Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

One Species, Three Pleistocene Evolutionary Histories: Phylogeography of the Italian Crested Newt, Triturus carnifex

Abstract

Phylogeographic patterns of temperate species from the Mediterranean peninsulas have been investigated intensively. Nevertheless, as more phylogeographies become available, either unique patterns or new lines of concordance continue to emerge, providing new insights on the evolution of regional biotas. Here, we investigated the phylogeography and evolutionary history of the Italian crested newt, Triturus carnifex, through phylogenetic, molecular dating and population structure analyses of two mitochondrial gene fragments (ND2 and ND4; overall 1273 bp). We found three main mtDNA lineages having parapatric distribution and estimated divergence times between Late Pliocene and Early Pleistocene. One lineage (S) was widespread south of the northern Apennine chain and was further geographically structured into five sublineages, likely of Middle Pleistocene origin. The second lineage (C) was widespread throughout the Padano–Venetian plain and did not show a clear phylogeographic structure. The third lineage (N) was observed in only two populations located on western Croatia/Slovenia. Results of analysis of molecular variance suggested that partitioning populations according to the geographic distribution of these lineages and sublineages explains 76% of the observed genetic variation. The phylogeographic structure observed within T. carnifex and divergence time estimates among its lineages, suggest that responses to Pleistocene environmental changes in this single species have been as diverse as those found previously among several codistributed temperate species combined. Consistent with the landscape heterogeneity, physiographic features, and palaeogeographical evolution of its distribution range, these responses encompass multiple refugia along the Apennine chain, lowland refugia in large peri-coastal plains, and a ‘cryptic’ northern refugium.

Citation: Canestrelli D, Salvi D, Maura M, Bologna MA, Nascetti G (2012) One Species, Three Pleistocene Evolutionary Histories: Phylogeography of the Italian Crested Newt, Triturus carnifex. PLoS ONE 7(7): e41754. https://doi.org/10.1371/journal.pone.0041754

Editor: Vincent Laudet, Ecole Normale Supérieure de Lyon, France

Received: May 2, 2012; Accepted: June 25, 2012; Published: July 26, 2012

Copyright: © Canestrelli et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This study was funded by the Agenzia Regionale dei Parchi (ARP-Lazio) and by the PRIN project 20085YJMTC from ‘Ministero dell'Istruzione, dell'Università e della Ricerca’ (MIUR, Italy). DS is supported by FCT post-doctoral grant SFRH/BPD/66592/2009. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Identifying Pleistocene refugia is a central task of phylogeographical research ([1]–[3] and references therein), and ongoing climate change has led to increased interest in the identification and characterization of these areas [4]. Glacial refugia allowed species to survive during unfavourable climatic phases of the Pleistocene and are often hotspots of current intraspecific diversity. Recent studies have shown that a plethora of microevolutionary processes encompassing demographic size variations, population fragmentations, secondary contacts, and population admixture acted in glacial refugia and contributed to shape the high refugial genetic diversity [3], [5]–[12]. Therefore, glacial refugia are important both for long-term preservation of species and for their evolutionary potential. Moreover, evidence supporting the importance of genetic diversity with respect to community structure and ecosystem resilience is growing [13], [14]. Thus, assessing the geographic location of glacial refugia and understanding what microevolutionary processes were involved in the formation and long-term maintenance of genetic diversity hotspots in these areas have crucial relevance with respect to conservation at multiple levels of biodiversity [4], [15], [16]. Interestingly, in many regions worldwide, glacial refugia for temperate species have been identified in coastal lowlands (e.g. [17]–[20]) and/or at the so-called ‘rear edges’, the current low-latitude margins of species' ranges (e.g. [21]–[24]). Populations in these areas are expected to be especially threatened by climate change, rising special concerns for their long-term conservation (see [4], [15], [25], [26] for a thorough discussion of the genetic consequences of recent climate change).

The western Mediterranean region has been the subject of intensive phylogeographical efforts [5], [6], [27], [28]. The Balkan, Iberian, and Italian peninsulas have long been identified as the most important refugial areas in the region, but as more studies were performed, increasingly complicated patterns appeared. For example, within these three peninsulas, a scenario of multiple refugia is emerging for a growing number of species (see [6], and references therein). While in many cases long-term demographic stability can explain the occurrence of intraspecific diversity hotspots in these areas, in many others repeated cycles of population fragmentation and secondary admixture were involved (e.g. [10], [11], [29], [30]). Moreover, peri-glacial areas and coastal lowlands exposed by glaciation-induced sea-level lowstands are emerging as important, previously underrated refugia, which allowed some species to overcome the negative demographic effects of glacial climate [19]. On the whole, these studies reveal that the species' responses to Pleistocene climatic oscillations were even more diverse than previously thought [5], [7], [19], [31]–[35].

In this study, we examined the phylogeography of the Italian crested newt, Triturus carnifex. This amphibian belongs to the T. cristatus superspecies, a species group distributed in Europe and western Asia (reviewed in [36]). T. carnifex is common and widespread from sea level to about 1000 m a.s.l. ([37], but see also [38]) where it breeds in a wide range of freshwater habitats [38]–[40]. T. carnifex is generally considered a poor disperser with short migration distances, generally less than 1 Km/year ([36], [41]; but see also [42]). It is mainly distributed in the Italian peninsula south of the Alpine arc, reaching East Slovenia, northern Croatia and Austria ([36]; Figure 1C). Interestingly, it is absent in most of the central and southern Calabria, an area that has been repeatedly indicated as the most important glacial refugium for temperate species in the Italian peninsula (see [10], [11], [43]; and references therein).

thumbnail
Download:
Figure 1. Geographic distribution of the 37 sampling sites and phylogenetic relationships of the 49 haplotypes found in Triturus carnifex.

A, Maximum likelihood (ML) tree showing the phylogenetic relationships among the 49 haplotypes found in Triturus carnifex. Terminal haplogroups were collapsed. Clade names and bootstrap (bs) values of ML and Maximum parsimony (MP) trees (ML/MP), respectively, are shown above and below each node (grey circles: bs >70%; black circles: bs >85%). B, Statistical parsimony networks, with haplotypes numbered as in Table 1. Circles size is proportional to haplotype frequency; open dots represent missing intermediate haplotypes. C, Geographical distribution of the 37 populations sampled. Populations (shown as pie diagrams) are coloured according to the main haplogroups in panels A and B. White dotted line shows the northern edge of the species' distribution; A, Arno river basin, CS, Crati–Sibari plain, VC, Volturno–Calore river drainage basin. Inset: Geographical location of the study area within the western Palearctic region.

https://doi.org/10.1371/journal.pone.0041754.g001

Previous studies based on allozyme markers [44], [45] suggested that the genetic diversity of T. carnifex populations is geographically structured into two population groups distributed north and south of the north-central Apennine chain. Thus, both the geographic pattern of distribution and early evidence of population structure suggest that the Plio-Pleistocene evolutionary history of T. carnifex could be unique, not conforming to the scenario inferred for most temperate species along the Italian peninsula, i.e. a (more or less) fragmented glacial range encompassing the Calabrian region (the main refugium in southern Italy) and a postglacial northward expansion along the peninsula (e.g. [21], [46]). Therefore, in this study we carry out phylogenetic, molecular dating and population structure analyses in order to investigate the evolutionary history of this newt. Finally, through a comparison with previous studies of co-distributed species, we put in evidence novel patterns of phylogeographic concordance and their significance for the evolution of regional biotas.

