Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

A Repeat Sequence Causes Competition of ColE1-Type Plasmids

  • Mei-Hui Lin ,

    Contributed equally to this work with: Mei-Hui Lin, Jen-Fen Fu

    Affiliations Department of Medical Biotechnology and Laboratory Science, College of Medicine, Chang Gung University, Taoyuan, Taiwan, Research Center for Pathogenic Bacteria, Chang Gung University, Taoyuan, Taiwan

  • Jen-Fen Fu ,

    Contributed equally to this work with: Mei-Hui Lin, Jen-Fen Fu

    Affiliation Department of Medical Research, Chang Gung Memorial Hospital, and Graduate Institute of Clinical Medical Sciences Taoyuan, Taiwan

  • Shih-Tung Liu

    cgliu@mail.cgu.edu.tw

    Affiliations Department of Microbiology and Immunology, College of Medicine, Chang Gung University, Taoyuan, Taiwan, Research Center for Pathogenic Bacteria, Chang Gung University, Taoyuan, Taiwan

A Repeat Sequence Causes Competition of ColE1-Type Plasmids

  • Mei-Hui Lin, 
  • Jen-Fen Fu, 
  • Shih-Tung Liu
PLOS
x

Abstract

Plasmid pSW200 from Pantoea stewartii contains 41 copies of 15-bp repeats and has a replicon that is homologous to that of ColE1. Although deleting the repeats (pSW207) does not change the copy number and stability of the plasmid. The plasmid becomes unstable and is rapidly lost from the host when a homoplasmid with the repeats (pSW201) is present. Deleting the repeats is found to reduce the transcriptional activity of RNAIp and RNAIIp by about 30%, indicating that the repeats promote the transcription of RNAI and RNAII, and how the RNAI that is synthesized by pSW201 inhibits the replication of pSW207. The immunoblot analysis herein demonstrates that RNA polymerase β subunit and σ70 in the lysate from Escherichia coli MG1655 bind to a biotin-labeled DNA probe that contains the entire sequence of the repeat region. Electrophoretic mobility shift assay also reveals that purified RNA polymerase shifts a DNA probe that contains four copies of the repeats. These results thus obtained reveal that RNA polymerase holoenzyme binds to the repeats. The repeats also exchange RNA polymerase with RNAIp and RNAIIp in vitro, revealing the mechanism by which the transcription is promoted. This investigation elucidates a mechanism by which a plasmid prevents the invasion of an incompatible plasmid and maintains its stability in the host cell during evolution.

Introduction

Stability is the most important determinant of the survival of a plasmid during evolution [1]. To maintain stability, a plasmid with a low copy number, such as F or P1, uses complex segregation systems to ensure it is precisely segregated into daughter cells following plasmid replication and cell division [2], [3], [4]. Post-segregational killing (PSK) systems also ensure that all of the living daughter cells receive a plasmid following cell division [5]. Many plasmids with a relatively high copy number, including ColE1 and p15A, typically segregate random numbers of replicated plasmids [6], [7]. Since the number of copies is large, the probability that a daughter cell does not receive a randomly segregated plasmid is low [7], [8], [9]. Additionally, precise control of the copy number ensures that a constant number of plasmids are maintained in a cell [6], [10]. Incompatibility is another factor that is likely to threaten the stability of a plasmid [11]. After an incompatible plasmid invades a cell, the plasmid coexists with the resident plasmid and consumes the same resources in the cell to replicate and segregate. Over time, the plasmid that invades the cell may multiply and cause the loss of the original resident plasmid.

Plasmid competition is a mechanism by which a plasmid is lost in the presence of an incompatible plasmid in the same cell. One of the best-documented instances of this phenomenon concerns pT181. This plasmid contains a cis element, cmp, which functions at a distance and optimizes the utilization of oriV by a replication initiation protein, RepC [12], [13]. Gennaro et al. [14], [15] showed that although deleting cmp from pT181 does not affect a plasmid’s replication, stability, or copy number, a homoplasmid without a cmp is rapidly lost when pT181 is present in the same cell [14], [15]. Plasmid competition also occurs in pSC101 and is associated with a DNA sequence that involves plasmid partition [16]. If pSC101 is present, then a homoplasmid without this sequence is lost from the cell [17]. Additionally, PSK-mediated plasmid competition has been identified. A plasmid that encodes a PSK system can cause the loss of a PSK-negative plasmid from the same cell [18], [19], [20].

Plasmids of the ColE1 family replicate by a different mechanism from that used by pT181 and pSC101. Rather than using replication initiation proteins to initiate plasmid replication, ColE1 synthesizes preprimer RNA [21], [22], which forms an RNA-DNA hybrid at the oriV, allowing cleavage of the RNA by RNase H to produce RNAII [23], [24], which then serves as a primer to initiate plasmid replication [25], [26], [27]. Therefore, RNAII acts only in cis and cannot initiate the replication of another ColE1 molecule. Also, ColE1 synthesizes RNAI, which forms a duplex with the 5′ region of preprimer RNA [27]; this duplex changes the structure of the preprimer RNA, preventing its cleavage at the oriV and, thereby, the initiation of plasmid replication [27], [28]. Therefore, RNAI is a trans-acting factor that acts as an inc determinant that controls the copy number and causes plasmid incompatibility [29], [30].

