Lin, 
  • Kuo-Chen Yeh
PLOS
x

Abstract

YELLOW STRIPE-LIKE1 (YSL1) and YSL3 are involved in iron (Fe) and copper (Cu) translocation. Previously, we reported that upregulation of YSL1 and YSL3 under excess Cu caused high accumulation of Cu in the siz1 mutant, impaired in small ubiquitin-like modifier (SUMO) E3 ligase. Interestingly, the siz1 mutant contains high levels of salicylic acid (SA), involved in plant defense against biotrophic pathogens. In this study, we found that YSL1 and YSL3 were upregulated by SA. SA-regulated YSL3 but not YSL1 depended on NONEXPRESSOR OF PR1 (NPR1). Susceptibility to the pathogen Pseudomonas syringe pv. tomato (Pst) DC3000 was greater for ysl3 than the wild type. Also, during Pst DC3000 infection, YSL3 was positively regulated by SA signaling through NPR1 and the upregulation was enhanced in the coi1 mutant that defective in the jasmonic acid (JA) receptor, CORONATINE INSENSITIVE1. This line of evidence indicates that the regulation of YSL3 is downstream of SA signaling and interplays with JA signaling for involvement in pathogen-induced defense. We provide new insights into the biological function of the metal transporter YSL3 in plant pathogen defense.

Introduction

Plant species have 2 classes of mechanisms for acquiring iron (Fe): Strategy I is used by nongraminaceous plants to reduce ferric chelates at the root surface and absorb the generated ferrous ions across the root plasma membrane by iron transporters; strategy II is a chelation strategy used by graminaceous plants for primary acquisition of Fe [1]. Strategy II plants secrete phytosiderophores (PSs), compounds of the mugineic acid family, which are hexadentate metal chelators with high affinity for ferric Fe [2]. PSs are derivatives of the non-proteinogenic amino acid nicotianamine (NA), which also functions as a transition metal chelator in plants [3], [4]. In grasses, ferric Fe–PS complexes in the rhizosphere are taken up into root cells through the action of YELLOW STRIPE1 (YS1) transporter [5][9].

The YELLOW STRIPE-LIKE (YSL) family in Arabidopsis was identified by sequence similarity to maize YS1 (ZmYS1), which takes up ferric Fe–PS complexes and belongs to the oligopeptide transporter family [7], [10], [11]. Multiple YSL genes are found in diverse plant species, including monocots, dicots, gymnosperms, ferns and mosses [5], [7], [10], [12][18]. The Arabidopsis YSL family has 8 members [7]. They play important roles in plant Fe homeostasis. Some YSL genes may have a role in metal remobilization from senescent leaves, in the development of reproductive organs and as transporters in seed formation, and in long-distance transport of metals complexed with NA [13], [19], [20].

Arabidopsis YSL1, YSL2 and YSL3 are located in the plasma membrane and expressed in the vascular bundle parenchyma. Their functions likely mediate the remobilization of Fe, Zn, and Cu in the form of metal–NA chelates from senescent leaves and the loading of these metals into inflorescences and seeds [16], [21][24]. Recently, YSL4 and YSL6, reported as potential H+/metal–NA co-transporters, were found localized in vacuole membranes and internal membranes resembling endoplasmic reticulum [25], [26]. YSL6 was also detected in the chloroplast envelope. Fe is trapped in the chloroplasts of ysl4ysl6 double mutants, which suggests a fundamental role for YSL4 and YSL6 in managing chloroplastic Fe content [27].

The expression of YSL2 is induced in the presence of Fe and Cu and repressed strongly by Zn deficiency and mildly by Cu excess [16], [22]. Under Cu deficiency, among the Arabidopsis YSL genes, YSL2 expression is upregulated by SQUAMOSA PROMOTER BINDING PROTEIN-LIKE7 (SPL7), and induction of YSL3 expression partially depends on SPL7 function [28], [29]. Moreover, the transcriptional regulation of YSL1 and YSL3 is repressed by Fe deficiency and induced by Fe excess [16], [21][23]. Our previous work revealed that both YSL1 and YSL3 were downregulated by SIZ1-dependent SUMOylation that induced by excess Cu in Arabidopsis (Chen et al., 2011). The expression of YSL1 and YSL3 were dramatically higher in the siz1 mutant than in wild type.