Materials and Methods

Ethics statement

The Italian Ministry of Environment approved all animal procedures in this study, including capture, handling, and tissue sampling (DPN/2D/2003/2267). Since the study did not involve laboratory work on living animals, authorization from the Ministry of Health was not required. Newts were captured with nets at breeding ponds. We collected tissue samples from tail tips, anaesthetizing newts by submerging them in a 0.1% solution of MS222 (3-aminobenzoic acid ethyl ester). Immediately after the completion of the procedure, tissue samples were stored in 96% ethanol and all newts were released at the collection site. No newts were brought to the laboratory and no newts were sacrificed. All sampling took place in public areas and no additional permits or approvals were required for these sites.

Sampling and laboratory procedures

A total of 231 Triturus carnifex individuals were sampled from 37 localities spanning the species' range. Detailed information about sampling localities and number of individuals sampled in each locality are shown in Table 1 and Figure 1C. DNA extraction was performed by following the standard cetyltrimethyl ammonium bromide (CTAB) protocol [47]. Two mitochondrial fragments were amplified and sequenced for all individuals. One fragment comprised part of the NADH dehydrogenase subunit 4 gene and the tRNAHis gene (hereafter referred to as ND4), and the other fragment comprised the NADH dehydrogenase subunit 2 gene (hereafter referred to as ND2). Preliminary amplifications and sequencing of the ND4 fragment were performed using primers ND4 and LEU [48], and then the internal primers ND4carnF1 (ACCCCATTAACAAAAGAAATAGCA) and ND4carnR2 (GTGTTTCATAACTCTTCTTGGTGTG) were designed and used to screen all individuals. Preliminary amplifications and sequencing of the ND2 fragment were performed using primers H5018 and L3780 [49], and then the internal primer TCND2F2 (TCCTTGCTTGAATAGGACTAGAAAT) was designed and used in conjunction with H5018 to screen all individuals.

thumbnail
Download:
Table 1. Geographic location, number of individuals (n) and haplotype composition of the 37 populations sampled of Triturus carnifex.

https://doi.org/10.1371/journal.pone.0041754.t001

Amplifications were performed in a 25 µl volume containing MgCl2 (2.5 mM), reaction buffer (5×, Promega), the four dNTPs (0.2 mM each), the two primers (0.2 µM each), the enzyme Taq polymerase (1 U, Promega) and 2 µl of DNA template. Polymerase chain reaction (PCR) was performed with a step at 95°C for 5 min followed by 30 (ND4) or 35 (ND2) cycles of: 94°C for 1 min, 56°C for 1 min, 72°C for 1 min, and a single final step at 72°C for 10 min. Purification and sequencing of the PCR products were carried out by Macrogen Inc. (www.macrogen.com) by using an ABI PRISM 3700 sequencing system. All sequences were deposited in GenBank (accession numbers: JQ598071–JQ598166).

Data analysis

Electropherograms were visually checked using FinchTv 1.4.0 [50] and aligned using Clustal ×2.0 [51]. MEGA5 [52] was used to analyse sequence variation.

Phylogenetic relationships among T. carnifex haplotypes were inferred using Maximum Likelihood (ML) and Maximum Parsimony (MP) methods. For these analyses, the closely related species T. macedonicus was used as outgroup (GenBank accession number NC015794).

The best-fit model of nucleotide substitution for our dataset was selected among 88 alternative models using the Akaike Information Criterion (AIC, [53]) implemented in jModelTest 0.1.1 [54]. We first analysed the ND4 and ND2 fragments separately, and then combined. TIM1+Γ [55] was the best fit model in all cases. Consequently, the combined dataset (with the gamma distribution shape parameter = 0.10) was used in all subsequent analyses.

ML analyses were performed with PhyML 3.0 [56]. Tree topologies were estimated using the SPR&NNI option, which performs both the available methods (i.e the Nearest Neighbor Interchanges (NNI), and the Subtree Pruning and Regrafting (SPR)) and returns the best solution among the two. MP analysis was computed using PAUP [57], with all characters equally weighted and unordered. A heuristic search was carried out, with tree bisection and reconnection (TBR) branch swapping and 10 rounds of random sequence addition. The robustness of the inferred ML and MP tree topologies was assessed by the non-parametric bootstrap method with 1000 replicates.

Phylogenetic relationships among haplotypes were also inferred by the statistical parsimony procedure for phylogenetic network estimations [58] by using the software TCS 1.2.1 [59].

Time to the most recent common ancestor (TMRCA) of the main mtDNA lineages was estimated by using the distance-based least squares (LS) methods recently described by Xia & Yang [60] and implemented in the software DAMBE [61]. The hypothesis of clock-like evolution of our sequences was assessed by performing a likelihood ratio test in DAMBE. This test did not reject the molecular clock hypothesis for our dataset. To specify a tree topology we used the ML tree previously estimated by PhyML. The divergence between T. carnifex and T. macedonicus was used to set a calibration point. According to Arntzen et al. [62], this divergence was estimated to date back to the end of the Messinian salinity crisis and the consequent reflooding of the Adriatic Sea (5.337 million years ago (Ma)). Finally, to perform the LS analysis in DAMBE we set the ‘softbound’ option and ‘MLCompositeTN93’ genetic distance, as suggested by Xia & Yang [60], along with 1000 bootstrap re-samplings to obtain standard deviations of the time estimates.

To understand how genetic variance was hierarchically distributed among groups, among populations within groups, and within populations, we performed the analysis of molecular variance (AMOVA) by using Arlequin 3.5.1.2 [63]. Groups were defined a priori, according to the main geographic discontinuities in the distribution of genetic variation, as defined by previous phylogenetic analyses. The analysis was run using the Tamura & Nei model (TrN+Γ [64]), which is the best approximation of the TIM1+Γ model available in ARLEQUIN. The significance of the variance components and fixation indices was tested using 10100 permutations.

To assess the occurrence of a significant pattern of isolation-by-distance, the correlation between geographic and genetic distances separating populations was evaluated using Mantel tests with the software ZT [65]. Following suggestions by Rousset [66], geographic distances were log-transformed, and genetic distances were estimated as the mean distances among populations calculated with MEGA by using the TrN+Γ model. Mantel tests were performed for the entire data set and for each main clade defined by previous phylogenetic analyses, along 1000 bootstrap replicates.

