Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Divergent Wnt8a Gene Expression in Teleosts

  • Nesrin Mwafi,

    Affiliation Heidelberg University, Medical Faculty Mannheim, Department of Cell and Molecular Biology, Mannheim, Germany

  • Carlo A. Beretta,

    Affiliation Heidelberg University, Medical Faculty Mannheim, Department of Cell and Molecular Biology, Mannheim, Germany

  • Alessio Paolini,

    Affiliation Heidelberg University, Medical Faculty Mannheim, Department of Cell and Molecular Biology, Mannheim, Germany

  • Matthias Carl

    matthias.carl@medma.uni-heidelberg.de

    Affiliation Heidelberg University, Medical Faculty Mannheim, Department of Cell and Molecular Biology, Mannheim, Germany

Divergent Wnt8a Gene Expression in Teleosts

  • Nesrin Mwafi, 
  • Carlo A. Beretta, 
  • Alessio Paolini, 
  • Matthias Carl
PLOS
x

Correction

24 Mar 2014: The PLOS ONE Staff (2014) Correction: Divergent Wnt8a Gene Expression in Teleosts. PLOS ONE 9(3): e92758. https://doi.org/10.1371/journal.pone.0092758 View correction

Abstract

The analysis of genes in evolutionarily distant but morphologically similar species is of major importance to unravel the changes in genomes over millions of years, which led to gene silencing and functional diversification. We report the analysis of Wnt8a gene expression in the medakafish and provide a detailed comparison to other vertebrates. In all teleosts analyzed there are two paralogous Wnt8a copies. These show largely overlapping expression in the early developing zebrafish embryo, an evolutionarily distant relative of medaka. In contrast to zebrafish, we find that both maternal and zygotic expression of particularly one Wnt8a paralog has diverged in medaka. While Wnt8a1 expression is mostly conserved at early embryonic stages, the expression of Wnt8a2 differs markedly. In addition, both genes are distinctly expressed during organogenesis unlike the zebrafish homologs, which may hint at the emergence of functional diversification of Wnt8a ligands during evolution.

Introduction

Teleosts are particularly suitable for comparative studies to elucidate evolutionary events resulting in genomic diversity. With as many as 25.000 species arising within the last 250 million years, it is the most diverse group of vertebrates and with the increasing number of genome sequences available an invaluable resource for genome comparisons. Amongst the sequenced fish genomes are the zebrafish (Danio rerio) [1] and the medakafish (Oryzias latipes) [2], which share their last common ancestor about 110 million years ago [3]. Due to an ancient genome duplication, teleosts frequently have two copies of genes represented only once in the mammalian genome [4][6]. The Duplication-Degeneration-Complementation (DDC) model of gene evolution has helped framing ideas about how genomes and gene functions evolve following duplication events [7]. For instance, gene paralogs can lose their function during evolution or the coding sequence of one duplicate can change resulting in novel protein functions (neo-functionalisation). Past research has also shown that mutations in gene regulatory regions can result in the acquisition of a new site or time of expression and a paralog's function is changing (sub-functionalisation) [7][10]. Frequently, the expression domain and function of the single mammalian gene homolog is equivalent to the combination of the expression domains and functions of the two fish paralogs. This sub-functionalization of genes in fish can be used to dissect the whole range of gene functions of their non-duplicated mammalian homologs [11], [12]. Thus, it is of fundamental importance to study gene expression and function in related and morphologically similar but evolutionarily distant species to gain insights into the functional complexity of a given gene and to address questions regarding gene/genome evolution also compared to mammalian systems.

The Wnt signaling pathway is highly conserved and amongst the most intriguing signaling cascades studied to date. Its exceptionally wide range of functional properties ranging from cell proliferation and tissue homeostasis to cell differentiation and cellular diversity in development and disease has inspired many researchers investigating Wnt signaling [13], [14]. However, by today, 28 different Wnt ligands have been identified in zebrafish [15] and only a very small subset of ligands has been analyzed in medaka [16]. Wnt8 genes are amongst the most prominent ligands in Wnt signaling. In vertebrates, two Wnt8 genes are present in the genome, Wnt8a and Wnt8b. In teleosts, the genome duplication resulted in the generation of an additional Wnt8a paralog in close genomic proximity and in tandem to the first [17]. This arrangement appears very conserved amongst teleosts [17][19]. Interestingly, besides a transcript for the second Wnt8a paralog, a bicistronic Wnt8a transcript encoding both Wnt8a proteins has been identified in zebrafish [17].