Interestingly, the siz1 mutant showed high levels of salicylic acid (SA) and SA glucoside [30]. Elevated SA level in siz1 induced the expression of pathogenesis-related (PR) genes and increased the resistance against the bacterial pathogen Pseudomonas syringae pv. tomato (Pst) DC3000 [31]. We hypothesized that the YSL1 and YSL3 could be regulated by SA and probably involved in the pathogen defense. In this study, we found that the expression of YSL3 was induced by SA in an NONEXPRESSOR OF PR1 (NPR1)-dependent pathway and a biological role of YSL3 in the innate immunity of plants was illuminated.

Materials and Methods

Plant Materials and Growth Conditions

The Arabidopsis thaliana wild type (Col-0 and Col-6), ysl1 (ysl1-2; SALK_034534), ysl3 (ysl3-1; SALK_064683C), (ysl3-2; SALK_045218), ysl1ysl3 (ysl1-2ysl3-1), npr1 (npr1-1) and coi1 (coi1-16) were described previously [32][34]. Seeds were surface-sterilized and grown on half-strength MS medium (1/2×MS salt, pH 5.7, 1% sucrose and 0.35% phytagel). Soil-grown plants were grown in pots containing a mixture of organic substrate, vermiculite and mica sheets (9∶1∶1 v/v). All plants were grown under 16-h light (70 µmol m−2s−1)/8-h dark, 22°C. For SA treatment, 12-day-old plants were transferred to 1/2 MS medium containing SA.

RNA Isolation and Quantitative Real-time RT-PCR (qPCR)

Extraction of total RNA and qPCR were performed as described (Chen et al., 2011). Frozen shoot and root tissues (approximately 100 mg) were ground in liquid nitrogen with use of a tissue homogenizer (SH-48, J&H Technology Co.), to which 1 mL of TRIzol reagent was immediately added for RNA isolation. The concentration of the RNA was determined spectrophotometrically at 260 nm (Nanodrop, Isogen Life Science). Subsequently, 2 µg RNA was treated with RQ1 RNase-free DNase (Promega), and the reaction buffer was replaced with 5× first-strand RT buffer (Invitrogen). The cDNA was synthesized by use of SuperScript III reverse transcriptase (Invitrogen). qPCR analyses involved use of the KAPA SYBR FAST qPCR kit (Kapa Biosystems). The expression of ACTIN2 (ACT2) was an internal control. The primers of qPCR are for YSL1 5′-TCCCAATGTGGTTCGCAGTTT-3′ (forward) and 5′-TTGAGACCGCAGCGAATGTA-3′ (reverse); YSL3 5′-GTGGCGGCAAATCTCGTTA-3′ (forward) and 5′-CCATCGGTAATGGAACCCAAT-3′ (reverse); SID2 5′-ATGCGGGACCTATTGGATTTT-3′ (forward) and 5′-TCTGATCCCGACTGCAAATTC-3′ (reverse); PDF1.2 5′-TTTGCTTCCATCATCACCCTTA-3′ (forward) and 5′-GCGTCGAAAGCAGCAAAGA-3′ (reverse); PR1 5′-GTCTCCGCCGTGAACATGT-3′ (forward) and 5′-CGTGTTCGCAGCGTAGTTGT-3′ (reverse); ACT2 5′-AGGTCCAGGAATCGTTCACAGA-3′ (forward) and 5′-CCCCAGCTTTTTAAGCCTTTGA-3′ (reverse). Testing of the efficiency of primers was based on the manufacturer's instructions (Applied Biosystems).

Pathogenicity Assay of Pseudomonas syringae

Before infection, Pseudomonas syringae pv. tomato (Pst) DC3000 was grown in King's B (KB) medium [35] supplemented with 50 µg/mL rifampicin at 28°C. After overnight cultivation, a bacterial suspension was prepared in 10 mM MgCl2 with 0.02% Silwet L-77 to OD600 0.05. Four-week-old Arabidopsis seedlings were inoculated by spraying the leaves with Pst DC3000 suspension until runoff was imminent and leaf surfaces appeared evenly wet [36]. Disease development was monitored every day and the bacterial population in planta was determined 3 days after inoculation as described [37]. In brief, 3 leaf discs were collected from plants in each pot by use of a 0.6 cm-diameter cork borer and homogenized in 10 mM MgCl2 by use of a plastic pestle. Serial dilutions of each sample were plated on selective KB medium agar supplemented with rifampicin and incubated at 28°C for 2 days, then the number of rifampicin-resistant colonies were counted for calculating colony-forming units per centimeter squared of infected leaf tissue. For analysis of gene expression, leaf samples with pathogen infection were harvested at different days post-inoculation (0, 1, 2, 3 dpi) and immediately frozen in liquid N2 and stored at −80°C.