Results

For all individuals analysed the ND4 fragment was 638 bp in length, comprising 563 bp of the (3′) NADH dehydrogenase subunit 4 gene and 75 bp of the tRNAHis gene, and the ND2 fragment was 635 bp. The combined dataset (overall 1273 bp) included 128 variable positions, of which 70 were parsimony informative. We did not find indels or stop codons within the coding region of either the ND2 or the ND4 fragments. A total of 49 haplotypes were found in the combined fragment, and their geographic distribution is presented in Table 1.

The tree obtained by the ML method is shown in Figure 1A. The log-likelihood score for the ML tree was −3853.93018. MP analysis yielded 1324 most parsimonious trees of 186 steps in length (consistency index = 0.715; retention index = 0.869). Tree topologies were identical between MP and ML trees at main nodes, with minor differences at some terminal nodes. Three main clades were found, and their geographic distribution among populations is shown in Figure 1C. One clade (referred to as clade N) included only two haplotypes and was geographically restricted to north-eastern samples 36 and 37. The second clade (referred to as clade C) was found among samples from the Padano–Venetian plain and northwestern Apennines (samples 24–35), and the third clade (referred to as clade S) was widespread throughout the reminder of the species' range along the Italian peninsula (samples 1–24). Average Tamura–Nei sequence divergence among the three clades was 0.029 (standard error (SE) 0.006) for the clade pairs N–C and N–S, and 0.021 (0.004 SE) between clades C and S. Co-occurrence among these main clades was observed only in sample 24 (clades C and S). Three main subclades (referred to as CI, CII, and CIII) were observed within clade C, but they showed no clear geographic pattern of distribution (Figure 1 and Table 1). Instead, five subclades within clade S showed a clear geographic association. Subclades SIII, SIV, and SV were restricted in the Calabrian peninsula (samples 5, 3–4, and 1–2, respectively). Subclade SII (samples 6–7) was distributed north of this area to the Volturno–Calore basin. Finally, subclade SI (the most frequent in the dataset) was widespread throughout the remainder of the Italian peninsula. All of the above clades and subclades were supported by high bootstrap values (>70%).

Phylogenetic networks among the haplotypes found are shown in Figure 1B. Under the 95% criterion for a parsimonious connection, three distinct networks were generated (N, C, and S), and they corresponded to the three main clades of the phylogenetic trees. The haplotypes of networks C and S formed three and five subgroups, respectively, clearly corresponding to the subclades yielded by the tree-building methods.

TMRCA estimates for the main mtDNA lineages are shown in the chronogram of Figure 2. The TMRCA for the entire ingroup was estimated to have occurred between the Late Pliocene and Early Pleistocene (2.619±0.426 Ma), and the divergence between clades C and S fell well within the Early Pleistocene (2.049±0.364 Ma). Finally, most of the splits within these clades likely occurred late in the Early Pleistocene.

thumbnail
Download:
Figure 2. Chronogram of the main mtDNA lineeages found in Triturus carnifex.

Chronogram showing the estimated times to the most recent common ancestor (TMRCA) for the main mtDNA lineages of Triturus carnifex. The calibration point (5.337) and the ranges of the main historical epochs on the scale bar are reported in million years. Clades were named as in Figure 1A.

https://doi.org/10.1371/journal.pone.0041754.g002

For the AMOVA analysis the following seven groups were defined (see Figure 1): (1–2), (3–4), (5), (6–7), (8–24), (25–35), (36–37). Since the three subclades found within clade C did not show a clear geographic structure (see above), all individuals carrying haplotypes from clade C were assigned to a single group (25–35). This analysis showed that 70.59% of the overall genetic variance can be attributed to differences between groups, 24.40% to differences among populations within groups, and 5.01% to differences within populations. All the covariance components were highly significant (Table 2).

thumbnail
Download:
Table 2. Summary of the molecular variance analyses, with populations grouped according to the phylogenetic results.

https://doi.org/10.1371/journal.pone.0041754.t002

The Mantel tests performed between genetic distances and log-geographic distances suggested the occurrence of a statistically significant (P<0.01) but weak pattern of isolation by distance, both within the entire dataset (R2 = 0.29) and within the range of clade S (R2 = 0.31). No significant pattern of isolation by distance was detected among the populations of clade C.

Discussion

Our results revealed an unexpected phylogeographic pattern compared with previous studies of the genetic structure among T. carnifex populations. Indeed, analyses of allozyme genetic variation carried out by Scillitani & Picariello [44] and Arntzen [45], consistently identified two main lineages, roughly distributed in northern and peninsular Italy respectively. In addition, the study of the mtDNA variation within the T. cristatus species group by Arntzen et al. [62] identified two main lineages within the range of T. carnifex, one found among samples from peninsular Italy and the other among samples located east and north of the Alpine arc. In contrast, our results revealed the occurrence of three main mtDNA lineages (clades N, C and S; Figure 1), which apparently contrasts with the results of those previous studies. Nevertheless, when the respective sampling schemes are compared, each of those previous studies may have overlooked samples within the range of one of the three lineages. Both allozyme studies were based on samples collected south of the Alpine arc, and thus, lacked samples from the putative range of our clade N, while the study by Arntzen et al. [62] lacked samples from the Padano–Venetian plain, i.e. the putative range of our clade C.

Divergence and secondary contact among main lineages

The divergence among the three lineages was roughly estimated to have occurred from the Plio-Pleistocene boundary to early in the Lower Pleistocene (Figure 2). Palaeoenvironmental changes were profound during this epoch and have been studied intensively in the Mediterranean region [67]–[69]. Climate became cooler and dryer, and the prevailing features of today's climate, including marked seasonality, became established at this time [70]–[75]. Accordingly, pollen spectra and fossil data, indicate substantial changes in the distributions and assemblages of temperate species [69], [70], [76]–[78]. It is likely that T. carnifex experienced major distributional changes during this period, including major fragmentations into three lineages, as suggested by its current genetic structure (our data; [44], [45], [62]), at least under the assumption of niche conservatism.

The phylogeographic breaks found by us among the main lineages of T. carnifex closely match prominent biogeographic discontinuities along the Italian peninsula (see [6]).

The geographic area where lineages C and N have been found in close contiguity falls on the north-eastern side of the Padano–Venetian plain. Although outside this area we did not detect any admixed populations where the two lineages co-occur, the continuous distribution of T. carnifex across this phylogeographic discontinuity strongly suggests the existence of a secondary contact zone between lineages C and N. Interestingly, this geographic area not only marks the range boundaries of many species, but has also been indicated as an effective biogeographical crossroad between the Dinaric and Italian districts for many taxa and as a site of clustering of contact zones and hybrid zones between both intraspecific lineages and closely related species (this study; [3], [49], [79]–[86]).