The two Wnt8a paralogs are largely overlappingly expressed during early zebrafish development and appear to exert similar but distinct functions [17], [18]. However, it is not known whether these features are conserved within the teleost lineage. Moreover, an expression or functional analysis at later stages has not been carried out.

Here we report the expression analysis of the two medaka Wnt8a paralogs during embryonic development. Like for other teleosts, the two genes are arranged in close proximity to each other in the genome. However, unlike in zebrafish, both maternal and zygotic expression of the medaka Wnt8a genes differs in various developing tissues. Our data indicate that Wnt8a gene expression has diverged between distantly related teleost species and implies that they may have acquired different functions during evolution. Moreover, we find sites of medaka Wnt8a expression during organogenesis stages, which we did not detect in zebrafish but are found also in mammals with the exception of the caudal hematopoietic system and gall bladder.

Materials and Methods

Ethics statement

The approval for all animal work carried out was obtained from the Regierungspräsidium Karlsruhe (35-9185.64).

Fish maintenance

Wildtype Oryzias latipes from a closed stock at the University Heidelberg and the Danio rerio AB x TL line were kept as described [20][22].

Whole mount in situ labeling

Whole mount in situ hybridization using digoxigenin labeled RNA riboprobes for medaka Wnt8a1 and Wnt8a2 and zebrafish Wnt8a ORF1 and Wnt8a ORF2 were perform as described [23], [24].

Cloning of the full length medaka Wnt8a1 and Wnt8a2 genes

Total RNA was isolated from 1, 2 and 3 dpf medaka embryos using Trizol® (Invitrogen, Darmstadt, Germany). First strand cDNA was prepared according to the manufacturer's protocol (Invitrogen SuperScript®III First-Strand kit, Darmstadt, Germany). To clone both medaka full-length Wnt8a genes from the synthesized cDNA, PCR was performed using the Taq DNA polymerase kit (QIAGEN, Hilden, Germany) with the following primers.

Wnt8a1 forward 5′ AGCGTGGAGGGAGGCTGCAT 3′, Wnt8a1 reverse 5′ TGGAGTGCCCCGTGTTCTGT 3′, Wnt8a2 forward.

5′ AGGAAAATTGAAGAAGCGAACCAGGA 3′ and Wnt8a2 reverse.

5′ AGCCGTAATCTTTCATCTGGGGGC 3′. PCR program: Denaturation for 30 sec at 95°C, annealing for 30 sec at 70°C for Wnt8a1 and 62°C for Wnt8a2 followed by extension for 1 min at 72°C for a total of 35 cycles. The first cycle was preceded with initial denaturation for 3 min at 95°C and the last cycle was followed by additional extension for 3 min at 72°C and cooling at 25°C for 30 sec. The purified full-length Wnt8a cDNAs (Wnt8a1: 1349 bp and Wnt8a2: 1110 bp) were cloned into the pCRII-TOPO vector (Invitrogen, Darmstadt, Germany) according to the manufacturer's instructions and sequenced.

RT-PCR detection of Wnt8a transcripts in medaka and zebrafish

To detect maternal and zygotic expression of medaka Wnt8a genes, we isolated total RNA from medaka embryos at 2-cells, 4-cells, 16-cells and 40% epiboly. The synthesized first strand cDNAs were used as templates for PCR carried out as above to obtain the Wnt8a2 cDNA. To obtain a 530 bp long Wnt8a1 fragment, we used the same PCR conditions as above with an annealing temperature of 60°C and for Wnt8 the following primers: Wnt8a1 forward 5′ AGCGTGCAAGTGTCACGGCG 3′, Wnt8a1 reverse 5′ CACGGTCCCTGCGCTTCGTT 3′.