Pantoea stewartii SW2 is a corn pathogen that induces necrosis and systemic wilting, called Stewart’s wilt [31]. The organism has 13 plasmids, which range in size from 4 to 320 kb [32]. Since P. stewartii is a member of Enterobacteriaceae, these plasmids can replicate and be stably maintained in Escherichia coli [33]. Of these 13 plasmids in strain SW2, pSW100 (4272 bp) and pSW200 (4367 bp) are the two smallest and their replicon is homologous to those of ColE1 and p15A [34], [35]. However, in spite of the homology of the replicon sequence, the two plasmids are compatible with ColE1 and p15A [34], [35]. Interestingly, pSW100 and pSW200 have only ten copies per cell – fewer than ColE1 [34], [35]. A calculation that is based on their copy number shows that the plasmids are less than one thousandth as stable as ColE1 or p15A [6], [36]. Owing to their potential instability, pSW100 uses the sex pilus assembly as a partition tool to maintain its stability whereas pSW200 utilizes a 9-bp sequence, sps (sequence for plasmid stability) for the efficient synthesis of RNAII and maintenance of the stability of the plasmid [37], [38]. Plasmid pSW200 also contains genes that are required for plasmid mobilization and a 0.6-kb fragment, from nt 3341 to nt 3955, which includes 41 copies of contiguous 15-bp repeats (DR region) (Fig. 1). An earlier study revealed that although deleting 40 of the 41 repeats from pSW200 (pSW207) does not affect the stability or copy number of the plasmid [35], the plasmid becomes extremely unstable when a homoplasmid with an intact DR region, pSW201, is present in the same cell [35]. The loss of pSW207 is associated with the DR region in pSW201 because another pSW201 derivative that lacks the DR region, pSW219, is incompatible with pSW207 and does not unilaterally cause the loss of pSW207 [35]. This investigation finds that the repeats promote the transcription of both the RNAI and preprimer RNA genes. The elevated RNAI expression from pSW201 prevents preprimer RNA from coupling to the oriV in pSW207, inhibiting replication and resulting in the loss of pSW207.

thumbnail
Figure 1. Linear map of plasmids used in this study.

(A) Plasmid pSW200 (4367 bp) has an RNAI-RNAII region, oriV, bom, mobCABD and a region that contains 41 copies of 15-bp direct repeats (DR). (B) Plasmid pSW201 includes the entire pSW200 sequence and a Km-resistance gene (open triangle) that is inserted into the mob region at a PstI site. Plasmid pSW201N is identical to pSW201 except for the inverted DR region. Plasmids pSW210, pSW219, pSW230, pSW231, pSW232 and pSW252 are deletion derivatives of pSW201. Plasmid pSW207 contains 40 of the 41 repeats with the SspI-DraI fragment replaced by a Tc-resistance gene (filled square). Numbers represent the nucleotide positions from the DraI site in pSW200. The map shows the following restriction enzyme sites; A, AflIII; B, BglII; D, DraI; H, HincII; N, NcoI; Ac, AccI; Nh, NheI; P, PstI; S, SspI, and Sp, SpeI.

https://doi.org/10.1371/journal.pone.0061668.g001

Materials and Methods

Bacterial Strains and Culturing Conditions

E. coli HB101 (F-, hsdS20, supE44, recA13, ara14, proA2, rpsL20, xyl-5, mtl-1) [39] was used as a host for studying competition among plasmids. E. coli MG1655 (F-, λ-) [40] was obtained from Bioresource Collection and Research Center (Taiwan) and used to identify the proteins that bind to DR repeats. LB broth and agar [41] were used as general-purpose media. Kanamycin (Km) (50 µg/ml), ampicillin (Ap) (50 µg/ml), and tetracycline (Tc) (12.5 µg/ml) were added to the medium to select antibiotic-resistant colonies.

Plasmid Construction

Plasmids that were used in this study are summarized in Table 1 and shown in Fig. 1. The construction of pSW201, pSW207, pSW210, pSW219 and pSW106 has been described elsewhere [35]. Plasmid pSW201N is identical to pSW201 except for the opposite orientation of the DR region. One to four 0.6-kb fragments from pACYC184 (nt 3808 to nt 162, GenBank accession number: X06403.1) [42] were inserted into DraI site in pSW201 to produce pSW201D1, pSW201D2, pSW201D3 and pSW201D4, respectively, to study the effects of the distance between the 15-bp repeats and the RNAI and RNAII promoters on competition. Plasmids pSW230, pSW231 and pSW232 are derivatives of pSW201 that lack the NheI-PstI (nt 1189 to nt 1752), PstI-AflIII (nt 1752 to nt 2178), and AflIII-SpeI fragments (nt 2178 to nt 3212), respectively, of pSW200. Plasmid pSW252 contains the BglII-NheI fragment (nt 380 to nt 1189) and the SspI-BglII fragment (nt 3356 to nt 3981) in pSW200, and a kanamycin-resistance gene. A BspHI-AccI fragment, a BglII-AccI fragment, a BstI-AccI fragment and a BglII-AccI fragment, which contained the minimal replicons of pBR322 [43], pACYC184 [42], pSW100 [34] and pRK415 [44], were isolated by restriction digestion and used to replace the BglII-AccI fragment in pSW200 to form pBR322-210, pACYC-210, pSW100-210 and pRK-210, respectively. Plasmid pKK175-6-lux was constructed by inserting a HindIII-BamHI fragment of pUCD1752, which contains the luxAB genes, into the HindIII-BamHI sites of pKK175-6 [45]. Then, a DNA fragment that covered the region from nt 1 to 426 and nt 3356 to 4367 in pSW200 were inserted into pKK175-6-lux to form pSW242 and pSW243, respectively. PCR was used to amplify a DNA fragment from nt 3022 to nt 426, which contains the DR region and RNAIIp, with primers A1 (5′-CCCTGCAGATGACGGAGCTGGAAAAAC) and B1 (5′-GGAAGCTTCAGTTAATAAGATTACGGCGGG) using pSW210 as a template. The PCR product was cut using PvuII and HindIII and inserted into the SmaI-HindIII sites in pKK175-6 [45] to form pSW261. The DR region in pSW261 was deleted using NcoI and BglII to form pSW262. The region from nt 532 to nt 957 that contained RNAIp in pSW200 was amplified by PCR using primers A2 (5′-GGAGGATCCTTCCAGTGTAGCCGCAG) and B2 (5′-CCGTCGACGCTGCGATGCCGTTTTTCC) and inserted into the BamHI-SalI sites in pSW261 to yield pSW2611. A DNA fragment that contained a 5′ portion of the tet gene was amplified by PCR using pKK175-6 as a template and primers A3 (5′-CCAAGCTTCCTAATGAGGAGTCGCATAA) and B3 (5′-CCCGGATCCATAAGTGCGCGACGATAGT). The fragment was inserted at the BamHI-HindIII sites in pSW2611 to form pSW2612. NcoI and BglII were used to delete RNAIIp from pSW2612 to form pSW263. The NcoI-HindIII fragment, which contained the DR region and RNAIIp in pSW2612, was then deleted to generate pSW264. AatII and SpeI were used to delete the DR region in pSW201, which was then treated with ExoIII and mungbean nuclease using an Exo-size deletion kit (New England Biolabs). The DNA fragments were then ligated to generate plasmids with various numbers of repeats. DNA sequencing was performed to count the repeats in the plasmids.