Statistical Analysis

Two-sample t test was used to examine statistical difference between the control and treatments. P<0.05 was considered statistically significant.

Accession Numbers

Sequence data from this article can be found in the Arabidopsis Genome Initiative or GenBank/EMBL databases under the following accession numbers: YSL1 (At4g24120), YSL3 (At5g53550), SID2 (At1g14710), PDF1.2 (At5g44420), PR1 (At1g24610) and ACT2 (At3g18780).

Results and Discussion

YSL3 is positively regulated by SA signaling through NPR1

We used wild-type plants treated with SA to investigate whether the expression of YSL1 and YSL3 is regulated by SA. YSL3 was induced by both low and high concentrations of SA in the shoot but only slightly induced by a low concentration in the root (Figure 1). The SA-induced YSL3 expression was previously observed in whole seedlings [38]. YSL1 was only slightly induced by a high concentration (200 µM) of SA in the shoot but not in the root. To further address whether SA-induced YSL1 and YSL3 expression depends on NPR1, we detected the expression of YSL1 and YSL3 in the wild type and the npr1 mutant with 200-µM SA treatment. SA-induced YSL3 expression was diminished in the npr1 mutant, so the induction depended on NPR1 (Figure 2). However, SA only slightly induced YSL1 expression, with no NPR1 dependence (Figure 2). The expression could be induced at 1 h after SA treatment (Figure S1 in File S1). Of note, the induction of YSL3 expression showed two phases during SA treatment: slightly induced at early times (1 to 8 h) and substantially induced at late times (12 to 24 h).

thumbnail
Figure 1. Dose effect of salicylic acid (SA) on the expression of YSL1 and YSL3 in shoots and roots of Arabidopsis thaliana ecotype Col-0.

Twelve-day-old plants were treated with SA (0, 25, 50, 100 and 200 µM) for 24 h. Quantitative real-time RT-PCR (qPCR) analysis of expression of YSL1 and YSL3 in shoots and roots relative to that of ACT2. Data are mean±SD from 9 samples from 3 biological replicates. Different letters indicate significant difference at p<0.05.

https://doi.org/10.1371/journal.pone.0098008.g001

thumbnail
Figure 2. Effect of exogenous SA on the expression of YSL1 and YSL3 in A. thaliana Col-0 and the npr1 mutant.

Twelve-day-old plants of A. thaliana Col-0 wild type (WT) and npr1 mutant were treated with 200 µM SA for 24 h. qPCR analysis of expression of YSL1 and YSL3 in shoots relative to that of ACT2. Data are mean±SD 9 samples from 3 biological replicates. Different letters indicate significant difference at p<0.05.

https://doi.org/10.1371/journal.pone.0098008.g002

The ysl3 mutant shows enhanced susceptibility against Pseudomonas syringae pv. tomato (Pst) DC3000

SA synthesis and accumulation are required for local and systemic-acquired resistance to pathogen infection. In SA signaling, NPR1 plays a key role in pathogen defense, because the npr1 mutant is very sensitive to Pst DC3000 infection [39]. SA upregulated YSL3 expression through NPR1 (Figure 1, Figure 2) in Arabidopsis; thus, we hypothesized that YSL3 could be involved in pathogen resistance. Arabidopsis plants of the wild type, ysl1, ysl3, ysl1ysl3 and npr1 mutants were challenged with Pst DC3000. Arabidopsis defective in YSL3 was sensitive to Pst DC3000. The disease symptoms of ysl3 and ysl1ysl3 were similar to that of the npr1 mutant (Figure 3A). The bacterial number in leaves was higher for ysl3 and ysl1ysl3 than the wild type and ysl1 (Figure 3B). Overall, the bacterial number in plants agreed with the disease symptoms observed. No further change in susceptibility in the defect of YSL1 in ysl1 and ysl1ysl3 mutants suggested that YSL1 plays no or little role in the plant pathogen defense. The enhanced susceptibility against pathogens in the ysl3 mutant was further confirmed in the mutant with a second mutated allele (Figures S2, S3 in File S1).

thumbnail
Figure 3. Mutation in YSL3 results in enhanced susceptibility to P. syringae pv. tomato (Pst) DC3000 infection.