Total RNA from zebrafish was isolated from embryos at 80% epiboly and from heads dissected posterior to the hindbrain and the remaining tails at 48 hpf. To obtain a 217 bp long Wnt8a ORF1 cDNA fragment and a 264 bp long Wnt8a ORF2 fragment (see supporting information Figure S1I), the PCR conditions were used as above with an annealing temperature of 62°C with the following primers: Wnt8a ORF1 forward 5′ GCTGTCAAAGCAACGCTCAA 3′, Wnt8a ORF1 reverse 5′ AGCTGAACGTGTCCGCTATT 3′, Wnt8a ORF2 forward 5′ GGATGTAGCGACAACGTGGA 3′, Wnt8a ORF2 reverse 5′ GAGTTTCTGGGCCTGATCGT 3′.

Phylogenetic analysis

The genomic browsers: Ensembl (http://www.ensembl.org/index.html) and NCBI (http://www.ncbi.nlm.nih.gov/) were used to collect the sequences of Wnt8a transcripts: Homo sapiens (Wnt8a: ENST00000398754); Pan troglodytes (Wnt8a: ENSPTRT00000031975); Bos taurus (Wnt8a: NM_001192370.1); Equus caballus (Wnt8a: ENSECAT00000015524); Mus musculus (Wnt8a: ENSMUST00000012426); Rattus norvegicus (Wnt8a: ENSRNOT00000064574); Ciona intestinalis (WntA202: ENSCINT00000012046); Xenopus tropicalis (Wnt8a: ENSXETT00000008323); Xenopus laevis (Wnt8a: NM_001088168.1); Taeniopygia guttata (Wnt8a: ENSTGUT00000001220); Tetraodon nigroviridis (Wnt8a-203: ENSTNIT00000002526, Wnt8a-202: ENSTNIT00000001194); Gallus gallus (Wnt8C: ENSGALT00000009817); Oryzias latipes (Wnt8a1 (formerly named WNT8A (1 of 2): ENSORLT00000009606, Wnt8a2 (formerly named WNT8A (2 of 2): ENSORLT00000009585); Gasterosteus aculeatus (Wnt8a_1.2: ENSGACT00000024478, Wnt8a_2.2: ENSGACT00000024475); Danio rerio (Wnt8a ORF1: ENSDART00000017635, Wnt8a ORF2: ENSDART00000105649); Takifugu rubripes (Wnt8.1: AY628150, Wnt8.2: AY628150). At NCBI, both Takifugu rubripes Wnt8 genes share one accession number and are named wnt8 bicistronic mRNA with nucleotides 1-1092 bp coding for the Wnt8.1 protein and 1552–2604 bp coding for the Wnt8.2 protein.

The Wnt8a cDNA sequence alignments and the phylogenetic trees were built using Geneious software. The sequences were aligned using the global multiple alignment method with free end gaps. The tree was built using the Phylogenetic Maximum Likelihood method (PhML) [25] and the Hasegaw-Kishino-Yano (HKY85) substitution model with 10.000 bootstrap replicates using Ciona intestinalis as outgroup. To disentangle nodes in the tree, MrBayes analysis was applied [26]. The MCMC (Markov chain Monte Carlo) was used to calculate the posterior probabilities of phylogenetic trees.

Results and Discussion

Wnt8a ligands are conserved amongst vertebrates

Like in other teleosts [17][19], the two medaka Wnt8a paralogs are organized in a tandem arrangement in the genome. We isolated the full length coding sequences of medaka Wnt8a1 (formerly named Wnt8-like) [16] and Wnt8a2. Phylogenetic analysis shows that the medaka Wnt8a paralogs cluster well with the respective Wnt8a paralogs of the evolutionarily close Fugu and Tetraodon (Figure 1). In contrast, the zebrafish Wnt8a genes cluster together on the Wnt8a1 branch of the tree. Consistent with its evolutionary distance, the medaka Wnt8a1 protein shares higher homology with its Fugu homolog (78% identical amino acids (aa)) rather than with zebrafish Wnt8a ORF1 (also named Wnt8.1, Wnt8a or Wnt8a.1) (69% identical aa). However, the second Wnt8a protein, Wnt8a2, appears similarly conserved (Fugu Wnt8.2 shares 71% identical aa with medaka Wnt8a2 and 72% with zebrafish Wnt8a ORF2; also named Wnt8.2 [17]).

thumbnail
Figure 1. Phylogenetic analysis of Wnt8a genes.