The southern edge of the lineage C range is delimited by a well-known biogeographic barrier, the northern Apennines. Lineage C extends narrowly to the south at both the eastern and western sides of this mountain area, and at least on the eastern side, it establishes a secondary contact zone with lineage S, as revealed by the co-occurrence of haplotypes from both lineages in our single sample 24. Clusters of species' range edges, phylogeographic breaks, and contact zones along the northern Apennines have similarly been found in several temperate species, including amphibians [87]–[90].

The clustering of phylogeographic breaks, secondary contact zones, and species' range edges identifies both the north-eastern side of the Padano–Venetian plain and the northern Apennines as suture zones (under the extended definition by [91]). This has several significant implications. First, the phylogeographic concordance between the pattern observed in T. carnifex and those previously found in several other species is strong evidence in favour of the historical rather than stochastic origin of the observed discontinuities [92]–[94]. Second, suture zones offer unique opportunities to compare levels and patterns of gene exchange in relation to divergence history and phenotypic evolution of different taxa [3], [95]. In the western Palearctic region, such opportunities have been especially exploited for the northern and central portion of the region (e.g. [3], [81], [96]), whereas limited research has been devoted to cases in the Mediterranean region (but see [7], [10], and references therein). The two zones underscored here are located in key areas of the western Palearctic region and are transitional between peninsular Italy and the continent (northern Apennines), and between the Italian and the Balkan regions (north-eastern side of the Padano–Venetian plain). Thus, future studies in these areas could help to gain deeper insights on the evolutionary history of the Mediterranean hotspot of biodiversity. Finally, because these zones are hotspots of divergence and evolutionary potential, they also merit special consideration with respect to biodiversity conservation (see [16]).

One species, three Pleistocene evolutionary histories I: Northern ‘cryptic’ refugia

The geographic distribution of the three lineages (N, C, and S), their estimated divergence times, and their intra-lineage phylogeographic structures suggest that they have had independent and substantially different evolutionary histories throughout most of the Pleistocene.

Lineage N was observed only at the easternmost portion of the species range (sites 36–37). This observation is also confirmed by a comparison of previously published sequence data [97], [98] with our data. In fact, when our haplotypes N1 and N2 are compared with the more eastern and southern samples from these previous studies (one sequence from Sinac, Croatia and one sequence from Kramplje, Slovenia; Genbank accessions: GQ258936, GQ258952; GU982385, GU982459), average sequence divergence never exceeded 0.009, that is well below the value we found among haplotypes belonging to clades C and N (0.021, 0.004 SE; data available upon request). Although more samples east of the Alpine chain clearly will be needed before inferring the Pleistocene evolutionary history of lineage N, data currently available suggest long-term isolation of this lineage in western Croatia/Slovenia. The occurrence of lineage C in the Padano–Venetian plain, T. macedonicus in the Balkans, T. cristatus in central Europe, and T. dobrogicus in eastern Europe (see [36]), make neighbouring areas, including the Italian and the Balkan peninsulas, less plausible as long-term refugia for this lineage. Multiple lines of evidence suggest the existence of northern (cryptic) refugia for temperate species [2], [31], areas of sheltered topography that provided suitable microclimates for the survival of thermophilous species outside the traditional southern peninsular refugia. This hypothesis has recently received support from several phylogeographic studies of various temperate organisms, including plants and animals (see [2] for a review). In the western Croatia/Slovenia area, the occurrence of ancient and divergent lineages of T. carnifex echoes previous findings from several phylogeographic, palaeobotanical and palaeoclimatic studies [84], [99]–[101], thus indicating the prominent contribution of this northern refugium to the present-day genetic pools of many temperate species.

One species, three Pleistocene evolutionary histories II: ‘Refugia-between-refugia’

The occurrence of clade C in the Padano–Venetian plain and its deep divergence with clades N and S provide strong evidence in support of a long-term persistence of this lineage in this area and suggest that the Padano–Venetian plain could have acted as a long-term refugium for T. carnifex over multiple Pleistocene glaciations. The occurrence of closely related lineages around the range of the Padano–Venetian lineage would disprove the alternative hypothesis of a recent (re)colonization of this region from neighbouring areas, including north and west of the Alpine arc and the eastern coast of the Adriatic Sea, i.e. the distribution areas of the closely related species T. cristatus and T. macedonicus. Palaeogeographic, sedimentological, and palaeontological (fossil and pollen) data have shown that following the south-eastern widening of the Padano–Venetian plain due to glaciation-induced marine regressions [102]–[104], a vast alluvial plain environment was established in this area [105]. This provided a paleoenvironmental scenario suitable for the survival of temperate species, particularly amphibians, even during Pleistocene glacial phases. Considering that lineage C showed a lack of geographic structure and that the highest genetic diversity of this lineage occurs along the eastern edge of its range, survival of this lineage in coastal or peri-coastal portion of the Padano–Venetian plain throughout the Pleistocene appears particularly plausible. A similar scenario was hypothesized previously on the basis of phylogeographic data for two other temperate amphibians, the Italian tree frog, Hyla intermedia [88], and the pool frog, Pelophylax lessonae [89]. Interestingly, this phylogeographic concordance, indicating long-term survival of essentially thermophilic taxa within the Padano–Venetian plain, suggests that a major glacial refugium for Mediterranean biodiversity just between the well-known Apennine and Balkan refugia could have passed mostly unseen for a long time. The post-glacial reflooding of the south-eastern portion of the Padano–Venetian plain likely erased most of the genetic imprints of such a refugial range in many species. Nevertheless, with an appropriate sampling scheme, such imprints could still be found in other species. This issue merits further research, even considering the growing interest in peri-coastal lowlands as glacial refugia and biodiversity hotspots in many regions worldwide (see [19], and literature therein).

One species, three Pleistocene evolutionary histories III: Multiple refugia in peninsular Italy

In contrast to the northern lineages, lineage S showed a clear phylogeographic structure with five main subclades. Three of these subclades (SIII, SIV, and SV) occurred in the northern and central portions of the Calabrian peninsula, an area documented as a major hotspot of intraspecific biodiversity and as a site of multiple refugia for an increasing number of species [10], [11], [21], [43], [46], [88], [89], [106]–[108]. The other two subclades (SI and SII) occurred along the remainder of the Italian peninsula. The phylogeographic discontinuities between these latter subclades are located near the Volturno–Calore river drainage basin, another area of clustering of phylogeographic breaks and secondary contact zones for several species and intraspecific lineages (e.g. [46], [108], [109]). For both the Calabrian and the Volturno–Calore areas, glacio-eustatic sea-level oscillations throughout the Pleistocene and consequent insularization of southern Italy during multiple interglacial transgressions have been indicated as the most likely source of historical barriers to the dispersal of terrestrial fauna [10], [11], [21], [88], [106]. According to ecological and phylogenetic studies no evidence exists to support a sea crossing, even of modest distance, by this species or its close relatives. Thus, a scenario of palaeoinsularization as the source of the observed phylogeographic pattern appears plausible for T. carnifex.