A, Disease symptoms on leaves of each Arabidopsis line after inoculation with Pst DC3000. Four-week-old Arabidopsis thaliana Col-0 wild type (WT), ysl1, ysl3, ysl1ysl3 and npr1 grown in the soil were spray-inoculated with 107 colony-forming units (cfu)/mL Pst DC3000 in 10 mM MgCl2 with 0.02% Silwet L-77 (hereafter Pst DC3000 solution). Photographs were taken 3 days post inoculation (dpi). B, Bacterial population in leaves of each Arabidopsis line 0, 1, and 3 days after inoculation. Data are mean±SD from 6 replicates. Different letters indicate significant difference at p<0.05.

https://doi.org/10.1371/journal.pone.0098008.g003

To investigate the induction pattern of YSL3 in soil-grown plants, we examined the expression of YSL3 after pathogen infection. YSL3 was induced immediately after Pst DC3000 infection, a pattern similar to that for the SA biosynthesis gene SALICYLIC ACID INDUCTION DEFICIENT2 (SID2) and SA downstream gene PATHOGENESIS-RELATED1 (PR1) (Figure 4). YSL3 expression was significantly induced after 12-h Pst DC3000 inoculation (Figure S4 in File S1). This Pst DC3000-induced YSL3 expression was diminished in sid2 and npr1, similar to the expression of PR1 (Figure S5 in File S1), which supports a role downstream of SA. Therefore, induction of YSL3 plays a role in the basal defense against Pst DC3000 infection in Arabidopsis.

thumbnail
Figure 4. Expression of YSL1, YSL3, PR1 and SID2 in Arabidopsis leaves infected with Pst DC3000.

Four-week-old plants of Arabidopsis wild type (Col-0) were spray-inoculated with Pst DC3000 solution. Plants sprayed with 10 mM MgCl2 with 0.02% Silwet L-77 were used as a mock treatment control. Mature leaves (3rd) were collected 0, 1, 2 and 3 days post-inoculation (dpi). qPCR analysis of expression of YSL1, YSL3, PR1, SID2 and PLANT DEFENSIN1.2 (PDF1.2) relative to that of ACT2. Data are mean±SD from 6 samples of 2 biological repeats. *P<0.05 compared with mock inoculation.

https://doi.org/10.1371/journal.pone.0098008.g004

YSL3 is negatively regulated by jasmonic acid (JA) signaling via CORONATINE INSENSITIVE1 (COI1) during Pst DC3000 infection

Crosstalk between SA and JA allows the plant to activate specific defense responses against a particular invading pathogen [40]. The defense response signaling through SA and JA is often antagonistic. Pathogen-induced accumulation of SA is associated with suppressed JA signaling [41]. Previous studies showed that coronatine (COR), a phytotoxic production by some phytopathogenic Pseudomonads, promotes P. syringae virulence in Arabidopsis by activating a signaling cascade to suppress SA accumulation and signaling [42]. Pst DC3000 exploits the inhibition of SA signaling by JA signaling via activating COI1 by phytotoxic coronatine [43][45]. The coi1 mutant defective in the JA receptor with enhanced resistance to Pst DC3000 is via activation of SA-dependent defense pathway [43], [46]. If YSL1 and YSL3 are downstream of SA signaling pathway as shown in Figure 1, we expected that both genes would be higher expression in the coi1 mutant than wild type after Pst Dc3000 infection.

We examined gene expression in coi1 mutant plants spray-inoculated with Pst DC3000. In addition to elevated expression of the SA biosynthesis gene SID2 and SA-regulated PR1, the expression of YSL1 and YSL3 was elevated in infected coi1 mutant plants (Figure 5), which supports that YSL1 and YSL3 are downstream of SA signaling. By contrast, the expression of PLANT DEFENSIN1.2 (PDF1.2), downstream of JA signaling, was reduced in coi1 as compared with the wild type (Figure 5). These data suggest that the antagonism between SA and JA signaling applies to the control of YSL1 and YSL3.

thumbnail
Figure 5. Effect of CORONATINE INSENSITIVE1 mutation (coi1) on the expression of YSL1, YSL3, SID2, PR1 and PDF1.2 in Arabidopsis leaves inoculated with Pst DC3000.

