Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Full-Exon Pyrosequencing Screening of BRCA Germline Mutations in Mexican Women with Inherited Breast and Ovarian Cancer

  • Felipe Vaca-Paniagua,

    Affiliations Laboratorio de Genómica, Instituto Nacional de Cancerología, Tlalpan, México, Unidad de Genómica y Secuenciación Masiva (UGESEM), Instituto Nacional de Cancerología, Tlalpan, México

  • Rosa María Alvarez-Gomez,

    Affiliation Unidad de Genómica y Secuenciación Masiva (UGESEM), Instituto Nacional de Cancerología, Tlalpan, México

  • Verónica Fragoso-Ontiveros,

    Affiliations Laboratorio de Genómica, Instituto Nacional de Cancerología, Tlalpan, México, Unidad de Genómica y Secuenciación Masiva (UGESEM), Instituto Nacional de Cancerología, Tlalpan, México

  • Silvia Vidal-Millan,

    Affiliation Clínica de Genética, Instituto Nacional de Cancerología, Tlalpan, México

  • Luis Alonso Herrera,

    Affiliation Unidad de Investigaciones Biomédicas en Cáncer, Instituto Nacional de Cancerología, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México (UNAM), Tlalpan, México

  • David Cantú,

    Affiliation Departamento de Oncología Médica, Instituto Nacional de Cancerología, Tlalpan, México

  • Enrique Bargallo-Rocha,

    Affiliation Departamento de Oncología Médica, Instituto Nacional de Cancerología, Tlalpan, México

  • Alejandro Mohar,

    Affiliation Unidad de Investigaciones Biomédicas en Cáncer, Instituto Nacional de Cancerología, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México (UNAM), Tlalpan, México

  • César López-Camarillo,

    Affiliation Posgrado en Ciencias Genómicas, UACM, Benito Juarez, México

  • Carlos Pérez-Plasencia

    carlos.pplas@gmail.com

    Affiliations Laboratorio de Genómica, Instituto Nacional de Cancerología, Tlalpan, México, Unidad de Genómica y Secuenciación Masiva (UGESEM), Instituto Nacional de Cancerología, Tlalpan, México, Unidad de Biomedicina, FES-IZTACALA, UNAM, Tlalnepantla, México

Full-Exon Pyrosequencing Screening of BRCA Germline Mutations in Mexican Women with Inherited Breast and Ovarian Cancer

  • Felipe Vaca-Paniagua, 
  • Rosa María Alvarez-Gomez, 
  • Verónica Fragoso-Ontiveros, 
  • Silvia Vidal-Millan, 
  • Luis Alonso Herrera, 
  • David Cantú, 
  • Enrique Bargallo-Rocha, 
  • Alejandro Mohar, 
  • César López-Camarillo, 
  • Carlos Pérez-Plasencia
PLOS
x

Abstract

Hereditary breast cancer comprises 10% of all breast cancers. The most prevalent genes causing this pathology are BRCA1 and BRCA2 (breast cancer early onset 1 and 2), which also predispose to other cancers. Despite the outstanding relevance of genetic screening of BRCA deleterious variants in patients with a history of familial cancer, this practice is not common in Latin American public institutions. In this work we assessed mutations in the entire exonic and splice-site regions of BRCA in 39 patients with breast and ovarian cancer and with familial history of breast cancer or with clinical features suggestive for BRCA mutations by massive parallel pyrosequencing. First we evaluated the method with controls and found 41–485 reads per sequence in BRCA pathogenic mutations. Negative controls did not show deleterious variants, confirming the suitability of the approach. In patients diagnosed with cancer we found 4 novel deleterious mutations (c.2805_2808delAGAT and c.3124_3133delAGCAATATTA in BRCA1; c.2639_2640delTG and c.5114_5117delTAAA in BRCA2). The prevalence of BRCA mutations in these patients was 10.2%. Moreover, we discovered 16 variants with unknown clinical significance (11 in exons and 5 in introns); 4 were predicted as possibly pathogenic by in silico analyses, and 3 have not been described previously. This study illustrates how massive pyrosequencing technology can be applied to screen for BRCA mutations in the whole exonic and splice regions in patients with suspected BRCA-related cancers. This is the first effort to analyse the mutational status of BRCA genes on a Mexican-mestizo population by means of pyrosequencing.