Competition Assay

E. coli HB101 was cotransformed with pSW207 (Tcr) and a deletion derivative of pSW201 (Kmr). Transformants were cultured overnight in LB broth that contained Km and Tc, and subcultured to the mid-log phase in the same medium without antibiotics. Plasmids in the cell were analyzed using the alkaline-lysis method of Kado and Liu [46] with minor modification. Briefly, the plasmids were extracted from cells (1×109 cfu). The cell pellet was dissolved in 20 µl TAE and 80 µl extraction buffer [46]. After 1 hr of incubation at room temperature, the plasmid solution was treated with 100 µl phenol-chloroform. Meanwhile, cells (2×105 cfu) were subcultured in 5 ml of antibiotic-free LB broth for 7 h with shaking at 37°C, plated on LB agar, and then replica-plated onto plates that contained Km or Tc. About 500 to 1000 colonies were examined to determine the fraction of the colonies that were resistant to kanamycin and tetracycline. Cells that had been transformed using a single plasmid were used as a control. The ratio of copy number of two plasmids in the same cell was estimated following agarose gel electrophoresis by measuring the intensity of the plasmid bands using the Gel-Pro software program (Media Cybernetics). Plasmid pSW201, which has ten copies per cell [35], was used as a reference.

DNA Affinity Precipitation Assay (DAPA)

E. coli MG1655 was cultured in 50 ml LB overnight. After centrifugation, cell pellet was suspended in ice-cold homogenization buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, 1.5% Triton X-100, pH 8.0). Cells were homogenized using a Mini BeadBeater (Biospec Products Inc.). The cell lysate was centrifuged at 17,000×g for 30 min at 4°C. A biotinylated DNA probe, DR-I, which contains the entire sequence of the DR region (nt 3314 to nt 3975) in pSW200, was amplified by PCR using biotin-labeled primers 200-Bio-F5 (5′- GTTAGTCCCTTCCACATTAA) and 200-R5 (5′-ACGATGGGGTTATCAATCTG). The lysate (1 mg protein) was mixed with 2.5 µg of DR-I probe in a binding buffer that contained 60 mM KCl, 12 mM HEPES, pH 7.9, 4 mM Tris-HCl, 5% glycerol, 0.5 mM EDTA, and 1 mM dithiothreitol. The reaction mixture was incubated on ice for 45 minutes and mixed with 30 mg M280 streptavidin beads (Dynal Biotech, Norway). The beads were then captured using a magnet and washed five times in binding buffer while they were attached to the magnet. A 2× electrophoresis sample buffer was used to extract proteins that were bound to the probes, and the proteins were then boiled for 10 min [37]. The proteins were separated by in a 6% SDS-polyacrylamide gel and analyzed by immunoblotting using anti-RNA polymerase β subunit antibody and anti-σ70 antibody (Abcam, Cambridge, UK) [37]. A biotin-labeled probe, 167, which contained a non-promoter sequence from the fen operon [47] was used as a negative control.

Electrophoretic Mobility Shift Assay (EMSA)

Biotin was used to label double-stranded DNA probes using a 3′-end DNA labeling kit (Pierce, Rockford, IL). Each probe (5 nM) was then mixed with RNA polymerase holoenzyme (Epicentre, Madison, WI) in 20 µl of a reaction mixture that contained 1 mM Tris-HCl, pH 7.5, 50 mM KCl, 1 mM dithiothreitol, 2.5% glycerol, 5 mM MgCl2, 1 µg poly(dI-dC), and 0.05% NP-40. The mixture was incubated at room temperature for 20 min. EMSA was performed using the method of Lin et al. [37]. An unlabeled DR probe was used to compete the binding. DNA was detected using horseradish peroxidase-conjugated streptavidin (Pierce, Rockford, IL). DNA probes were also labeled using [γ-32P]ATP according to a method that has been described elsewhere [48]. 32P-labeled DNA was then purified using an Easy Pure PCR/Gel Extraction Kit (Bioman, Taipei, Taiwan). RNA polymerase (5 nM) was incubated with 32P-labeled DR probe (0.1 µM) in 20 µl EMSA reaction mixture. After 20 min of incubation, unlabeled 167, RNAIp and RNAIIp probes (0.1 µM) were added to the mixture to detect the exchange of RNA polymerase from the DR probe to 167, RNAIp and RNAIIp probes. In another set of exchange experiments, RNA polymerase (5 nM) was incubated with biotin-labeled DR probe (1 nM) for 15 min. The DNA-protein complex was captured using the method that was used for DAPA. 32P-labeled 167, RNAIp and RNAIIp probes (0.1 µM) were then added to the DNA-protein complex. Exchange of RNA polymerase from the DR probes to RNAIp and RNAIIp was analyzed by gel electrophoresis and autoradiography.