Four-week-old A. thaliana ecotype Col-6 wild type (WT) and coi1-16 mutant were spray-inoculated with Pst DC3000 solution. Plants sprayed with 10 mM MgCl2 with 0.02% Silwet L-77 were used as a mock treatment control. Mature leaves (3th) were harvested at 3 dpi. qPCR analysis of expression of YSL1, YSL3, PR1, SID2 and PDF1.2 relative to that of ACT2. Data are mean±SD from 6 samples of 2 biological repeats. *P<0.05 compared with wild type.

https://doi.org/10.1371/journal.pone.0098008.g005

In conclusion, we identified that SA-induced YSL3 expression depends on NPR1; YSL1 is slightly induced by high-concentration SA and NPR1-independent. Our results clearly demonstrate the importance of YSL3 in plant pathogen defense regulated by cross-talk between SA- and JA-dependent signaling pathways during infection with Pst DC3000. The knockout mutant ysl3 was more susceptible than the wild type to Pst DC3000 infection. YSL3 is a positive regulator of basal resistance and appears to function downstream of SA and to be negatively regulated by JA signaling through COI1. SIZ1 is a negative regulator for both the plant defense response [31] and the expression of YSL3 [33], which may be through the regulation of SA accumulation. Apparently, YSL3 plays a role in the SIZ1-regulated plant defense response.

This regulation information extends our knowledge of the biological function of YSL3 from metal ion translocation to plant immunity. NPR1 was recently reported to be a receptor of SA, and Cu a potential cofactor for its activation [47]. Whether the metal transporter role of YSL3 contributes to the delivery of Cu for NPR1 activity or YSL3-mediated metal ion homeostasis plays a role in SA signaling through ROS in plant pathogen defense remains for further study.

Supporting Information

File S1.

Contains: Figure S1. Time-course expression of selected SA-induced genes (SAIG). RT-PCR analysis of selected SAIG gene expression in wild-type plants. Total RNA from 2-week-old seedlings treated with 0.5 mM SA (SA) or maintained in MS medium (C) for the times (hours) indicated were isolated for RT-PCR. LLP (At5g03350) and PR1 (At2g14610) were used as controls for NPR1-dependent early and late response genes, respectively. ACT3 (At3g53750) was a control. The following primers were used for RT-PCR: YSL3-FP: 5′-ATGAGGAGTATGATGATGGAGAGAGAG -3′ YSL3-RP: 5′-TTAACTCGAATATTTACTCGGCATGAAGC -3′; LLP-FP: 5′-TTGGGAAAATGAAACACTGGTC-3′ LLP-RP: 5′-CATTCCGGTTACAACTTTCTGATAC-3′; PR1-FP, 5′-TTCTTCCCTCGAAAGCTCAA-3′; PR1-RP, 5′-TTGCAACTGATTATGGTTCCAC-3′); ACT3-FP: 5′-GCTATGTATGTCGCCATTCAAGC-3′ ACT3-RP: 5′-CATCATATTCTGCCTTTGCGATCC-3′ Cycles for amplification of each gene are indicated. Figure S2. Two T-DNA SALK lines, SALK_064683 (ysl3-1) and SALK_045218 (ysl3-2), of YSL3. A, Relative positions of T-DNA insertions in YSL3. White boxes and lines represent exons and introns, respectively. Insertion sites of T-DNA and orientation are illustrated by triangles with arrowheads. Primers used for RT-PCR are indicated. B, Genotyping of ysl3-1 and ysl3-2 mutants. Primers used for genotyping are ysl3-1 LP: CCCTCGATATTTTGCTTAGGG; ysl3-1 RP: CTTCACCTAGGTCGATGCTTG; ysl3-2 LP: GCCTTTAGGAGTGTGGAAACC ysl3-2 RP: TTTTTCCTCTCGTCATTTTCC and LBb1.3: ATTTTGCCGATTTCGGAAC. PCR reactions in 1 involved primers LP and RP and in 2 LBb1.3 and RP. C, RT-PCR to detect the expression of YSL3. The following primers were used for RT-PCR: YSL3 FP: ATGAGGAGTATGATGATGGAGAGAGAG; YSL3 RP: TTAACTCGAATATTTACTCGGCATGAAGC; ACT8 FP: CCACATGCTATCCTCCGTCT and ACT8 RP: CTGGAAAGTGCTGAGGGAAG. ACT8 (At1g49240) expression was a control. Figure S3. Two T-DNA insertion lines of ysl3 mutants with enhanced susceptibility to P. syringae pv. tomato DC3000 infection. A, Disease symptoms on leaves of each Arabidopsis line after inoculation with Pseudomonas syringae pv. tomato (Pst) DC3000. Four-week-old Arabidopsis thaliana Col-0 wild type (WT), ysl3-1, ysl3-2 and npr1 grown in the soil were spray-inoculated with 107 cfu/mL Pseudomonas syringae pv. tomato (Pst) DC3000 in 10 mM MgCl2 with 0.02% Silwet L-77. Photographs were taken 3 days post-inoculation (dpi). Bar scale is 1 cm. B, Bacterial population in leaves of each Arabidopsis line after inoculation of Pst DC3000. 0 and 3 dpi, leaf samples were collected and bacterial number was determined. Data are mean±SD from 4 replicates. Different letters indicate significant difference at p<0.05. Figure S4. Time course of YSL3 gene expression in Arabidopsis. YSL3 expression in Pst DC3000-infected and mock-inoculated (Mock) Arabidopsis (Col-0) plants at 0, 1, 3, 6, 12, 24, 48 and 72 h post-inoculation (hpi) monitored by qPCR. Total RNA from 3-week-old seedlings grown at 22°C on soil were used as templates. qPCR analysis of YSL3 expression relative to that of ACT2. Data are mean±SD from 6 samples of 2 biological repeats. Figure S5. RT-PCR analysis of YSL3 expression in the wild type, sid2 and npr1. RT-PCR analysis of YSL3 and PR1 expression in Pst DC3000-infected and mock-inoculated (Mock) Arabidopsis Col-0 wild-type (WT), sid2-1 and npr1 plants over 2 days post-inoculation (dpi). Total RNA from 3-week-old seedlings grown at 22°C on soil was used as templates. ACT3 was a control. Cycles for amplification of each gene are indicated.