The medaka genome contains two Wnt8a genes (bold). The Wnt8a cDNA sequence alignment of various species shows that the medaka paralogous copies cluster well with those of evolutionarily related teleosts. acul., aculeatus; nigro., nigroviridis.

https://doi.org/10.1371/journal.pone.0085303.g001

Like zebrafish Wnt8a ORF1 (63% identical aa compared to 62% of Wnt8a ORF2), the medaka Wnt8a1 protein is most similar to the mammalian single Wnt8a protein (60% identical aa compared to 56% of Wnt8a2).

This indicates that the medaka genome contains two paralogous Wnt8a copies, which are well conserved within closely related teleosts and that Wnt8a1 is the gene more similar to the single mammalian Wnt8a.

Differential initiation of medaka Wnt8a gene paralog expression

Zebrafish Wnt8a ORF1 is expressed maternally [27] and the earliest Wnt8a expression in other animal models has been reported in the posterior epiblast prior to gastrulation in mice and chick [28], [29]. Early zygotic zebrafish Wnt8a expression is found in lateral and ventral marginal cells of the blastoderm [17], [27] (Figure S1A and B). Its expression in the embryonic shield remains controversial. This gene was initially described to be expressed in the shield and downregulated subsequently [27]. A later study mentioned that Wnt8a ORF1 (and Wnt8a ORF2) is not expressed in the shield until about 75% epiboly [17]. At subsequent stages, Wnt8a ORF1 is expressed in the paraxial mesoderm [27] and Wnt8a ORF2 remains expressed in marginal cells similar to its paralog [17].

We find that medaka Wnt8a1 is maternally expressed (Figure 2A,C,E), while we did not detect any Wnt8a2 transcripts by whole mount in situ hybridization or RT-PCR (Figure 2B,D,F). The early zygotic medaka Wnt8a1 expression is well conserved amongst vertebrates and is seen in lateral and ventral marginal cells at 40% epiboly with the exception of the shield (Figure 2G) [16], [17], [27], [28], [30][32]. At this stage, Wnt8a2 is expressed weakly in a slightly broader region of the blastoderm margin including cells of the shield (Figure 2H). At late gastrulation, medaka Wnt8a1 is also found in cells of the dorsal blastoderm margin with lower expression in the ventral part similar to its homologs in other vertebrates [17] (Figure 2I and inset). However, no Wnt8a2 transcripts are found in any of the marginal cells. Therefore the temporal expression of medaka Wnt8a2 in the shield and the blastoderm margin markedly differs from medaka Wnt8a1 and zebrafish Wnt8a ORF2. This may imply functional differences of the medaka Wnt8a genes during early embryonic development, which may be more prominent than in zebrafish [17].

thumbnail
Figure 2. Differential early Wnt8a1 and Wnt8a2 gene expression.

(A–D) 8-cell stage embryos are shown with the animal pole to the top. Sense RNA probes were used to validate the maternal Wnt8a1 expression. (E,F) RT-PCR for Wnt8a1 and Wnt8a2 transcripts on extracted RNA at stages indicated to the left. (G,H) Pictures focused on the dorsal margin of the dissected blastoderm of embryos at 40% epiboly with animal pole to the top. While Wnt8a1 (G) is expressed in cells of the blastoderm margin but not in cells of the shield (framed by black lines), Wnt8a2 (H) is weakly expressed in cells of the shield and the margin. Open rectangle indicates the broad Wnt8a2 expression domain at the margin. (I,J) Embryos at 80% epiboly with anterior to the left; (I) dotted lines frame the developing embryonic axis; inset and (J) show embryos dissected from the yolk for clarity. (J) Dotted line marks the blastoderm margin. 40%, 40% epiboly; c, cells; ma, margin; ea, embryonic axis; n.c., negative control; pam, paraxial mesoderm; st., stage; vma, ventral margin.