The occurrence of five genetically divergent and geographically separated sub-clades within lineage S and the clustering of their estimated divergence times early in the Middle Pleistocene (Figure 2) suggest that the species survived most of the Pleistocene climatic oscillations within multiple separate refugia. This pattern is emerging in an increasing number of temperate species from the Italian peninsula [10], [11], [21], [43], [46], [88], [89], [106]–[108]. Nevertheless, contrary to most species studied to date, T. carnifex is currently absent from the south-central and southern portion of the Calabrian region, the hotspot of genetic diversity and the area richest in distinct refugia and divergent lineages in most of the studied species. Furthermore, contrary to findings from these previous studies, the ancient derivation of subclade SI (about 1 My; see Figure 2) suggests a long-term refugium in the northern portion of the peninsula rather than a post-glacial recolonization of this area from the south (see also [88]). Interestingly, recent updates of palaeoenvironmental data for the north-western peninsula (particularly the Arno river basin) indicate the presence of areas of prolonged ecological stability along the coastal plains [110], which could have acted as a glacial refugium for both plant and animal temperate species (see also [20], [88], [110]).

Conclusions

The growing number of phylogeographic studies concerning the western Palaearctic region shows that the species' responses to Pleistocene climatic oscillations can be surprisingly diverse. The Italian crested newt, Triturus carnifex, exemplifies several of these species' responses. Multiple sources of evidence suggest that the three main lineages of this species have had substantially independent evolutionary histories in three distinct geographic districts throughout the Pleistocene, showing differential responses to Quaternary climate oscillations. Such responses encompass survival in a northern cryptic refugium (lineage N) and in peri-costal refugia (lineage C and sublineage SI), as well as in multiple refugia spanning most of the Italian peninsula (lineage S). These different regional responses also suggest diverse historical demographic trends for each lineage, which merit further investigation by using multi-locus data including information from variable regions of the nuclear genome. In addition, although different regional responses may be attributable primarily to the availability of suitable habitat through time associated with physiographic features and palaeogeographical histories, they may also be due to differences in lineage ecologies, which affect individualistic reactions to local factors [111], [112]. The development of lineage-specific ecological niche models will allow testing of whether distinct evolutionary lineages within this species have different niche associations and thus, unique responses to past and future climatic shifts [112].

The finding of three ancient and independent evolutionary units within the Italian crested newt also has important conservation implications. This species is currently listed as Least Concern on the International Union for Conservation of Nature (IUCN) Red list of Threatened Species ‘in view of its wide distribution, tolerance of a broad range of habitats, presumed large population’ [113]. However, our results do not fit this assessment and suggest that the three lineages should be considered distinct conservation units (ESUs; sensu [114]). Furthermore, lineage S appears fragmented into several population units of historical derivation that should be considered demographically independent (see [94]) for management purposes also (MUs; sensu [114]).

Finally, the importance of an appropriate sampling design in phylogeographic studies has been emphasized recently, and for temperate species of the western Palearctic special attention has been given to the southern portion of the species' ranges [7], [11], [15], [81]. The case of T. carnifex presented here reinforces this claim, and indicates substantial variation in the southern range of the species that would have passed unseen otherwise. This study also clearly shows that northern portions of peninsular species' ranges cannot be overlooked when developing sampling strategies, especially when our data are compared to those of previous assessments of genetic variation in this species.

Acknowledgments

We are grateful to Giorgio Tabirri for help in the laboratory work, to Ben Wielstra for kind discussions and to Alessio Capoccia, Anna Loy, Cristiano Liuzzi, David Fiacchini, Edoardo Razzetti, Lucio Bonato, Francesco Ficetola, Niki Morganti, Gaetano Aloise, Roberta Bisconti, Francesco P. Caputo, Paolo Cipriani, Valeria Pasqualini and Sebastiano Salvidio for the help in samples collection.

Author Contributions

Conceived and designed the experiments: DC DS. Performed the experiments: DS MM. Analyzed the data: DC DS MM. Contributed reagents/materials/analysis tools: DC GN MAB. Wrote the paper: DC DS MM MAB GN.