Analysis of Transcription Using RT-qPCR

An RNA/DNA Mini Kit (Qiagen, Valencia, CA) was used to purify RNA from E. coli cells that had been cultured to the log phase. Purified RNA was suspended in water that had been treated with diethyl pyrocarbonate and reverse-transcribed to cDNA using both random hexamers and Superscript II reverse transcriptase (Life Technologies). An ABI PRISM 7700 sequence detection system (Applied Biosystems) was used to quantify and analyze the cDNA. 5′-TCCTAATGCAGGAGTCGCATAA and 5′-CATAAGTGCGGCGACGATAGT were used in PCR to amplify a 115-bp region in the tetracycline-resistance gene. The 16S rRNA, which was used as an internal control to normalize the amount of tested transcript, was reverse-transcribed and amplified using primers F1 (5′-CCATGAAGTCGGAATCGCTAG) and R1 (5′-ACTCCCATGGTGTGACGG) [49]. The activities of RNAIp and RNAIIp were normalized by calculating the difference between the threshold number of cycles of 16S rRNA and that of the tetracycline-resistance gene (ΔCt). The difference between the promoter activity in the presence of DR and that in the absence of DR was determined from the difference between ΔCt values (ΔΔCt). The amount of tet mRNA that was obtained from pSW261 and pSW263 was set to 100%. The difference between the amounts of mRNA was calculated as 2ΔΔCt [50]. Each experiment was performed three times.

Results

Repeat Region and Plasmid Competition

Our earlier study demonstrated that the repeats in pSW201 are responsible for the instability of pSW207 (Fig. 1B) as a pSW201 derivative that does not include an intact repeat region, such as pSW219, cannot destabilize pSW207 [35] (Table 2). This study further demonstrated that pSW207 was lost in the presence of pSW252, in which all of the regions other than those that contained the replicon and repeats of pSW200 were deleted (Fig. 1B). After E. coli HB101 was cotransformed with pSW252 and pSW207, 94% of the colonies were found to be resistant to kanamycin (pSW252), and 6% were resistant to tetracycline (pSW207) (Table 2), verifying that the repeats in pSW252 are responsible for plasmid competition. Additionally, pSW207 is lost irrespectively of the orientation of the DR region in pSW201 because pSW201N, which contains an inverted DR region (Fig. 1B), caused the loss of pSW207 with a pSW201N:pSW207 segregation ratio of 98∶2 (Table 2). Furthermore, increasing the distance between DR and the RNAII promoter by inserting one to four copies of a 600-bp DNA fragment at a DraI site to form pSW201D1, pSW201D2, pSW201D3 and pSW201D4, respectively, did not influence the capacity of pSW201 to destabilize pSW207, all of which had a segregation ratio with pSW207 of 99∶1 (Table 2). In this study, the mob region was also deleted (pSW230, pSW231, pSW232) (Fig. 1B). These plasmids destabilized pSW207 (Table 2), suggesting that the mob genes are not associated with competition.

Numbers of Repeats and Competition Among Plasmids

Since the 15-bp repeats in pSW200 importantly affected plasmid competition, whether altering the number of the repeats could influence the capacity of pSW201 to compete with pSW207 was studied. The competition assay revealed that only 3% of the population contained pSW207 when the cells were cotransformed with pSW201. The fraction of the cells that contained pSW207 increased to 10% when the number of repeats in pSW201 was reduced from 41 to 19; it increased to 31%, 45% and 42% when the number of repeats in pSW201 was reduced to three, one and zero, respectively (Fig. 2). The results demonstrate that number of repeats strongly affects plasmid competition.

thumbnail
Figure 2. Correlation between number of repeats and competition among plasmids.

Derivatives of pSW201 that contain various numbers of 15-bp repeats were cotransformed with pSW207 into E. coli HB101. The transformants were plated on LB agar and then replica-plated on LB agar that contained Km or Tc to select those that contained pSW201 derivatives with various numbers of repeats (empty column) and pSW207 (filled column).

https://doi.org/10.1371/journal.pone.0061668.g002

Enhancing Transcriptional Activity of RNAIp and RNAIIp by 15-bp Repeats

As is generally known, RNAI is the inc determinant that inhibits the coupling of preprimer RNA to the oriV and thereby prevents the replication of ColE1 plasmids. This study posits that deleting the DR region from pSW200 reduces the transcription of the RNAI and preprimer RNA genes. Restated, in a cell that contains both pSW201 and pSW207, pSW201 expresses more RNAI than does pSW207, overwhelming the preprimer RNA from pSW207 to inhibit the replication of pSW207, which is therefore excluded from the cell. Therefore, in this study, transcriptional fusions were generated to test whether the DR region affected the activities of RNAIp and RNAIIp, which were determined by measuring the amount of RNA that was transcribed from the promoters by RT-qPCR. Additionally, instead of amplifying the region between RNAIp and RNAIIp, which has a complex secondary structure and is difficult to amplify by PCR, the regions downstream of the two promoters were replaced with a sequence from a Tc-resistance gene (Fig. 3A). RT-qPCR analysis revealed that deleting the DR regions from pSW261 and pSW263 reduced the amount of RNA that was transcribed from RNAIIp and RNAIp by 29% and 33%, respectively (Fig. 3B, 3C), revealing that the deletion of the DR region equally reduced the activities of RNAIp and RNAIIp by about 30%. These results suggest that the repeats promote the transcription of the RNAI and preprimer RNA genes. This enhancement is not attributed to the transcription from the DR repeats as a transcriptional fusion between the repeat region and luxAB (pSW243) yielded only the background level of luciferase activity (Fig. 4), indicating that the DR repeats do not contain a promoter that transcribes the RNAI and preprimer RNA genes.

thumbnail
Figure 3. RT-qPCR analysis of activity of RNAIp and RNAIIp.