https://doi.org/10.1371/journal.pone.0085303.g002

Shortly before the end of gastrulation, we find Wnt8a2 transcripts specifically in the paraxial mesoderm (Figure 2J). This transient Wnt8a2 expression is similar to the reported expression of zebrafish Wnt8a ORF1 and the single Wnt8a genes of Xenopus and mouse [17], [28], [33], [34] (Table 1).

thumbnail
Table 1. Sites of Wnt8a gene expression in medaka, zebrafish, Xenopus and mouse.

https://doi.org/10.1371/journal.pone.0085303.t001

Medaka Wnt8a expression during somitogenesis and organogenesis

During zebrafish somitogenesis, both Wnt8a genes are expressed in cells of the tailbud [17], [35] (Figure S1C and D). At 2 and 4 days of development, we find ubiquitous staining for both genes in the developing brain and no staining in the trunk and tail (Figure S1E–H). However, the same holds true for the genes' sense probes suggesting that the antisense probes give rise to background color. Indeed, using RT-PCR on RNA extracted from dissected heads and tails of 2 dpf embryos, we observed low amounts of cDNA products for both genes in both regions (Figure S1I). This suggests that also during stages following somitogenesis both zebrafish Wnt8a genes are expressed at low levels, which, however, is not detectable by in situ hybridization. In mouse and chick embryos Wnt8a expression is confined to the fore- and midbrain as well as limbs and branchial arches [36]. Furthermore, expression in the gut, heart and otic vesicles has been reported for mouse embryos [36][38]. Thus, many of the later Wnt8a expression domains may not be conserved between zebrafish and mouse and chick (Table 1).

We find that medaka Wnt8a1 is expressed in the axial part of the presomitic mesoderm in the tailbud (Figure 3A) [16] including cells of the most posterior notochord. Conversely, Wnt8a2 expression is seen broadly throughout the posterior somatic mesoderm reaching into the forming somites (Figure 3B). While Wnt8a1 remains expressed in a decreasing number of tailbud cells up to 3,5 dpf (Figure 3C,E) similar to zebrafish, Wnt8a2 transcripts disappear in this part of the embryo. Instead, Wnt8a2 starts to be expressed in cells of the caudal hematopoietic system at 2,5 days, where it is strongly expressed in the caudal vein from 3,5 dpf onwards (Figure 3D,F and inset) [39]. Moreover, expression is seen in the otic vesicles at 4 dpf (Figure 3H). On the other hand Wnt8a1 transcripts appear in the entire gut by 3.5 dpf extending anteriorly into the oesophagus subsequently (Figure 3G,I). In addition, Wnt8a1 is expressed in the outflow tract of the heart, the swim bladder and the gall bladder (Figure 3G,I and inset). These observations represent evolutionary diversification of gene expression within the teleost lineage and amongst vertebrate species in general. Unlike other model systems analyzed, we were not able to detect expression of zebrafish Wnt8a genes at stages after somitogenesis by in situ hybridization. Conversely, Wnt8a gene expression in cells of the developing hindbrain rhombomeres seen in various species including zebrafish appears not to be conserved in medaka [17], [28], [29], [33]. Moreover, Wnt8a expression in limbs and branchial arches of mouse and chick embryos is not seen in fish [36]. Intriguingly, expression in the gut, heart and otic vesicles appears to be conserved between medaka and mouse [36][38], while only medaka Wnt8a gene expression is found in the caudal hematopoietic tissue, gall- and swim bladder (Table 1).

thumbnail
Figure 3. Wnt8a gene paralog expression pattern differ during somitogenesis and organogenesis.