References

  1. 1. Waltari E, Hijmans RJ, Peterson AT (2007) Locating Pleistocene Refugia: Comparing Phylogeographic and Ecological Niche Model Predictions. PLoS ONE 2: 563.
  2. 2. Stewart JR, Lister AM, Barnes I, Dalén L (2010) Refugia revisited: individualistic responses of species in space and time. Proc R Soc B 77: 661–671.
  3. 3. Hewitt GM (2011a) Quaternary phylogeography: the roots to hybrid zones. Genetica 139: 617–638.
  4. 4. Keppel G, Van Niel KP, Wardell-Johnson GW, Yates CJ, Byrne M, et al. (2012) Refugia: identifying and understanding safe havens for biodiversity under climate change. Global Ecol Biogeogr 21: 393–404.
  5. 5. Hewitt GM (2004) Genetic consequences of climatic oscillations in the Quaternary. Philos T Roy Soc B 359: 183–195.
  6. 6. Hewitt GM (2011b) Mediterranean Peninsulas—the evolution of hotspots. In: Biodiversity hotspots. Zachos FE, Habel JC, editors. Heidelberg: Springer. 123–147.
    • 7. Gómez A, Lunt DH (2007) Refugia within refugia: patterns of phylogeographic concordance in the Iberian Peninsula. In: Phylogeography in Southern European Refugia: Evolutionary Perspectives on the origins and conservation of European Biodiversity. Weiss S, Ferrand N, editors. Dordrecht: Springer Verlag. 155–188.
      • 8. Byrne M, Yeates DK, Joseph L, Kearney M, Bowler J, et al. (2008) Birth of a biome: insights into the assembly and maintenance of the Australian arid zone biota. Mol Ecol 17: 4398–4417.
      • 9. Wang J, Gao P, Kang M, Lowe AJ, Huang H (2009) Refugia within refugia: the case study of a canopy tree (Eurycorymbus cavaleriei) in subtropical China. J Biogeogr 36: 2156–2164.
      • 10. Canestrelli D, Aloise G, Cecchetti S, Nascetti G (2010) Birth of a hotspot of intraspecific genetic diversity: notes from the underground. Mol Ecol 9: 5432–5451.
      • 11. Canestrelli D, Sacco F, Nascetti G (2012) On glacial refugia, genetic diversity and microevolutionary processes: deep phylogeographic structure in the endemic newt Lissotriton italicus. Biol J Linn Soc 105: 42–55.
      • 12. Shafer ABA, Cullingham CI, Côté SD, Coltman DW (2010) Of glaciers and refugia: a decade of study sheds new light on the phylogeography of northwestern North America. Mol Ecol 19: 4589–4621.
      • 13. Whitham TG, Bailey JK, Schweitzer JA, Shuster SM, Bangert RK, et al. (2006) A framework for community and ecosystem genetics: from genes to ecosystems. Nat Rev Genet 7: 510–523.
      • 14. Hughes AR, Inouye BD, Johnson MTJ, Underwood N, Vellend M (2008) Ecological consequences of genetic diversity. Ecol Lett 11: 609–623.
      • 15. Hampe A, Petit RJ (2005) Conserving biodiversity under climate change: the rear edge matters. Ecol Lett 8: 461–467.
      • 16. Vandergast AG, Bohonak AJ, Hathaway SA, Boys J, Fisher RN (2008) Are hotspots of evolutionary potential adequately protected in southern California? Biol Conserv 141: 1648–1664.
      • 17. Burns EM, Eldridge MDB, Crayn DM (2007) Low phylogeographic structure in a wide spread endangered Australian frog Litoria aurea (Anura: Hylidae). Conserv Genet 8: 17–32.
      • 18. Marske KA, Leschen RAB, Barker GM (2009) Phylogeography and ecological niche modelling implicate coastal refugia and trans-alpine dispersal of a New Zealand fungus beetle. Mol Ecol 18: 5126–5142.
      • 19. Bisconti R, Canestrelli D, Nascetti G (2011) Multiple lines of evidence for demographic and range expansion of a temperate species (Hyla sarda) during the last glaciation. Mol Ecol 20: 5313–5327.
      • 20. Porretta D, Canestrelli D, Urbanelli S (2011) Southern crossroads of the Western Palaearctic during the Late Pleistocene and their imprints on current patterns of genetic diversity: insights from the mosquito Aedes caspius. J Biogeogr 38: 20–30.
      • 21. Canestrelli D, Cimmaruta R, Costantini V, Nascetti G (2006) Genetic diversity and phylogeography of the Apennine yellow-bellied toad Bombina pachypus, with implications for conservation. Mol Ecol 15: 3741–3754.
      • 22. Larmuseau MHD, Van Houdt JKJ, Guelinckx J, Hellemans B, Volckaert FAM (2009) Distributional and demographic consequences of Pleistocene climate fluctuations for a marine demersal fish in the north-eastern Atlantic. J Biogeogr 36: 1138–1151.
      • 23. Provan J, Maggs CA (2011) Unique genetic variation at a species' rear edge is under threat from global climate change. Proc R Soc B 279: 39–47.
      • 24. Recuero E, García-París M (2011) Evolutionary history of Lissotriton helveticus: Multilocus assessment of ancestral vs recent colonization of the Iberian Peninsula. Mol Phylogenet Evol 60: 170–182.
      • 25. Araujo MB, Thuiller W, Pearson RG (2006) Climate warming and the decline of amphibians and reptiles in Europe. J Biogeogr 33: 1712–1728.
      • 26. Parmesan C (2006) Ecological and evolutionary responses to recent climate change. Ann Rev Ecol Evol Syst 37: 637–669.
      • 27. Petit RJ, Hampe A, Cheddadi R (2005) Climate changes and tree phylogeography in the Mediterranean. Taxon 54: 877–885.
      • 28. Nieto Feliner G (2011) Southern European glacial refugia: A tale of tales. Taxon 60: 365–372.
      • 29. Gonçalves H, Martínez-Solano I, Pereira R, Carvalho B, García-París M, et al. (2009) High levels of population subdivision in a morphologically conserved Mediterra nean toad (Alytes cisternasii) result from recent, multiple refugia: evidence from mtDNA, microsatellites and nuclear genealogies. Mol Ecol 18: 5143–5160.
      • 30. Previšić A, Walton C, Kučinić M, Mitrikeski PT, Kerovec M (2009) Pleistocene divergence of Dinaric Drusus endemics (Trichoptera, Limnephilidae) in multiple microrefugia within the Balkan Peninsula. Mol Ecol 18: 634–647.
      • 31. Stewart JR, Lister AM (2001) Cryptic northern refugia and the origins of modern biota. Trends Ecol Evol 16: 608–613.
      • 32. Ursenbacher S, Conelli A, Golay P, Monney JC, ZuYe MAL, et al. (2006) Phylogeography of the asp viper (Vipera aspis) inferred from mitochondrial DNA sequence data: evidence for multiple Mediterranean refugial areas. Mol Phylogenet Evol 38: 546–552.
      • 33. Maggs CA, Castilho R, Foltz D (2008) Evaluating signatures of glacial refugia for North Atlantic benthic marine taxa. Ecology 89: S108–S122.
      • 34. Rull V (2009) Microrefugia. J Biogeogr 36: 481–484.
      • 35. Schneeweiss GM, Schönswetter P (2011) A re-appraisal of nunatak survival in arctic-alpine phylogeography. Mol Ecol 20: 190–192.
      • 36. Jehle R, Thiesmeier B, Foster J (2011) The Crested Newt. A Dwilling Pond-Dweller. Bielefeld: Laurenti Verlag 152.
      • 37. Andreone F, Marconi M (2006) Triturus carnifex. In: Atlante degli anfibi e dei rettili d'Italia/Atlas of Italian Amphibians and Reptiles. Sindaco R, Doria G, Razzetti E, Bernini F, editors. Firenze: Societas Herpetologica Italica, Edizioni Polistampa. 220–225.
        • 38. Giacoma C, Picariello O, Puntello D, Rossi F, Tripepi S (1988) The distribution and habitats of the newt (Triturus, Amphibia) in Calabria (southern Italy). Monit Zool Ital N S 22: 449–464.
        • 39. Pavignano I, Giacoma C, Castellano S (1990) A multivariate analysis of habitat determinants for T. vulgaris and T. carnifex in North Western Italy. Alytes 7: 77–124.