https://doi.org/10.1371/journal.pone.0098008.s001

(PDF)

Acknowledgments

We thank Laura Smales for manuscript English editing.

Author Contributions

Conceived and designed the experiments: CCC KCY. Performed the experiments: CCC WFC NCL. Analyzed the data: CCC NCL KCY. Contributed reagents/materials/analysis tools: NCL KCY. Wrote the paper: CCC KCY.

References

  1. 1. Kobayashi T, Nishizawa NK (2012) Iron uptake, translocation, and regulation in higher plants. Annu Rev Plant Biol 63: 131–152.
  2. 2. Takagi S, Nomoto K, Takemoto T (1984) Physiological Aspect of Mugineic Acid, a Possible Phytosiderophore of Graminaceous Plants. Journal of Plant Nutrition 7: 469–477.
  3. 3. Walter A, Pich A, Scholz G, Marschner H, Romheld V (1995) Effects of Iron Nutritional-Status and Time of Day on Concentrations of Phytosiderophores and Nicotianamine in Different Root and Shoot Zones of Barley. Journal of Plant Nutrition 18: 1577–1593.
  4. 4. Higuchi K, Suzuki K, Nakanishi H, Yamaguchi H, Nishizawa NK, et al. (1999) Cloning of nicotianamine synthase genes, novel genes involved in the biosynthesis of phytosiderophores. Plant Physiology 119: 471–479.
  5. 5. Murata Y, Ma JF, Yamaji N, Ueno D, Nomoto K, et al. (2006) A specific transporter for iron(III)-phytosiderophore in barley roots. Plant Journal 46: 563–572.
  6. 6. Schaaf G, Ludewig U, Erenoglu BE, Mori S, Kitahara T, et al. (2004) ZmYS1 functions as a proton-coupled symporter for phytosiderophore- and nicotianamine-chelated metals. Journal of Biological Chemistry 279: 9091–9096.
  7. 7. Curie C, Panaviene Z, Loulergue C, Dellaporta SL, Briat JF, et al. (2001) Maize yellow stripe1 encodes a membrane protein directly involved in Fe(III) uptake. Nature 409: 346–349.
  8. 8. Romheld V, Marschner H (1986) Evidence for a Specific Uptake System for Iron Phytosiderophores in Roots of Grasses. Plant Physiology 80: 175–180.
  9. 9. von Wiren N, Mori S, Marschner H, Romheld V (1994) Iron Inefficiency in Maize Mutant Ys1 (Zea-Mays L Cv Yellow-Stripe) Is Caused by a Defect in Uptake of Iron Phytosiderophores. Plant Physiology 106: 71–77.
  10. 10. Roberts LA, Pierson AJ, Panaviene Z, Walker EL (2004) Yellow stripe1. Expanded roles for the maize iron-phytosiderophore transporter. Plant Physiol 135: 112–120.
  11. 11. Yen MR, Tseng YH, Saier MH Jr (2001) Maize Yellow Stripe1, an iron-phytosiderophore uptake transporter, is a member of the oligopeptide transporter (OPT) family. Microbiology 147: 28812883.
  12. 12. Victoria Fde C, Bervald CM, da Maia LC, de Sousa RO, Panaud O, et al. (2012) Phylogenetic relationships and selective pressure on gene families related to iron homeostasis in land plants. Genome 55: 883–900.
  13. 13. Conte SS, Walker EL (2012) Genetic and biochemical approaches for studying the yellow stripe-like transporter family in plants. Curr Top Membr 69: 295–322.
  14. 14. Harada E, Sugase K, Namba K, Iwashita T, Murata Y (2007) Structural element responsible for the Fe(III)-phytosiderophore specific transport by HvYS1 transporter in barley. FEBS Lett 581: 4298–4302.
  15. 15. Gendre D, Czernic P, Conejero G, Pianelli K, Briat JF, et al. (2007) TcYSL3, a member of the YSL gene family from the hyper-accumulator Thlaspi caerulescens, encodes a nicotianamine-Ni/Fe transporter. Plant Journal 49: 1–15.