(A,B,E,G–I) Dorsal and (C,D,F) lateral views with anterior to the left, (A–F) focused on the tail region. (A,B) At 38 hours post fertilization (hpf), Wnt8a1 transcripts are found in the axial part of the tailbud including the posterior end of the notochord (arrow), while Wnt8a2 is widely expressed in the tailbud, presomitic mesoderm and developing somites. (C–F) Wnt8a1 expressing cells are found in the tailbud at 2,5 days post fertilization (dpf) and 3,5 dpf and Wnt8a2 is expressed in caudal hematopoietic tissue (arrows in D). Line in (F) marks the position of the transversal section shown in the inset. (G) After 4 dpf, Wnt8a1 is expressed in the entire gut, oesophagus (not before 4 dpf (I)), swim- and gall bladder. The anatomy of these structures has been well described previously [40]. (I) The dissected gut system is shown for clarity. The inset shows Wnt8a1 expression in the outflow tract of the dissected heart. (H) Wnt8a2 transcripts are present in the otic vesicles. a, atrium; ca, caudal artery; cv, caudal vein; g, gall bladder; l, liver; no, notochord; nt, neural tube; oe, oesophagus; oft, outflow tract; ov, otic vesicle; psm, presomitic mesoderm; sb, swim bladder; som, somites; tb, tailbud; v, ventricle.

https://doi.org/10.1371/journal.pone.0085303.g003

In summary, the medaka Wnt8a paralogs have acquired very different sites of expression when compared to each other, but the sum resembles much of Wnt8a expression in animals with a single Wnt8a gene in their genome.

The early medaka Wnt8a1 gene expression is similar to Wnt8a expression of other vertebrate species. However, the temporal-spatial dynamics of Wnt8a2 expression appears to have diverged during teleost evolution. It is tempting to speculate that this may be due to differences on the transcriptional level such that for instance unlike zebrafish and Fugu Wnt8a, medaka may not have a bicistronic Wnt8a transcript [17], [18].

Our phylogenetic analysis shows that the zebrafish Wnt8a genes do not separate into the two Wnt8a gene clusters of other teleosts, which may explain their similar expression and semi-redundant function described in zebrafish [17]. Conversely, the separation of medaka Wn8a paralogous copies together with the divergence of their expression suggests that the two genes may have acquired different functions during evolution.

Supporting Information

Figure S1.

Analysis of zebrafish Wnt8a gene expression. (A,B) Dorsal views and (C,D,G,H) lateral views of zebrafish embryos labeled for Wnt8a ORF1 and Wnt8a ORF2 expression at stages indicated to the left. (A–D) Embryos at 80% epiboly and 22 hpf exhibit the described Wnt8a gene expression in cells of the blastoderm margin and the tail tip respectively; no labeling is detected using the Wnt8a sense probes (insets in A and B). (E–H) Low levels of blue color is ubiquitously distributed in the brain of 2 dpf and 4 dpf old embryos, which is however also seen using the sense probe (insets in E and F). (I) RT-PCR analysis to detect Wnt8a gene transcripts reveals low levels of Wnt8a gene expression in both heads and tails of zebrafish embryos. Therefore the color visible in the head is likely to be background. 80%, 80% epiboly; n.c., negative control; st., standard; tb, tailbud.

https://doi.org/10.1371/journal.pone.0085303.s001

(TIF)

Acknowledgments

We thank N. Aghaallaei and M. Ramialison for help with medaka anatomy, R. Duncan and R. Dorsky for plasmids, J. Wittbrodt and M. Boutros for support and our fish facility team for fish care.

Author Contributions

Conceived and designed the experiments: MC. Performed the experiments: NM AP. Analyzed the data: NM MC. Contributed reagents/materials/analysis tools: MC. Wrote the paper: MC. Generation and analysis of the phylogenetic tree: CB.