Introduction

About 10% of all breast cancers are of monogenic origin [1]. The most prevalent entity is Hereditary Breast and Ovarian Cancer (HBOC), an autosomal dominant disease with incomplete penetrance. The two high-penetrance genes most commonly mutated in HBOC are the tumor suppressor genes BRCA1 and BRCA2 (breast cancer, early onset 1 and 2). The BRCA1 gene, localized at 17q21, and BRCA2, at 13q12, have long coding sequences (5589 and 10254 nt for BRCA1 and BRCA2, respectively) and are essential components of the double-strand break repair by homologous recombination system [2]. Almost 3500 deleterious mutations in these genes have been found in all the coding sequence [3]. Furthermore BRCA1 and BRCA2 mutation carriers are also at increased risk of fallopian tubes, pancreatic, prostate and endometrial cancer [4][6].

The molecular diagnosis of mutations in BRCA genes implies high degree of clinical suspicion based principally in history of familial BRCA-related cancers in first- or second-degree relatives, age of presentation and tumor characteristics (morphological, immunohistochemical and molecular features) [7]. For patients with a BRCA mutation, current clinical alternatives include breast and ovarian screening, prophylactic surgery, and chemoprevention [8]. The approach extends to their family in order to identify other members at risk to allow the genetic advice, screening and/or predictive testing [9].

Unfortunately, genetic testing for mutations in BRCA1 and BRCA2 is not always available in public institutions in developing countries due to its high cost and limitations in infrastructure. As BRCA genes have long coding sequences and lack mutation hot spots, the current strategies for BRCA genotyping typically include a first step to detect occurring mutations by protein truncation test (PTT), denaturing high-performance liquid chromatography (dHPLC), denaturing gradient gel electrophoresis (DGGE) or high-resolution melting curve analysis (HRMCA); and a final step to determine the mutation by Sanger sequencing [10]. These approaches are laborious, expensive and time consuming, and could be substituted by high throughput, cost efficient testing methods such as massively parallel sequencing [11], [12].

In this work we used massive parallel pyrosequencing to screen for mutations in the complete coding regions and splice sites of BRCA genes in Mexican women. We studied 39 patients with breast and/or ovary cancer and with history of familial cancer and with early-onset breast cancer, suggestive for BRCA mutations. We found 4 pathogenic mutations, of which 3 have not been described. We also identified 16 missense mutations with unknown deleterious effects. In addition, by a directed sequencing strategy, we evaluated the presence of the deleterious mutations in the family members of the patients. Also, we identified family members with the mutations and with no clinical manifestations of cancer. These patients began clinical management (that includes follow-up and prophylactic measures). This work illustrates how new sequencing technology for screening of mutations in BRCA genes impacts the familial health scenario and can be conducted as part of the genetic approach for patients with familial cancer in public health care institutions.

Methods

Patients

A total of 39 patients were screened. Thirty-five female patients with breast and/or ovarian cancer and with two or more first- or second-degree relatives with tumors associated with BRCA mutations were studied. Two male patients with breast cancer were included. All patients were clinically approached and a three-generation genealogy of each family was made. Two patients without familial cancer history, one with early-onset (age of diagnosis: 28) breast cancer and one with breast and ovarian cancer, suggestive for BRCA mutations, were also included. Patients were fully informed about the study and gave their written consent. The protocol was approved by the Institutional Review Boards of the National Cancer Institute of Mexico (http://www.incan.edu.mx/) and carried out in accordance with the Declaration of Helsinki, good clinical practices, and local ethical and legal requirements.

DNA isolation

Genomic DNA was isolated of peripheral blood with the Magna Pure System (Roche) following manufacturer instructions. The integrity of the material was verified by agarose electrophoresis. Sample quantification was done with the Quant-it Picogreen kit (Invitrogen) in a QuantiFluor Fluorometer (Promega).