(A) Map of pSW261, pSW262, pSW263, and pSW264. Arrow indicates direction of transcription. Numbers represent relative nucleotide positions in pSW200. (B)(C) RNA that was transcribed from a region in Tc-resistance gene was amplified by RT-qPCR. 16S rRNA was used as an internal control and amounts of mRNA that were transcribed from RNAIp and RNAIIp were normalized to amount of 16S rRNA. Amount of tet mRNA from pSW261 and pSW263 was set to 100%. Experiment was performed three times and each sample was prepared in duplicate. Empty square: a fragment from tetracycline-resistance gene; error bar: standard deviation.

https://doi.org/10.1371/journal.pone.0061668.g003

thumbnail
Figure 4. Transcription from DR and RNAIIp.

Transcriptional fusion was generated by inserting a fragment from nt 1 to 426, which contains RNAIIp in pSW201 (pSW242), and a fragment from nt 3356 to 4367 in pSW201, which contains DR (pSW243), into a luciferase reporter plasmid, pKK175-6-lux. Luciferase activity was monitored with a luminometer and presented in relative light units (RLU). Each experiment was performed three times and each sample in the experiment was prepared in duplicate.

https://doi.org/10.1371/journal.pone.0061668.g004

Analysis of RNA Polymerase Bound to 15-bp Repeats

According to sequence analysis, the repeat region contains sequences resemble that of the -35 box (Fig. 5). To confirm whether the binding of RNA polymerase to the repeats is critical to plasmid competition, a DNA affinity precipitation assay (DAPA) was performed. The lysate from E. coli MG1655 was mixed with a biotinylated DNA probe, DR-I, that contained the entire DR region (Fig. 5B). The proteins that were bound to the repeats were analyzed by immunoblotting using antibodies against RNA polymerase β subunit and σ70. The immunoblot results revealed these two proteins in the lysate (Fig. 6, lanes 1, 4). Meanwhile, the study found the binding of RNA polymerase β subunit and σ70 to the DR-I probe (Fig. 6, lanes 3, 6), but not to probe 167, which contained a non-promoter sequence from the fen operon (Fig. 6, lanes 2, 5), suggesting the binding of RNA polymerase holoenzyme to DR repeats.

thumbnail
Figure 5. −10 and −35 sequences in RNAIp, RNAIIp, and DR.

(A) Sequences of -10 and -35 boxes in RNAIp and RNAIIp. (B) Forty-one copies of 15-bp repeats in DR region, from nt 3341 to nt 3955 in pSW200. Sequences that are homologous to the -35 box are underlined.

https://doi.org/10.1371/journal.pone.0061668.g005

thumbnail
Figure 6. Analysis of proteins that bind to 15-bp repeats.

An E. coli MG1655 lysate was mixed with a biotin-labeled probe, DR-I, which contained the entire DR region (lanes 3, 6), or probe 167 (lanes 2, 5). Proteins in the cell lysate that was bound to the probes were captured using streptavidin-coated magnetic beads and analyzed by immunoblotting using antibodies against β subunit of RNA polymerase (RNAP β)) (lanes 1–3) and σ70 (lanes 4–6). Lanes 1 and 4 were loaded with 0.05% cell lysate.

https://doi.org/10.1371/journal.pone.0061668.g006

Binding of RNA Polymerase to DR Region

The binding of RNA polymerase to the repeat region was confirmed by electrophoretic mobility shift assay (EMSA) using purified enzyme. PAGE revealed that 5–25 nM RNA polymerase shifted 5 nM DR probe (Fig. 7B, lanes 2–4). As expected, adding an unlabeled DR probe to the reaction mixture reduced the binding of RNA polymerase to the biotin-labeled DR probe (Fig. 7B, lanes 5–7). In a negative control, no band shift was observed when 5 nM probe 167 was utilized (Fig. 7B, lanes 8, 9). However, when a segment of the DR sequence from nt 3900 to nt 3930 in pSW200 (Fig. 6B) was inserted into probe 167, as in 167-DR (Fig. 7A), RNA polymerase shifted the probe (Fig. 7B, lanes 10, 11), confirming the binding of RNA polymerase to the DR region.

thumbnail
Figure 7. Binding of RNA polymerase to 15-bp repeats.

(A) Sequences of DNA probes used in EMSA. DR probe contains four copies of 15-bp repeats from nt 3896 to nt 3955. Sequences highlighted in DR probe resemble 35 sequences. Underlined region in DR probe from nt 3900 to nt 3930 was inserted into 167 sequence to yield 167-DR. (B) Purified RNA polymerase holoenzyme (Epicentre) was added to a reaction mixture that contained biotinylated DR probe (lanes 1–7). Unlabeled DR probe was added to compete for binding (lanes 5–7). Probe 167 and 167-DR (lane 8–11) were used to confirm binding of RNA polymerase to repeat region. Protein-DNA complex was separated using a 7% polyacrylamide gel and detected using a LightShift chemiluminescence EMSA kit (Pierce).

https://doi.org/10.1371/journal.pone.0061668.g007

Exchange of RNA Polymerase from DR Region to RNAIp and RNAIIp

Since RNA polymerase binds to the DR region, this study hypothesizes that RNA polymerase was tethered in the repeat region and was subsequently exchanged to RNAIp and RNAIIp, enhancing the transcription of RNAI and preprimer RNA genes. Hence, 5 nM RNA polymerase was mixed with 0.1 µM 32P-labeled DR probe to enable the binding of the enzyme to the probe. Cold RNAIp, RNAIIp, and 167 probes (0.1 µM) were then added to the reaction mixture to compete for binding. Although adding probe 167 slightly reduced the amount of RNA polymerase that was bound to the DR probe (Fig. 8B, lane 3), adding RNAIp and RNAIIp probes substantially reduced the binding (Fig. 8B, lanes 4, 5), indicating that adding RNAIp and RNAIIp probes to a mixture of RNA polymerase-DR probe complex destabilized the binding of RNA polymerase to DR. Another set of experiments involved adding cold RNA polymerase-DR probe complex (Bio-DR/RP) that had been captured with streptavidin beads to reaction mixtures that contained 0.1 µM 32P-labeled RNAIp, RNAIIp and 167 probes. The results revealed that RNA polymerase-DR complex shifted the RNAIp and RNAIIp probes (Fig. 8C, lanes 4, 6) but did not shift probe 167 (Fig. 8C, lane 2). Notably, the intensities of the probe bands in the gel seemed high, because of the large amounts of probes that were required to ensure detection of the exchange of RNA polymerase. The results revealed that RNA polymerase bound to the DR probe was exchanged with the RNAIp and RNAIIp probes.

thumbnail
Figure 8. Exchange of RNA polymerase from DR region to RNAIp and RNAIIp.