        • 40. Ficetola GF, De Bernardi F (2004) Amphibians in an human-dominated landscape: the community structure is related to habitat features and isolation. Biol Conserv 119: 219–230.
        • 41. Arntzen JW, Wallis GP (1991) Restricted gene flow in a moving hybrid zone of the newts Triturus cristatus and T. marmoratus in western France. Evolution 45: 805–826.
        • 42. Schabetsberger R, Jehle R, Maletzky A, Pesta J, Sztatecsny M (2004) Delineation of terrestrial reserves for amphibians: post-breeding migrations of Italian crested newts (Triturus c. carnifex) at high altitude. Biol Conserv 117: 95–104.
        • 43. Vega R, Amori G, Aloise G (2010) Genetic and morphological variation in a Mediterranean glacial refugium: evidence from Italian pygmy shrews, Sorex minutus (Mammalia: Soricomorpha). Biol J Linn Soc 100: 774–787.
        • 44. Scillitani G, Picariello O (2000) Genetic variation and its causes in the crested newt, Triturus carnifex (Laurenti, 1768), from Italy (Caudata: Salamandridae). Herpetologica 56: 119–130.
        • 45. Arntzen JW (2001) Genetic variation in the Italian crested newt, Triturus carnifex, and the origin of a non-native population north of the Alps. Biodivers Conserv 10: 971–987.
        • 46. Canestrelli D, Cimmaruta R, Nascetti G (2008) Population genetic structure and diversity of the Apennine endemicstream frog, Rana italica – insights on the Pleistocene evolutionary history of the Italian peninsular biota. Mol Ecol 17: 3856–3872.
        • 47. Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19: 11–15.
        • 48. Arévalo E, Davis SK, Sites JW (1994) Mitochondrial DNA sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus grammicus complex (Phrynosomatidae) in central Mexico. Syst Biol 43: 387–418.
        • 49. Babik W, Branicki W, Crnobrnja-Isaloviç J (2005) Phylogeography of two European newt species — discordance between mtDNA and morphology. Mol Ecol 14: 2475–2491.
        • 50. Geospiza Inc Finch TV, version 140 Geospiza, Inc, Seattle, WA.
          • 51. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettiga PA, et al. (2007) Clustal W and Clustal X version 20. Bioinformatics 23: 2947–2948.
          • 52. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, et al. (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol Biol Evol 28: 2731–2739.
          • 53. Akaike H (1973) Information theory and an extension of the maximum likelihood principle. In: Second International Symposium on Information Theory. Petrov BN, Csaki F, editors. Budapest: Akademiai Kiado. 267–281.
            • 54. Posada D (2008) jModelTest: Phylogenetic Model Averaging. Mol Biol Evol 25: 1253–1256.
            • 55. Posada D (2003) Using Modeltest and PAUP* to select a model of nucleotide substitution. In: Current Protocols in Bioinformatics. Baxevanis AD, Davison DB, Page RDM, Petsko GA, Stein LD, Stormo GD, editors. New York: John Wiley & Sons. 6.5.1–6.5.14.
              • 56. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, et al. (2010) New Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 30. Syst Biol 59: 307–21.
              • 57. Swofford DL (2003) PAUP* Phylogenetic Analysis Using Parsimony (*and Other Methods) Version 4.
                • 58. Templeton AR, Crandall KA, Sing CF (1992) A cladistic analysis of phenotypic associations with haplotypes inferred from restriction endonuclease mapping and DNA sequence data III Cladogram estimation. Genetics 132: 619–633.
                • 59. Clement M, Posada D, Crandall KA (2000) Tcs: a computer program to estimate gene genealogies. Mol Ecol 9: 1657–1660.
                • 60. Xia X, Yang Q (2011) A distance-based least-square method for dating speciation events. Mol Phylogenet Evol 59: 342–353.
                • 61. Xia X, Xie Z (2001) DAMBE: Data analysis in molecular biology and evolution. J Hered 92: 371–373.
                • 62. Arntzen JW, Espregueira Themudo G, Wielstra B (2007) The phylogeny of crested newts (Triturus cristatus superspecies): nuclear and mitochondrial genetic characters suggest a hard polytomy, in line with the paleogeography of the centre of origin. Contr Zool 76: 261–278.
                • 63. Excoffier LG, Schneider S (2005) Arlequin (version 30): An integrated software package for population genetics data analysis. Evol Bioinform Online 1: 47–50.
                • 64. Tamura K, Nei M (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 10: 512–526.
                • 65. Bonnet E, Van de Peer Y (2002) Zt: a software tool for simple and partial Mantel tests. J Stat Softw 7: 1–12.
                • 66. Rousset F (1997) Genetic differentiation and estimation of gene flow from F-statistics under isolation by distance. Genetics 145: 1219–1228.
                • 67. Thompson JD (2005) Plant evolution in the Mediterranean. New York: Oxford University Press. 304.
                  • 68. Blondel J, Aronson J, Bodiou JY, Boeuf G (2010) The Mediterranean region: biological diversity in space and time. New York: 2nd edn Oxford University Press. 376.
                    • 69. Kahlke RD, García N, Kostopoulos DS, Lacombat F, Lister AM, et al. (2011) Western Palaearctic palaeoenvironmental conditions during the Early and early Middle Pleistocene inferred from large mammal communities, and implications for hominin dispersal in Europe. Quat Sci Rev 30: 1368–1395.
                    • 70. Suc JP (1984) Origin and evolution of the Mediterranean vegetation and climate in Europe. Nature 307: 429–432.
                    • 71. Bertoldi R, Rio D, Thunell R (1989) Pliocene-pleistocene vegetational and climatic evolution of the south-central Mediterranean. Palaeogeogr Palaeoclimatol Palaeoecol 72: 263–275.
                    • 72. Combourieu-Nebout N, Vergnaud Grazzini C (1991) Late Pliocene northern hemisphere glaciation: the continental and marine responses in the central Mediterranean. Quat Sci Rev 10: 319–334.
                    • 73. Zachos J, Pagani M, Sloan L, Thomas E, Billups K (2001) Trends, rhythms, and aberrations in global climate 65 Ma to present. Science 292: 686–693.
                    • 74. Klotz S, Fauquette S, Combourieu-Nebout N, Uhl D, Suc JP, et al. (2006) Seasonality intensification and long-term winter cooling as part of the Late Pliocene climate development. Earth Planet Sc Lett 241: 174–187.
                    • 75. Joannin S, Quillévéré F, Suc JP, Lécuyer C, Martineau F (2007) Early Pleistocene climate changes in the central Mediterranean region as inferred from integrated pollen and planktonic foraminiferal stable isotope analyses. Quaternary Res 67: 264–274.
                    • 76. Bertini A (2003) Early to Middle Pleistocene changes of the Italian Flora and vegetation in the light of a chronostratigraphic framework. Il Quaternario, Ital J Quaternary Sci 16: 19–36.
                    • 77. Kostopoulos DS, Palombo MR, Alberdi MT, Valli AMF (2007) Pliocene to Pleistocene large mammal diversity and turnover in North Mediterranean region: the Greek Peninsula with respect to the Iberian and Italian ones. Geodiversitas 29: 401–419.
                    • 78. Bertini A (2010) Pliocene to Pleistocene palynoflora and vegetation in Italy: state of the art. Quatern Intern 225: 5–24.