Pyrosequencing

A Sequencing Master library of amplicons covering all the coding exons and splice sites of BRCA1 and BRCA2 was produced for each patient using the BRCAMASTR kit (Multiplicom) following manufacturer instructions. Briefly, 50 ng of gDNA were used as template in each of 12 multiplex PCR reactions for each patient. These reactions amplified the complete exonic and splice sites of BRCA1 and BRCA2. A 1∶1000 dilution of the purified PCR products were re-amplified using molecular identification (MID) adaptors for each patient. A BRCA amplicon library of each patient was generated and equivalent concentrations of the libraries were pooled to generate a Sequencing Master library. Pyrosequencing of the Master libraries were done in the sense and anti-sense strands with the 454 GS Junior (Roche) technology. Data analysis was done with the GS Amplicon Variant Analyzer software (Roche) comparing against genomic references NG_005905 and NG_012772 for BRCA1 and BRCA2, respectively. The cDNA references utilized were NM_007294 and NM_000059 for BRCA1 and BRCA2, respectively. The nomenclature used is based on the cDNA sequence and is according to Human Genome Variation Society (http://www.hgvs.org/). All the deleterious mutations found were verified by Sanger sequencing of original patient blood DNA and by restriction analysis when possible. The putative functional effects of missense variants were analyzed in silico with PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/).

Restriction analysis

The presence of the mutation c.3124_3133delAGCAATATTA found in patient 11 was verified by restriction analysis of the PCR product (554 pb) amplified with the primers BRCA1-11.1F: TCAGAGGCAACGAAACTGGACTCA and BRCA1-11.1R: CAGCCTATGGGAAGTAGTCATGCA. The mutated allele lacks the restriction site for SspI (AATATT) and is not cleaved by this enzyme, while the wild-type allele is cleaved in two fragments (257 and 297 pb). 500 ng of PCR products were digested with 1 U of SspI (Fermentas) at 37°C for 4 h in 20 uL. Ten uL of the reactions were visualized in 1.5% agarose gels.

Results

To analyze the performance of the amplicon strategy for the sequencing of BRCA genes we carried out an evaluation run with 6 patients' samples, of which 4 had previously identified mutations and 2 were negative controls [13]. We used three inclusion criteria to accept valid mutated sequences: 1) mutation found in forward and reverse sequences, 2) at least 30% of sequences with the mutations and 3) at least 20X of sequence coverage of the amplicons with the mutation. Also we defined three exclusion criteria: 1) mutations detected in an homopolymeric tract of ≥6, 2) mutations found in the last nucleotide of the sequence and with frequencies of less than 30% and 3) quality score lower than 20 in forward and reverse reads. Similar criteria have been described elsewhere [12]. As seen in table 1, we detected all the deleterious mutations in the positive controls and no pathogenic variants were found in the negative controls. In the mutations observed the minimal and maximal coverage was 41 and 485 reads per nucleotide, respectively. Also in this control experiment more than 70% of all the reads across the whole exon and splice sites had a quality score (Q) ranging from 36 to 40 (highest score), and low quality reads with Q>20 were less than 10% (Fig. 1). As expected, we observed that the majority of these low quality reads were in homopolymeric tracts, especially of >6 bases. Although present, these homopolymeric sequences are a negligible number of the total reads (Fig. 2). With this analysis we concluded that the strategy used was robust and suitable for its application in the screening of BRCA mutations in patients' samples.

thumbnail
Figure 1. Quality of the sequencing runs.

The percentages of the reads with their associated quality numbers of all runs are plotted.

https://doi.org/10.1371/journal.pone.0037432.g001

thumbnail
Figure 2. Distribution of homopolymeric tracts across the reads.