(A) Sequences of RNAIp and RNAIIp probes. (B) Purified RNA polymerase (RP) was added to 32P-labeled-DR probe (Fig. 7A). Unlabeled RNAIIp and RNAIp probes, which contained sequences shown in (A), were used to analyze exchange of RNA polymerase from DR region to RNAIp and RNAIIp. (C) DNA-protein complexes that contained a biotinylated-DR probe (Bio-DR) and RNA polymerase (Bio-DR/RP) were captured using streptavidin-coated magnetic beads. After unbound RNA polymerase had been removed, 32P-labeled RNAIIp and RNAIp probes were added to RNA polymerase-DR complex to analyze exchange of RNA polymerase from repeats to RNAIp and RNAIIp. Probe 167 was used as a negative control.

https://doi.org/10.1371/journal.pone.0061668.g008

Competition of Plasmids of ColE1 Family Caused by pSW200 Repeats

The BglII-AccI fragment (nt 380 to nt 1178) in pSW210 (Fig. 1B) that contained the replicon was replaced with a pBR322, p15A, or pSW100 replicon to yield pBR322-210, pACYC-210, or pSW100-210, respectively. Gel electrophoresis revealed that although pUC18 had a high copy number [51] when it was maintained as the sole plasmid in E. coli HB101 (Fig. 9A, lane 1), the copy number of pUC18 was considerably lower when pBR322-210 was present in the same cell (Fig. 9A, lane 3), showing that pUC18 was lost in the presence of pBR322-210. Meanwhile, pACYC184 and pSW106 were lost in the presence of pACYC-210 and pSW100-210, respectively (Fig. 9A, lanes 6, 9). This study also showed that pRK-210, which contains the RK2 replicon and DR, did not cause the instability of pSW207 and pACYC184 (Fig. 9B, lanes 1, 3). Plasmid pACYC-210 also did not cause the instability of pSW207 (Fig. 9B, lane 2), indicating that the presence of DR in a compatible plasmid does not cause competition. These results demonstrate that the repeats in the DR region from an incompatible plasmid cause competition among the plasmids of the ColE1 family.

thumbnail
Figure 9. Competition of ColE1-like plasmids by pSW200 repeats.

(A) Three plasmids in the ColE1 family that contains DR – pBR322-210, pACYC-210, and pSW100-210 were tested to determine their capacity to destabilize an incompatible plasmid. E. coli HB101 was transformed with pUC18 (lane 1), pBR322-210 (lane 2), pACYC184 (lane 4), pACYC-210 (lane 5), pSW106 (lane 7), and pSW100-210 (lane 8). The cells were also cotransformed with pUC18 and pBR322-210 (lane 3), pACYC184 and pACYC-210 (lane 6), and pSW106 and pSW100-210 (lane 9). (B) Plasmids pRK-210, a plasmid that contains an RK2 replicon and DR, and pACYC-210 were tested to determine their ability to destabilize a compatible plasmid. E. coli HB101 was cotransformed with pRK-210 and pSW207 (lane 1), pACYC-210 and pSW207 (lane 2), and pRK-210 and pACYC184 (lane 3). Plasmids were isolated using an alkaline lysis method and detected by agarose gel electrophoresis. Asterisks indicate pUC18, pACYC184, and pSW106.

https://doi.org/10.1371/journal.pone.0061668.g009

Discussion

Our earlier study revealed that DR is essential to the destabilization of pSW207 by pSW201 in E. coli HB101 (Table 2) [35]. This study concludes that the presence of a DR region enhances the transcription of both RNAI and preprimer RNA genes. RT-qPCR results show that deleting the DR region reduces the activities of both RNAIp and RNAIIp by about 30%. The results of the RT-qPCR study also suggest that, despite the reduction in transcription, the ratio of RNAI to RNAII that are synthesized by the pSW207 is equal to that of pSW201. This finding may explain why the number of copies of pSW207 is similar to that of pSW201. This study also shows that DR functions in a manner similar to eukaryotic enhancers [52] by promoting transcription from a distance in either orientation, although the ability of DR to enhance transcription is considerably less than that of a typical enhancer.

This study also supports the claim that RNA polymerase binds to the repeats in the DR region and is then exchanged with RNAIp and RNAIIp, promoting the transcription of the RNAI and preprimer RNA genes. The first piece of evidence for this claim is that the 15-bp repeats in the DR region contain sequences that resemble that of a -35 box (Fig. 5). Although RNA polymerase typically binds to both -35 and -10 sequences to initiate transcription, RNA polymerase anchors to the -35 region of the promoter to form the first closed complex in the initial stage of transcription [53], [54], suggesting that RNA polymerase binds to the -35-like sequences in the DR region. The second piece of evidence is that the immunoblot analysis revealed the binding of RNA polymerase β’ subunits and σ70 to probes that contain the 15-bp repeat sequences (Fig. 6). Finally, an EMSA study revealed that RNA polymerase shifted the probes that contain repeat sequences (Fig. 7B), revealing the binding of RNA polymerase to the DR region.