                    • 79. Amann T, Rykena S, Joger U, Nettmann HK, Veith M (1997) Zur artlichen Trennung von Lacerta bilineata Daudin, 1802 und L viridis (Laurenti, 1768). Salamandra 33: 255–268.
                    • 80. Santucci F, Emerson BC, Hewitt GM (1998) Mitochondrial DNA phylogeography of European Hedgehogs. Mol Ecol 7: 1163–1172.
                    • 81. Taberlet P, Fumagalli L, Wust-Saucy AG, Cossons JF (1998) Comparative phylogeography and post-glacial colonization routes in Europe. Mol Ecol 7: 453–464.
                    • 82. Hewitt GM (1999) Postglacial re-colonization of European biota. Biol J Linn Soc 68: 78–112.
                    • 83. Zeisset I, Beebee TJC (2001) Determination of biogeographical range: an application of molecular phylogeography to the European pool frog Rana lessonae. Proc R Soc B 268: 933–938.
                    • 84. Magri D, Vendramin GG, Comps B, Dupanloup I, Geburek T, et al. (2006) A new scenario for the Quaternary history of European beech populations: palaeobotanical evidence and genetic consequences. New Phytol 171: 199–221.
                    • 85. Audisio P, Brustel H, Carpaneto GM, Coletti G, Mancini E, et al. (2009) Data on molecular taxonomy and genetic diversification of the European Hermit beetles, a species complex of endangered insects (Coleoptera: Scarabaeidae, Cetoniinae, Osmoderma). J Zool Syst Evol Res 47: 88–95.
                    • 86. Verardi A, Canestrelli D, Nascetti G (2009) Nuclear and mitochondrial patterns of introgression between the parapatric European treefrogs Hyla arborea and H intermedia. Ann Zool Fenn 46: 247–258.
                    • 87. Di Giovanni MV, Vlach MR, Giangiuliani G, Goretti E, Torricelli R (1998) Genetic analysis of the species of Sigara s str (Heteroptera, Corixidae) in the Italian Peninsula. Ita J Zool 65: 393–397.
                    • 88. Canestrelli D, Cimmaruta R, Nascetti G (2007) Phylogeography and historical demography of the Italian treefrog Hyla intermedia reveals multiple refugia, population expansions and secondary contacts within peninsular Italy. Mol Ecol 16: 4808–4821.
                    • 89. Canestrelli D, Nascetti G (2008) Phylogeography of thepool frog Rana (Pelophylax) lessonae in the Italian peninsula and Sicily: multiple refugia, glacial expansions and nuclear–mitochondrial discordance. J Biogeogr 35: 1923–1936.
                    • 90. Stefani F, Galli P, Crosa G, Zaccara S, Calamari D (2004) Alpine and Apennine barriers determining the differentiation of the rudd (Scardinius erythrophthalmus L) in the Italian peninsula. Ecol Freshw Fish 13: 168–175.
                    • 91. Swenson NG, Howard DJ (2005) Clustering of contact zones, hybrid zones, and phylogeographic breaks in North America. Am Nat 166: 581–591.
                    • 92. Irwin DE (2002) Phylogeographic breaks without geographic barriers to gene flow. Evolution 56: 2383–2394.
                    • 93. Kuo CH, Avise JC (2005) Phylogeographic breaks in low dispersal species: the emergence of concordance across gene trees. Genetica 124: 179–186.
                    • 94. Avise JC (2008) Phylogeography: retrospect and prospect. J Biogeogr 36: 3–15.
                    • 95. Moritz C, Hoskin CJ, MacKenzie JB, Phillips BL, Tonione M (2009) Identification and dynamics of a cryptic suture zone in tropical rainforest. Proc R Soc B 276: 1235–44.
                    • 96. Petit RJ, Aguinagalde I, De Beaulieu JL, Bittkau C, Brewer S, et al. (2003) Glacial refugia: hotspots but not melting pots of genetic diversity. Science 300: 1563–1565.
                    • 97. Themudo GE, Wiestra B, Arntzen JW (2009) Multiple nuclear and mitochondria genes resolve the branching order of a rapid radiation of crested newts (Triturus, Salamandridae). Mol Phylogenet Evol 52: 321–328.
                    • 98. Wielstra B, Espregueira Themudo G, Güclü Ö, Olgun K, Poyarkov NA, et al. (2010) Cryptic crested newt diversity at the Eurasian transition: The mitochondrial DNA phylogeography of Near Eastern Triturus newts. Mol Phylogenet Evol 56: 888–896.
                    • 99. Barron EJ, Pollard D (2002) High-resolution climate simulations of Oxygen Isotope Stage 3 in Europe. Quaternary Res 58: 296–309.
                    • 100. Willis KJ, Van Andel T (2004) Trees or no trees? The environments of central and eastern Europe during the Last Glaciation. Quaternary Sci Rev 23: 2369–2387.
                    • 101. Magri D (2008) Patterns of post-glacial spread and the extent of glacial refugia of European beech (Fagus sylvatica). J Biogeogr 35: 450–463.
                    • 102. Corregiari A, Roveri M, Trincardi F (1996) Late Pleistocene and Holocene evolution of the North Adriatic Sea. Il Quaternario, Ital J Quaternary Sci 9: 697–704.
                    • 103. Amorosi A, Cotalongo ML, Fusco F (1999) Gladio-eustatic control of continental-shallow marine cyclicity from Late Quaternary deposits of the southeastern Po plain, northern Italy. Quaternary Res 52: 1–13.
                    • 104. Garzanti E, Vezzoli G, Andò S (2011) Paleogeographic and paleodrainage changes during Pleistocene glaciations (Po Plain, Northern Italy). Earth-Sci Rev 105: 25–48.
                    • 105. Amorosi A, Colalongo ML, Fiornini F (2004) Palaeogeographic and palaeoclimatic evolution of the Po plain from 150-ky core records. Global Planet Change 40: 55–78.
                    • 106. Santucci F, Nascetti G, Bullini L (1996) Hybrid zones between two genetically differentiated forms of the pond frog Rana lessonae in southern Italy. J Evol Biol 9: 429–450.
                    • 107. Podnar M, Mayer W, Tvrtković N (2005) Phylogeography of the Italian wall lizard, Podarcis sicula, as revealed by mitochondrial DNA sequences. Mol Ecol 14: 575–588.
                    • 108. Barbanera F, Zuffi MA, Guerrini M (2009) Molecular phylogeography of the asp viper Vipera aspis (Linnaeus, 1758) in Italy: evidence for introgressive hybridization and mitochondrial DNA capture. Mol Phylogenet Evol 52: 103–114.
                    • 109. Nascetti G, Zangari F, Canestrelli D (2005) The spectacled salamanders, Salamandrina terdigitata Lacépède, 1788 and S. perspicillata Savi, 1821: genetic differentiation and evolutionary history. Rend. Fis. Acc. Lincei 16: 159–169.
                    • 110. Ricci-Lucchi M (2008) Vegetation dynamics during the last Interglacial–Glacial cycle in the Arno coastal plain (Tuscany, western Italy): location of a new tree refuge. Quaternary Sci Rev 27: 2456–2466.
                    • 111. Stewart JR (2009) The evolutionary consequence of the individualistic response to climate change. J Evol Biol 22: 2363–2375.
                    • 112. Hornsby AD, Matocq MD (2012) Differential regional response of the bushy-tailed woodrat (Neotoma cinerea) to late Quaternary climate change. J Biogeogr 39: 289–305.
                    • 113. IUCN (2011) IUCN Red List of Threatened Species Version 20112 IUCN, Cambridge, UK. Available: http://wwwiucnredlistorg. Accessed 2012 Mar 30.
                      • 114. Moritz C (1994) Defining “Evolutionarily Significant Units” for conservation. Trends Ecol Evol 9: 373–375.