The base number signals are plotted against the sequence reads of the control run.

https://doi.org/10.1371/journal.pone.0037432.g002

thumbnail
Table 1. Evaluation of the methodological strategy for the detection of BRCA mutations.

https://doi.org/10.1371/journal.pone.0037432.t001

We screened for mutations in the whole coding sequence of BRCA genes in 39 patients with early-onset breast and ovarian tumors and/or with familial history of cancer, suggestive for BRCA mutations, as determined by our Clinic of Genetics. The main clinical characteristics of the patients are listed in table 2 and 3. After the pyrosequencing analysis and careful examination of the reads with our criteria of inclusion and exclusion, we found 4 mutations in the BRCA genes (c.2805_2808delAGAT and c.3124_3133delAGCAATATTA in BRCA1; c.2639_2640delTG and c.5114_5117delTAAA in BRCA2). All mutations were predicted to be deleterious because each generated a stop codon in the open reading frame (Table 4). These pathogenic mutations were confirmed by Sanger sequencing and the c.3124_3133delAGCAATATTA mutation in BRCA1 was also confirmed by restriction analysis (Fig 3). In the family of patient 1 (mutation c.5114_5117delTAAA) we found 10 clinically asymptomatic carriers (Fig. 4). The family with the c.2639_2640delTG mutation in BRCA2 (patient 15) had a strong history of cancer, including laryngeal, gastric, lung and colon cancer in second- and third-degree relatives in the maternal branch (Fig. 5). In the family with the c.2805delAGAT mutation in BRCA1 (patient 39), one first-degree relative had breast and colon cancer (Fig. 6). Interestingly, 3 of the 4 deleterious mutations have not been described previously. Likewise, we detected 16 genetic variants with unknown clinical significance (VUS), which included missense mutations and changes in intronic sequences (Table 5). Four VUS were predicted to be potentially deleterious by in silico analyzes (Table 5). Intronic variants that have been evaluated functionally through in vitro experiments by others were not present [14]. No Ashkenazi founder mutations were found.

thumbnail
Figure 3. Restriction analysis of the mutation c.3124_3133delAGCAATATTA found in patient 3.

PCR products encompassing the mutation were digested with SspI (see methods). The mutated allele has lost the SspI site and is not cleaved by the enzyme, while the wild-type allele is cut in two fragments. Lanes: 1) wild-type control PCR product not digested, 2) patient 11 PCR product not digested, 3) wild-type control PCR product digested, 4) patient 11 PCR product digested. Mut: mutated; Wt: wild-type.

https://doi.org/10.1371/journal.pone.0037432.g003

thumbnail
Figure 4. Genealogy of the family 1 carrier of the deleterious mutation c.5114_5117delTAAA in BRCA2.

Index patient is denoted with an arrow. Individuals with cancer are represented with in dark circles or with dark squares; the type of cancer is indicated as follows: Bla: Bladder cancer; Br: Unilateral Breast Cancer; B-Br: Bilateral breast cancer. Current age or known ages of cancer diagnosis and decease are showed. Numbers inside the rhombi indicate quantity of relatives. Asymptomatic carriers are represented with a midline. Unaffected family members confirmed by the predictive molecular testing are shown with a W (wild type).

https://doi.org/10.1371/journal.pone.0037432.g004

thumbnail
Figure 5. Genealogy of the family 15 carrier of the deleterious mutation c.2639_2640delTG in BRCA2.

Individuals with cancer are represented with dark circles or with dark squares; the type of cancer is indicated as follows: Br: unilateral breast cancer; Cr: colorectal cancer; NE: Not especified neoplasia; L: lung cancer; La: laryngeal cancer; Ga: gastric cancer. Index patient is denoted with an arrow. Current age or known ages of cancer diagnosis and decease are showed. Numbers inside the rhombi indicate quantity of first-degree relatives. Asymptomatic carriers are represented with a midline.

https://doi.org/10.1371/journal.pone.0037432.g005

thumbnail
Figure 6. Genealogy of the family 39 carrier of the deleterious mutation c.2805_2808delAGAT in BRCA1.

Index patient is denoted with an arrow. Individuals with cancer are represented in dark; the type of cancer is indicated as follows: Br: unilateral breast cancer; Cr: colorectal cancer. Current age or known ages of cancer diagnosis and decease are showed. Numbers inside the rhombi indicate quantity of relatives.

https://doi.org/10.1371/journal.pone.0037432.g006

thumbnail
Table 3. Clinical and familial features of the patients included in the study.

https://doi.org/10.1371/journal.pone.0037432.t003

thumbnail
Table 5. Variants of uncertain significance (VUS) detected in patients.