  16. 16. DiDonato RJ Jr, Roberts LA, Sanderson T, Eisley RB, Walker EL (2004) Arabidopsis Yellow Stripe-Like2 (YSL2): a metal-regulated gene encoding a plasma membrane transporter of nicotianamine-metal complexes. Plant Journal 39: 403–414.
  17. 17. Koike S, Inoue H, Mizuno D, Takahashi M, Nakanishi H, et al. (2004) OsYSL2 is a rice metal-nicotianamine transporter that is regulated by iron and expressed in the phloem. Plant Journal 39: 415–424.
  18. 18. Victoria FC, Bervald CM, da Maia LC, de Sousa RO, Panaud O, et al. (2012) Phylogenetic relationships and selective pressure on gene families related to iron homeostasis in land plants. Genome 55: 883–900.
  19. 19. Colangelo EP, Guerinot ML (2006) Put the metal to the petal: metal uptake and transport throughout plants. Current Opinion in Plant Biology 9: 322–330.
  20. 20. Curie C, Cassin G, Couch D, Divol F, Higuchi K, et al. (2009) Metal movement within the plant: contribution of nicotianamine and yellow stripe 1-like transporters. Annals of Botany 103: 1–11.
  21. 21. Le Jean M, Schikora A, Mari S, Briat JF, Curie C (2005) A loss-of-function mutation in AtYSL1 reveals its role in iron and nicotianamine seed loading. Plant Journal 44: 769–782.
  22. 22. Schaaf G, Schikora A, Haberle J, Vert G, Ludewig U, et al. (2005) A putative function for the arabidopsis Fe-Phytosiderophore transporter homolog AtYSL2 in Fe and Zn homeostasis. Plant and Cell Physiology 46: 762–774.
  23. 23. Waters BM, Chu HH, DiDonato RJ, Roberts LA, Eisley RB, et al. (2006) Mutations in Arabidopsis Yellow Stripe-Like1 and Yellow Stripe-Like3 reveal their roles in metal ion homeostasis and loading of metal ions in seeds. Plant Physiology 141: 1446–1458.
  24. 24. Chu HH, Chiecko J, Punshon T, Lanzirotti A, Lahner B, et al. (2010) Successful Reproduction Requires the Function of Arabidopsis YELLOW STRIPE-LIKE1 and YELLOW STRIPE-LIKE3 Metal-Nicotianamine Transporters in Both Vegetative and Reproductive Structures. Plant Physiology 154: 197–210.
  25. 25. Jaquinod M, Villiers F, Kieffer-Jaquinod S, Hugouvieux V, Bruley C, et al. (2007) A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. Mol Cell Proteomics 6: 394–412.
  26. 26. Conte SS, Chu HH, Rodriguez DC, Punshon T, Vasques KA, et al. (2013) Arabidopsis thaliana Yellow Stripe1-Like4 and Yellow Stripe1-Like6 localize to internal cellular membranes and are involved in metal ion homeostasis. Front Plant Sci 4: 283.
  27. 27. Divol F, Couch D, Conejero G, Roschzttardtz H, Mari S, et al. (2013) The Arabidopsis YELLOW STRIPE LIKE4 and 6 Transporters Control Iron Release from the Chloroplast. Plant Cell 25: 1040–1055.
  28. 28. Bernal M, Casero D, Singh V, Wilson GT, Grande A, et al. (2012) Transcriptome sequencing identifies SPL7-regulated copper acquisition genes FRO4/FRO5 and the copper dependence of iron homeostasis in Arabidopsis. Plant Cell 24: 738–761.
  29. 29. Yamasaki H, Hayashi M, Fukazawa M, Kobayashi Y, Shikanai T (2009) SQUAMOSA Promoter Binding Protein-Like7 Is a Central Regulator for Copper Homeostasis in Arabidopsis. Plant Cell 21: 347–361.
  30. 30. Yoo CY, Miura K, Jin JB, Lee J, Park HC, et al. (2006) SIZ1 small ubiquitin-like modifier E3 ligase facilitates basal thermotolerance in Arabidopsis independent of salicylic acid. Plant Physiology 142: 1548–1558.