This study establishes that RNA polymerase that is tethered to DR is exchanged with RNAIp and RNAIIp since the EMSA results show that adding cold RNAIp and RNAIIp probes to the reaction mixture considerably reduced the amount of RNA polymerase that was bound to the DR probe (Fig. 8B). Despite the binding of RNA polymerase, DR probable does not act as a promoter, since luxAB reporter genes that are inserted downstream of the DR region are not transcribed from DR (Fig. 4). Additionally, a sequence that resembles a -10 sequence is not present at a proper distance from the -35 sequences, suggesting that DR does not have promoter activity. Moreover, the exchange of RNA polymerase from an unlabeled repeat probe becomes evident when 32P-labeled probes that contain the sequences of RNAIp and RNAIIp are added to the reaction mixture (Fig. 8C), suggesting that RNA polymerase that binds to the DR region is exchanged with RNAIp and RNAIIp to enhance transcription. Finally, pUC18, pACYC184, and pSW100 exhibit the competition phenotype when a DR fragment is present (Fig. 9), suggesting that the DR fragment also affects other ColE1-like plasmids. Furthermore, DR functions only between incompatible plasmids because pRK-210 and pACYC-210 do not cause instability of compatible plasmids (Fig. 9B). Based on the results of this study, a model of the regulation of plasmid competition by DR is proposed. In this model, DR promotes the transcription of RNAI and preprimer RNA genes of pSW201 by exchanging RNA polymerase that is bound to DR with RNAIp and RNAIIp. Although pSW207 synthesizes less preprimer RNA than does pSW201, the ratio of RNAI to preprimer RNA remains unchanged, so the copy number of pSW207 is similar to that of pSW201. Meanwhile, the RNAI that is generated by pSW201 efficiently inhibits the coupling of preprimer RNA to oriV to decrease the copy number of pSW207, while maintaining the copy number of pSW201 at ten per cell. Therefore, pSW200 uses DR to inhibit the replication of an incoming incompatible plasmid without the DR sequence to prevent curing from the cell by incompatibility. This study elucidates a mechanism by which a plasmid causes the loss of an invading incompatible plasmid to maintain its stability during evolution.

Acknowledgments

The authors thank Wan-Ju Ke for providing the 167 DNA probe. We also thank Yi-Ching Cheng and Shu-Kuan Shih for their technical assistance. Ted Knoy is appreciated for his editorial assistance.

Author Contributions

Conceived and designed the experiments: MHL JFF STL. Performed the experiments: MHL JFF. Analyzed the data: MHL JFF STL. Contributed reagents/materials/analysis tools: MHL JFF STL. Wrote the paper: MHL JFF STL.