https://doi.org/10.1371/journal.pone.0037432.t005

Discussion

Molecular genetic testing of germline mutations in BRCA genes is not common in public institutions in Latin America due to its high costs and limitations in infrastructure. Current protocols for BRCA mutation detection are time consuming and laborious, which makes difficult their implementation in developing countries. Also, the polymorphic nature of BRCA genes, their long size and lack of hot mutation spots highlight the necessity to implement new high throughput diagnostic methodologies. Almost 10% of breast cancer is associated to hereditary mutations [15]. Likewise, the lifetime risk of developing breast cancer is been reported as high as 80% and 50% for BRCA1 and BRCA2 mutation carriers, respectively; although it varies between different populations and ethnicities [16], [17]. In this light, BRCA genetic testing is of major diagnostic relevance not only because it provides a clinical preventive approach to family members before the development of cancer, but also can imply novel treatment strategies for affected patients, such as the use of poly-(ADP–ribose) polymerase inhibitors [18][20]. Additionally, BRCA genetic tests are central for the determination of founder mutations, which are frequent deleterious variants that can be screened in the population in first-line directed studies to reduce costs and accelerate diagnosis [21], [22]. In the Mexican population no founder mutations have been described.

In these work we analysed BRCA full exome and splice site mutations by massive parallel pyrosequencing. In the evaluation of the method, we found all the mutations present in previously characterized positive controls; negative controls showed no variants. The coverage of the sequences for the mutations varied from 41 to 485X, with quality scores of 20–40 in 95% of the reads throughout all the exonic and splice sites regions. These results led us to evaluate mutations in patients with hereditary breast and ovarian cancer syndrome and in patients with clinical features suggestive for BRCA deleterious mutations. In these analyses we found 4 (10.2%) BRCA mutations in the 39 patients, which is very similar to the prevalence reported by other studies of families with hereditary cancer in Latin America [13], [23], [24]. All the mutations found in these patients have not been previously described and are not reported in the Breast Cancer Information core (BIC) and NCBI variant databases, which is in concordance with the polymorphic nature of these genes [25]. Interestingly, one of these mutations was in a patient with no history of familial cancer, but with strong suggestive clinical manifestations of a BRCA mutation, such as early-onset breast cancer [26]. This result highlights the necessity to extend the screening for BRCA mutations also to candidate patients with no history of familial cancer, which is in concordance with reports that described that 30–50% of BRCA mutation carriers have not family history of breast and ovarian cancer [27], [28]. Remarkably, we found 10 clinically asymptomatic BRCA2 mutation (c.5114_5117delTAAA) carriers in family 1, which reflects the incomplete penetrance associated with different BRCA mutations and that there are other risk factors associated with the penetrance of BRCA mutations [29][32]. In this study we used massive parallel pyrosequencing because its capacity to screen the whole exonic and splice site regions of BRCA1 and BRCA2 in up to 8 samples per run and its high depth of sequence, which provides more sensitivity for mutation detection than conventional Sanger sequencing and makes this strategy cost-effective [33]. Also, these advantages offer great benefit to the diagnostic scenario, comparing to other methods. However, this technology has intrinsic limitations, namely the detection of whole exon deletions and the identification of mutations in homopolymeric tracts longer than 6 bases. Since the frequency of exon deletion and large genomic rearrangements is population-dependent and has been described as 1–30% in BRCA-associated cancers, it is determinant to further evaluate putative BRCA mutation-negative samples by complementary methods, such as Multiplex Ligation-dependent Probe Amplification analysis [34][36]. Also the evaluation of homopolymeric tract variants, which comprise 12 stretches longer than 6 nt in the BRCA1 and BRCA2 coding sequences, should be assessed with alternative methods such as high-resolution-melting-curve-analysis [37]. When negative, these analyzes would rule out the BRCA etiology of the tumor. Thus, in these patients with clear familial history of cancer, the evaluation of mutations in other genes, like PALB2, CHEK2 and RAD51C, should also be considered [38][41]. This could be the case of some of the families of this study, in which we screened 35 patients with a clear familial history of cancer, but we only found 3 patients with mutations in BRCA. Additionally, the presence of VUS could be related to pathogenic effects at the level of mRNA processing, stability, translation and protein function, as has been described in BRCA1 and other genes [42][46]. The effect of VUS is subject of great interest as their presence exceeds mutations in patients with familial cancer; however, their functional evaluation is far from being a common diagnostic practice. In this regard, the functional evaluation of some VUS in the BRCA genes has showed that single nucleotide variations in introns can influence mRNA processing, producing exon skipping and aberrant out of frame mRNA forms [14]. We found 16 not previously described VUS, especially in patients without deleterious BRCA variants and 4 were predicted to be pathogenic by computational analyses. Functional studies must be undertaken to evaluate their effects. In this concern, we foresee that new routine methods will soon be accessible to determine the molecular and pathological relevance of these variants.