  31. 31. Lee J, Nam J, Park HC, Na G, Miura K, et al. (2007) Salicylic acid-mediated innate immunity in Arabidopsis is regulated by SIZ1 SUMO E3 ligase. Plant Journal 49: 79–90.
  32. 32. Cao H, Bowling SA, Gordon AS, Dong X (1994) Characterization of an Arabidopsis Mutant That Is Nonresponsive to Inducers of Systemic Acquired Resistance. Plant Cell 6: 1583–1592.
  33. 33. Chen CC, Chen YY, Tang IC, Liang HM, Lai CC, et al. (2011) Arabidopsis SUMO E3 Ligase SIZ1 Is Involved in Excess Copper Tolerance. Plant Physiology 156: 2225–2234.
  34. 34. Ellis C, Turner JG (2002) A conditionally fertile coi1 allele indicates cross-talk between plant hormone signalling pathways in Arabidopsis thaliana seeds and young seedlings. Planta 215: 549–556.
  35. 35. King E, Ward M, Raney D (1954) Two simple media for the demonstration of pyocyanin and fluorescin. J Lab Clin Med 44: 301–307.
  36. 36. Katagiri F, Thilmony R, He SY (2002) The Arabidopsis thaliana-pseudomonas syringae interaction. Arabidopsis Book 1: e0039.
  37. 37. Lin NC, Martin GB (2005) An avrPto/avrPtoB mutant of Pseudomonas syringae pv. tomato DC3000 does not elicit Pto-mediated resistance and is less virulent on tomato. Mol Plant Microbe Interact 18: 43–51.
  38. 38. Blanco F, Salinas P, Cecchini NM, Jordana X, Van Hummelen P, et al. (2009) Early genomic responses to salicylic acid in Arabidopsis. Plant Mol Biol 70: 79–102.
  39. 39. Dong XN (2004) NPR1, all things considered. Current Opinion in Plant Biology 7: 547–552.
  40. 40. Kunkel BN, Brooks DM (2002) Cross talk between signaling pathways in pathogen defense. Current Opinion in Plant Biology 5: 325–331.
  41. 41. Spoel SH, Koornneef A, Claessens SM, Korzelius JP, Van Pelt JA, et al. (2003) NPR1 modulates cross-talk between salicylate- and jasmonate-dependent defense pathways through a novel function in the cytosol. Plant Cell 15: 760–770.
  42. 42. Zheng XY, Spivey NW, Zeng WQ, Liu PP, Fu ZQ, et al. (2012) Coronatine Promotes Pseudomonas syringae Virulence in Plants by Activating a Signaling Cascade that Inhibits Salicylic Acid Accumulation. Cell Host & Microbe 11: 587–596.
  43. 43. Kloek AP, Verbsky ML, Sharma SB, Schoelz JE, Vogel J, et al. (2001) Resistance to Pseudomonas syringae conferred by an Arabidopsis thaliana coronatine-insensitive (coi1) mutation occurs through two distinct mechanisms. Plant Journal 26: 509–522.
  44. 44. Katsir L, Schilmiller AL, Staswick PE, He SY, Howe GA (2008) COI1 is a critical component of a receptor for jasmonate and the bacterial virulence factor coronatine. Proceedings of the National Academy of Sciences of the United States of America 105: 7100–7105.
  45. 45. Xin XF, He SY (2013) Pseudomonas syringae pv. tomato DC3000: A Model Pathogen for Probing Disease Susceptibility and Hormone Signaling in Plants. Annu Rev Phytopathol.
  46. 46. Yan J, Zhang C, Gu M, Bai Z, Zhang W, et al. (2009) The Arabidopsis CORONATINE INSENSITIVE1 protein is a jasmonate receptor. Plant Cell 21: 2220–2236.
  47. 47. Wu Y, Zhang D, Chu JY, Boyle P, Wang Y, et al. (2012) The Arabidopsis NPR1 protein is a receptor for the plant defense hormone salicylic acid. Cell Rep 1: 639–647.