References

  1. 1. Nordstrom K, Austin SJ (1989) Mechanisms that contribute to the stable segregation of plasmids. Annu Rev Genet 23: 37–69.
  2. 2. Schumacher MA (2012) Bacterial plasmid partition machinery: a minimalist approach to survival. Curr Opin Struct Biol 22: 72–79.
  3. 3. Bouet JY, Nordstrom K, Lane D (2007) Plasmid partition and incompatibility–the focus shifts. Mol Microbiol 65: 1405–1414.
  4. 4. Sengupta M, Austin S (2011) Prevalence and significance of plasmid maintenance functions in the virulence plasmids of pathogenic bacteria. Infect Immun 79: 2502–2509.
  5. 5. Hayes F (2003) Toxins-antitoxins: plasmid maintenance, programmed cell death, and cell cycle arrest. Science 301: 1496–1499.
  6. 6. Nordstrom K, Gerdes K (2003) Clustering versus random segregation of plasmids lacking a partitioning function: a plasmid paradox? Plasmid 50: 95–101.
  7. 7. Summers D (1998) Timing, self-control and a sense of direction are the secrets of multicopy plasmid stability. Mol Microbiol 29: 1137–1145.
  8. 8. Paulsson J, Ehrenberg M (1998) Trade-off between segregational stability and metabolic burden: a mathematical model of plasmid ColE1 replication control. J Mol Biol 279: 73–88.
  9. 9. Field CM, Summers DK (2011) Multicopy plasmid stability: revisiting the dimer catastrophe. J Theor Biol 291: 119–127.
  10. 10. Friehs K (2004) Plasmid copy number and plasmid stability. Adv Biochem Eng Biotechnol 86: 47–82.
  11. 11. Novick RP (1987) Plasmid incompatibility. Microbiol Rev 51: 381–395.
  12. 12. Gennaro ML, Novick RP (1986) cmp, a cis-acting plasmid locus that increases interaction between replication origin and initiator protein. J Bacteriol 168: 160–166.
  13. 13. Henriquez V, Milisavljevic V, Kahn JD, Gennaro ML (1993) Sequence and structure of cmp, the replication enhancer of the Staphylococcus aureus plasmid pT181. Gene 134: 93–98.
  14. 14. Gennaro ML, Novick RP (1988) An enhancer of DNA replication. J Bacteriol 170: 5709–5717.
  15. 15. Gennaro ML (1993) Genetic evidence for replication enhancement from a distance. Proc Natl Acad Sci U S A 90: 5529–5533.
  16. 16. Tucker WT, Miller CA, Cohen SN (1984) Structural and functional analysis of the par region of the pSC101 plasmid. Cell 38: 191–201.
  17. 17. Manen D, Goebel T, Caro L (1990) The par region of pSC101 affects plasmid copy number as well as stability. Mol Microbiol 4: 1839–1846.
  18. 18. Naito T, Kusano K, Kobayashi I (1995) Selfish behavior of restriction-modification systems. Science 267: 897–899.
  19. 19. Naito Y, Naito T, Kobayashi I (1998) Selfish restriction modification genes: resistance of a resident R/M plasmid to displacement by an incompatible plasmid mediated by host killing. Biol Chem 379: 429–436.
  20. 20. Cooper TF, Heinemann JA (2000) Postsegregational killing does not increase plasmid stability but acts to mediate the exclusion of competing plasmids. Proc Natl Acad Sci U S A 97: 12643–12648.
  21. 21. Masukata H, Tomizawa J (1984) Effects of point mutations on formation and structure of the RNA primer for ColE1 DNA replication. Cell 36: 513–522.
  22. 22. Itoh T, Tomizawa J (1980) Formation of an RNA primer for initiation of replication of ColE1 DNA by ribonuclease H. Proc Natl Acad Sci U S A. 77: 2450–2454.
  23. 23. Itoh T, Tomizawa J (1982) Purification of ribonuclease H as a factor required for initiation of in vitro Co1E1 DNA replication. Nucleic Acids Res 10: 5949–5965.
  24. 24. Selzer G, Tomizawa JI (1982) Specific cleavage of the p15A primer precursor by ribonuclease H at the origin of DNA replication. Proc Natl Acad Sci U S A 79: 7082–7086.
  25. 25. Tomizawa JI, Itoh T (1982) The importance of RNA secondary structure in CoIE1 primer formation. Cell 31: 575–583.
  26. 26. Masukata H, Tomizawa J (1990) A mechanism of formation of a persistent hybrid between elongating RNA and template DNA. Cell 62: 331–338.
  27. 27. Masukata H, Tomizawa J (1986) Control of primer formation for ColE1 plasmid replication: conformational change of the primer transcript. Cell 44: 125–136.
  28. 28. Tomizawa J, Itoh T, Selzer G, Som T (1981) Inhibition of ColE1 RNA primer formation by a plasmid-specified small RNA. Proc Natl Acad Sci U S A 78: 1421–1425.
  29. 29. Cesareni G, Helmer-Citterich M, Castagnoli L (1991) Control of ColE1 plasmid replication by antisense RNA. Trends Genet 7: 230–235.
  30. 30. Tomizawa J, Itoh T (1981) Plasmid ColE1 incompatibility determined by interaction of RNA I with primer transcript. Proc Natl Acad Sci U S A 78: 6096–6100.
  31. 31. Stewart FC (1897) A Bacterial Disease of Sweet Corn. NY Agric Exp Stn Bull 130: 422–439.
  32. 32. Coplin DL, Rowan RG, Chisholm DA, Whitmoyer RE (1981) Characterization of plasmids in Erwinia stewartii. Appl Environ Microbiol 42: 599–604.
  33. 33. Frederick RD, Coplin, D L (1986) Transformation of Escherichia coli by plasmid DNA from Erwinia stewartii. Mol Plant Pathol 76: 1353–1356.
  34. 34. Fu JF, Chang HC, Chen YM, Chang YS, Liu ST (1995) Sequence analysis of an Erwinia stewartii plasmid, pSW100. Plasmid 34: 75–84.
  35. 35. Fu JF, Hu JM, Chang YS, Liu ST (1998) Isolation and characterization of plasmid pSW200 from Erwinia stewartii. Plasmid 40: 100–112.
  36. 36. Summers DK (1991) The kinetics of plasmid loss. Trends Biotechnol 9: 273–278.
  37. 37. Lin MH, Liu ST (2008) Stabilization of pSW100 from Pantoea stewartii by the F conjugation system. J Bacteriol 190: 3681–3689.
  38. 38. Wu YC, Liu ST (2010) A sequence that affects the copy number and stability of pSW200 and ColE1. J Bacteriol 192: 3654–3660.
  39. 39. Boyer HW, Roulland-Dussoix D (1969) A complementation analysis of the restriction and modification of DNA in Escherichia coli.. J Mol Biol 41: 459–472.
  40. 40. Guyer MS, Reed RR, Steitz JA, Low KB (1981) Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol 45 Pt 1: 135–140.
  41. 41. Miller JH (1972) Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  42. 42. Chang AC, Cohen SN (1978) Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol 134: 1141–1156.
  43. 43. Bolivar F, Rodriguez RL, Greene PJ, Betlach MC, Heyneker HL, et al. (1977) Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene 2: 95–113.
  44. 44. Ditta G, Schmidhauser T, Yakobson E, Lu P, Liang XW, et al. (1985) Plasmids related to the broad host range vector, pRK290, useful for gene cloning and for monitoring gene expression. Plasmid 13: 149–153.
  45. 45. Brosius J (1984) Plasmid vectors for the selection of promoters. Gene 27: 151–160.
  46. 46. Kado CI, Liu ST (1981) Rapid procedure for detection and isolation of large and small plasmids. J Bacteriol 145: 1365–1373.
  47. 47. Ke WJ, Chang BY, Lin TP, Liu ST (2009) Activation of the promoter of the fengycin synthetase operon by the UP element. J Bacteriol 191: 4615–4623.
  48. 48. Yeh HY, Chen TC, Liou KM, Hsu HT, Chung KM, et al. (2011) The core-independent promoter-specific interaction of primary sigma factor. Nucleic Acids Res 39: 913–925.
  49. 49. Corless CE, Guiver M, Borrow R, Edwards-Jones V, Kaczmarski EB, et al. (2000) Contamination and sensitivity issues with a real-time universal 16S rRNA PCR. J Clin Microbiol 38: 1747–1752.
  50. 50. Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3: 1101–1108.
  51. 51. Lin-Chao S, Chen WT, Wong TT (1992) High copy number of the pUC plasmid results from a Rom/Rop-suppressible point mutation in RNA II. Mol Microbiol 6: 3385–3393.
  52. 52. Riethoven JJ (2010) Regulatory regions in DNA: promoters, enhancers, silencers, and insulators. Methods Mol Biol 674: 33–42.
  53. 53. Mecsas J, Cowing DW, Gross CA (1991) Development of RNA polymerase-promoter contacts during open complex formation. J Mol Biol 220: 585–597.
  54. 54. Perez-Martin J, Rojo F, de Lorenzo V (1994) Promoters responsive to DNA bending: a common theme in prokaryotic gene expression. Microbiol Rev 58: 268–290.