In summary, this work illustrates how hole exonic and splice site massive parallel pyrosequencing can be used as a diagnostic strategy to determine BRCA mutations. Its use circumvents the laborious and time-consuming efforts of the current methodologies. With this technology we found 4 mutations and 16 VUS in our series of patients with familial cancer, which highlights the relevance of this approach as a diagnostic tool and suggests it could be used as a routine practice in public health institutions.

Acknowledgments

We thank Omar Ruvalcaba and Gabriel Hernandez for technical assistance during the course of this work. This manuscript was submitted in partial fulfilment of the requirements for the M.Sc degree for RMAG at Posgrado en Ciencias Biológicas, Universidad Nacional Autónoma de México.

Author Contributions

Conceived and designed the experiments: CPP LAH AM. Performed the experiments: FVP RMAG VFO. Analyzed the data: FVP. Wrote the paper: FVP CPP. Contributed to sample collection, clinical approach, and follow-up of the patients: RMAG SVM DC EBR CLC. Targeted sequencing of mutations and genealogy evaluations: RMAG SVM.

References

  1. 1. Meindl A, Ditsch N, Kast K, Rhiem K, Schmutzler R (2011) Hereditary Breast and Ovarian Cancer: New Genes, New Treatments, New Concepts. Deutsches Ärzteblatt International 108: 323.A. MeindlN. DitschK. KastK. RhiemR. Schmutzler2011Hereditary Breast and Ovarian Cancer: New Genes, New Treatments, New Concepts.Deutsches Ärzteblatt International108323
  2. 2. Narod SA, Foulkes WD (2004) BRCA1 and BRCA2: 1994 and beyond. Nat Rev Cancer 4: 665–676.SA NarodWD Foulkes2004BRCA1 and BRCA2: 1994 and beyond.Nat Rev Cancer4665676
  3. 3. Petrucelli N, Daly MB, Feldman GL (2010) Hereditary breast and ovarian cancer due to mutations in BRCA1 and BRCA2. Genetics in Medicine 12: 245–259.N. PetrucelliMB DalyGL Feldman2010Hereditary breast and ovarian cancer due to mutations in BRCA1 and BRCA2.Genetics in Medicine12245259
  4. 4. Medeiros F, Muto MG, Lee Y, Elvin JA, Callahan MJ, et al. (2006) The tubal fimbria is a preferred site for early adenocarcinoma in women with familial ovarian cancer syndrome. Am J Surg Pathol 30: 230–236.F. MedeirosMG MutoY. LeeJA ElvinMJ Callahan2006The tubal fimbria is a preferred site for early adenocarcinoma in women with familial ovarian cancer syndrome.Am J Surg Pathol30230236
  5. 5. Lynch HT, Deters CA, Snyder CL, Lynch JF, Villeneuve P, et al. (2005) BRCA1 and pancreatic cancer: pedigree findings and their causal relationships. Cancer Genet Cytogenet 158: 119–125.HT LynchCA DetersCL SnyderJF LynchP. Villeneuve2005BRCA1 and pancreatic cancer: pedigree findings and their causal relationships.Cancer Genet Cytogenet158119125
  6. 6. Edwards SM, Kote-Jarai Z, Meitz J, Hamoudi R, Hope Q, et al. (2003) Two percent of men with early-onset prostate cancer harbor germline mutations in the BRCA2 gene. Am J Hum Genet 72: 1–12.SM EdwardsZ. Kote-JaraiJ. MeitzR. HamoudiQ. Hope2003Two percent of men with early-onset prostate cancer harbor germline mutations in the BRCA2 gene.Am J Hum Genet72112