References

  1. 1. How K, Clark MD, Torroja CF, Torrance J, Berthelot C, et al. (2013) The zebrafish reference genome sequence and its relationship to the human genome. Nature 496: 498–503.
  2. 2. Kasahara M, Naruse K, Sasaki S, Nakatani Y, Qu W, et al. (2007) The medaka draft genome and insights into vertebrate genome evolution. Nature 447: 714–719.
  3. 3. Wittbrodt J, Shima A, Schartl M (2002) Medaka – a model organism from the far East. Nat Rev Genet 3: 53–64.
  4. 4. Postlethwait JH, Yan YL, Gates MA, Horne S, Amores A, et al. (1998) Vertebrate genome evolution and the zebrafish gene map. Nature Genetics 18: 345–349.
  5. 5. Furutani-Seiki M, Wittbrodt J (2004) Medaka and zebrafish, an evolutionary twin study. Mechanisms of Development 121: 629–637.
  6. 6. Postlethwait JH, Woods IG, Ngo-Hazelett P, Yan YL, Kelly PD, et al. (2000) Zebrafish comparative genomics and the origins of vertebrate chromosomes. Genome Research 10: 1890–1902.
  7. 7. Force A, Lynch M, Pickett FB, Amores A, Yan Y-L, et al. (1999) Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151: 1531–1545.
  8. 8. Winkler S, Loosli F, Henrich T, Wakamatsu Y, Wittbrodt J (2000) The conditional medaka mutation eyeless uncouples patterning and morphogenesis of the eye. Development 127: 1911–1919.
  9. 9. Yokoi H, Shimada A, Carl M, Takashima S, Kobayashi D, et al. (2007) Mutant analyses reveal different functions of fgfr1 in medaka and zebrafish despite conserved ligand-receptor relationships. Dev Biol 304: 326–337.
  10. 10. Loosli F, Staub W, Finger-Baier KC, Ober EA, Verkade H, et al. (2003) Loss of eyes in zebrafish caused by mutation of chokh/rx3. EMBO Reports 4: 894–899.
  11. 11. Chiang C, Litingtung Y, Lee E, Young KE, Corden JL, et al. (1996) Cyclopia and defective axial patterning in mice lacking Sonic Hedgehog gene function. Nature 383: 407–413.
  12. 12. Schauerte HE, van Eeden FJ, Fricke C, Odenthal J, Strahle U, et al. (1998) Sonic hedgehog is not required for the induction of medial floor plate cells in the zebrafish. Development 125: 2983–2993.
  13. 13. Clevers H, Nusse R (2012) Wnt/b-Catenin Signaling and Disease. Cell 149: 1192–1205.
  14. 14. van Amerongen R, Nusse R (2009) Towards an integrated view of Wnt signaling in development. Development 136: 3205–3214.
  15. 15. Beretta CA, Brinkmann I, Carl M (2011) All four zebrafish Wnt7 genes are expressed during early brain development. Gene Expression Patterns 11: 277–284.
  16. 16. Yokoi H, Nishimatsu A, Ozato K, Yoda K (2003) Cloning and embryonic expression of six wnt genes in the medaka (Oryzias latipes) with special reference to expression of wnt5a in the pectoral fin buds. Develop Growth Differ 45: 51–61.
  17. 17. Lekven AC, Thorpe CJ, Waxman JS, Moon RT (2001) Zebrafish wnt8 encodes two wnt8 proteins on a bicistronic transcript and is required for mesoderm and neurectoderm patterning. Developmental Cell 1: 103–114.
  18. 18. Ramel MC, Buckles GR, Lekven AC (2004) Conservation of structure and functional divergence of duplicated Wnt8s in pufferfish. Dev Dyn 231: 441–448.
  19. 19. Narayanan A, Lekven AC (2012) Biphasic wnt8a expression is achieved through interactions of multiple regulatory inputs. Developmental Dynamics 241: 1062–1075.
  20. 20. Köster R, Stick R, Loosli F, Wittbrodt J (1997) Medaka spalt acts as a target gene of hedgehog signaling. Development 124: 3147–3156.
  21. 21. Westerfield M (1995) The Zebrafish Book 3rd Edition. (Eugene, OR: The University of Oregon Press).
  22. 22. McNabb A, Scott K, von Ochsenstein E, Seufert K, Carl M (2012) Don't be afraid to set up your fish facility. Zebrafish 9: 120–125.