  7. 7. Pruthi S, Gostout BS, Lindor NM (2010) Identification and management of women with BRCA mutations or hereditary predisposition for breast and ovarian cancer. Mayo Clinic Proceedings 85: 1111–1120.S. PruthiBS GostoutNM Lindor2010Identification and management of women with BRCA mutations or hereditary predisposition for breast and ovarian cancer.Mayo Clinic Proceedings8511111120
  8. 8. Paradiso A, Formenti S (2011) Hereditary breast cancer: clinical features and risk reduction strategies. Annals of Oncology 22: i31–i36.A. ParadisoS. Formenti2011Hereditary breast cancer: clinical features and risk reduction strategies.Annals of Oncology22i31i36
  9. 9. Clark AS, Domchek SM (2011) Clinical management of hereditary breast cancer syndromes. J Mammary Gland Biol Neoplasia 16: 17–25.AS ClarkSM Domchek2011Clinical management of hereditary breast cancer syndromes.J Mammary Gland Biol Neoplasia161725
  10. 10. Gerhardus A, Schleberger H, Schlegelberger B, Gadzicki D (2007) Diagnostic accuracy of methods for the detection of BRCA1 and BRCA2 mutations: a systematic review. Eur J Hum Genet 15: 619–627.A. GerhardusH. SchlebergerB. SchlegelbergerD. Gadzicki2007Diagnostic accuracy of methods for the detection of BRCA1 and BRCA2 mutations: a systematic review.Eur J Hum Genet15619627
  11. 11. Wang G, Beattie MS, Ponce NA, Phillips KA (2011) Eligibility criteria in private and public coverage policies for BRCA genetic testing and genetic counseling. Genetics in Medicine 13: 1045–1050.G. WangMS BeattieNA PonceKA Phillips2011Eligibility criteria in private and public coverage policies for BRCA genetic testing and genetic counseling.Genetics in Medicine1310451050
  12. 12. De Leeneer K, Hellemans J, De Schrijver J, Baetens M, Poppe B, et al. (2011) Massive parallel amplicon sequencing of the breast cancer genes BRCA1 and BRCA2: opportunities, challenges, and limitations. Hum Mutat 32(3): 335–344.K. De LeeneerJ. HellemansJ. De SchrijverM. BaetensB. Poppe2011Massive parallel amplicon sequencing of the breast cancer genes BRCA1 and BRCA2: opportunities, challenges, and limitations.Hum Mutat323335344
  13. 13. Vidal-Millán S, Taja-Chayeb L, Gutiérrez-Hernández O, Ramírez U, Robles-Vidal C, et al. (2009) Mutational analysis of BRCA1 and BRCA2 genes in Mexican breast cancer patients. European journal of gynaecological oncology 30: 527.S. Vidal-MillánL. Taja-ChayebO. Gutiérrez-HernándezU. RamírezC. Robles-Vidal2009Mutational analysis of BRCA1 and BRCA2 genes in Mexican breast cancer patients.European journal of gynaecological oncology30527
  14. 14. Théry J, Krieger S, Gaildrat P, Révillion F (2011) Contribution of bioinformatics predictions and functional splicing assays to the interpretation of unclassified variants of the BRCA genes. Eur J Hum Genet. 19(10): 1052–1058.J. ThéryS. KriegerP. GaildratF. Révillion2011Contribution of bioinformatics predictions and functional splicing assays to the interpretation of unclassified variants of the BRCA genes. Eur J Hum Genet.191010521058
  15. 15. Szabo CI, King M-C (1995) Inherited breast and ovarian cancer. Hum Mol Genet 4 Spec No. pp. 1811–1817.CI SzaboM-C King1995Inherited breast and ovarian cancer.Hum Mol Genet 4 Spec No18111817
  16. 16. Easton DF, Ford D, Bishop DT (1995) Breast and ovarian cancer incidence in BRCA1-mutation carriers. Breast Cancer Linkage Consortium. Am J Hum Genet 56: 265–271.DF EastonD. FordDT Bishop1995Breast and ovarian cancer incidence in BRCA1-mutation carriers. Breast Cancer Linkage Consortium.Am J Hum Genet56265271