  23. 23. Loosli F, Köster RW, Carl M, Krone A, Wittbrodt J (1998) Six3, a medaka homologue of the Drosophila homeobox gene sine oculis is expressed in the anterior embryonic shield and the developing eye. Mechanisms of Development 74: 159–164.
  24. 24. Mcdonald FJ, Heath JK (1994) Developmentally Regulated Expression of Fibroblast Growth Factor Receptor Genes and Splice Variants by Murine Embryonic Stem and Embryonal Carcinoma Cells. Developmental Genetics 15: 148–154.
  25. 25. Guindon S, Gascuel O (2003) A Simple, Fast, and Accurate Algorithm to Estimate Large Phylogenies by Maximum Likelihood. Systematic Biology 52: 696–704.
  26. 26. Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of phylogenetic tress. Bioinformatics 17: 754–755.
  27. 27. Kelly GM, Greenstein P, Erezyilmaz DF, Moon RT (1995) Zebrafish wnt8 and wnt8b share a common activity but are involved in distinct developmental pathways. Development 121: 1787–1799.
  28. 28. Bouillet P, Oulad-Abdelghani M, Ward SJ, Bronner S, Chambon P, et al. (1996) A new mouse member of the Wnt gene family, mWnt-8, is expressed during early embryogenesis and is ectopically induced by retinoic acid. Mechanisms of Development 58: 141–152.
  29. 29. Hume CR, Dodd J (1993) Cwnt-8C – A Novel Wnt Gene with a Potential Role in Primitive Streak Formation and Hindbrain Organization. Development 119: 1147–1160.
  30. 30. Smith WC, Harland RM (1991) Injected Xwnt-8 RNA acts early in Xenopus Embryos to promote formation of a vegetal dorsalizing center. Cell 67: 753–765.
  31. 31. Christian JL, McMahon JA, McMahon AP, Moon RT (1991) Xwnt-8, a Xenopus Wnt-1/int-1-related gene responsive to mesoderminducing growth factors, may play a role in ventral mesodermal patterning during embryogenesis. Development 111: 1045–1055.
  32. 32. Christian JL, Moon RT (1993) Interactions between Xwnt-8 and Spemann organizer signaling pathways generate dorsoventral pattern in the embryonic mesoderm of Xenopus. Developmental Biology 180: 22–34.
  33. 33. In der Rieden PMJ, Vilaspasa FL, Durston AJ (2010) Xwnt8 Directly Initiates Expression of Labial Hox Genes. Developmental Dynamics 239: 126–139.
  34. 34. Tian Q, Nakayama T, Dixon MP, Christian JL (1999) Post-transcriptional regulation of Xwnt-8 expression is required for normal myogenesis during vertebrate embryonic development. Development 126: 3371–3380.
  35. 35. Narayanan A, Thompson SA, Lee JJ, Lekven AC (2011) A transgenic wnt8a:PAC reporter reveals biphasic regulation of vertebrate mesoderm development. Developmental Dynamics 240: 898–907.
  36. 36. Martin A, Maher S, Summerhurst K, Davidson D, Murphy P (2012) Differential deployment of paralogous Wnt genes in the mouse and chick embryo during development. Evolution & Development 14 2: 178–195.
  37. 37. Summerhurst K, Stark M, Sharpe J, Davidson D, Murphy P (2008) 3D representation of Wnt and Frizzled gene expression patterns in the mouse embryo at embryonic day 11.5 (Ts19). Gene Expression Patterns 8: 331–348.
  38. 38. Jaspard B, Couffinhal T, Dufourcq P, Moreau C, Duplaa C (2000) Expression pattern of mouse sFRP-1 and mWnt-8 gene during heart morphogenesis. Mechanisms of Development 90: 263–267.
  39. 39. Fujita M, Isogai S, Kudo A (2006) Vascular Anatomy of the Developing Medaka, Oryzias latipes: A Complementary Fish Model for Cardiovascular Research on Vertebrates. Developmental Dynamics 235: 734–746.
  40. 40. Kobayashi D, Jindo T, Naruse K, Takeda H (2006) Development of the endoderm and gut in medaka, Oryzias latipes. Develop Growth Differ 48: 283–295.