  17. 17. Chen S, Parmigiani G (2007) Meta-analysis of BRCA1 and BRCA2 penetrance. Journal of Clinical Oncology 25: 1329–1333.S. ChenG. Parmigiani2007Meta-analysis of BRCA1 and BRCA2 penetrance.Journal of Clinical Oncology2513291333
  18. 18. Kwon JS, Daniels MS, Sun CC, Lu KH (2010) Preventing future cancers by testing women with ovarian cancer for BRCA mutations. Journal of Clinical Oncology 28: 675–682.JS KwonMS DanielsCC SunKH Lu2010Preventing future cancers by testing women with ovarian cancer for BRCA mutations.Journal of Clinical Oncology28675682
  19. 19. Trainer AH, Lewis CR, Tucker K, Meiser B, Friedlander M, et al. (2010) The role of BRCA mutation testing in determining breast cancer therapy. Nature Publishing Group 7: 708–717.AH TrainerCR LewisK. TuckerB. MeiserM. Friedlander2010The role of BRCA mutation testing in determining breast cancer therapy.Nature Publishing Group7708717
  20. 20. Tutt A, Robson M, Garber JE, Domchek SM, Audeh MW, et al. (2010) Oral poly (ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and advanced breast cancer: a proof-of-concept trial. Lancet 376: 235–244.A. TuttM. RobsonJE GarberSM DomchekMW Audeh2010Oral poly (ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and advanced breast cancer: a proof-of-concept trial.Lancet376235244
  21. 21. Ferla R, Calò V, Cascio S, Rinaldi G, Badalamenti G, et al. (2007) Founder mutations in BRCA1 and BRCA2 genes. Ann Oncol 18: Suppl 6vi93–8.R. FerlaV. CalòS. CascioG. RinaldiG. Badalamenti2007Founder mutations in BRCA1 and BRCA2 genes.Ann Oncol18Suppl 6vi938
  22. 22. Zhang L, Kirchhoff T, Yee CJ, Offit K (2009) A rapid and reliable test for BRCA1 and BRCA2 founder mutation analysis in paraffin tissue using pyrosequencing. J Mol Diagn 11: 176–181.L. ZhangT. KirchhoffCJ YeeK. Offit2009A rapid and reliable test for BRCA1 and BRCA2 founder mutation analysis in paraffin tissue using pyrosequencing.J Mol Diagn11176181
  23. 23. Ruiz-Flores P, Sinilnikova OM, Badzioch M, Calderon-Garcidueñas AL, Chopin S, et al. (2002) BRCA1 and BRCA2 mutation analysis of early-onset and familial breast cancer cases in Mexico. Hum Mutat 20: 474–475.P. Ruiz-FloresOM SinilnikovaM. BadziochAL Calderon-GarcidueñasS. Chopin2002BRCA1 and BRCA2 mutation analysis of early-onset and familial breast cancer cases in Mexico.Hum Mutat20474475
  24. 24. Gutiérrez Espeleta G, Llacuachaqui M, García-Jiménez L, Aguilar Herrera M, Loáiciga Vega K, et al. (2011) BRCA1 and BRCA2 mutations among familial breast cancer patients from Costa Rica. Clinical Genetics. G. Gutiérrez EspeletaM. LlacuachaquiL. García-JiménezM. Aguilar HerreraK. Loáiciga Vega2011BRCA1 and BRCA2 mutations among familial breast cancer patients from Costa Rica.Clinical Genetics
  25. 25. Lips EH, Laddach N, Savola SP, Vollebergh MA, Oonk AM, et al. (2011) Quantitative copy number analysis by Multiplex Ligation-dependent Probe Amplification (MLPA) of BRCA1-associated breast cancer regions identifies BRCAness. Breast Cancer Res 13: R107.EH LipsN. LaddachSP SavolaMA VolleberghAM Oonk2011Quantitative copy number analysis by Multiplex Ligation-dependent Probe Amplification (MLPA) of BRCA1-associated breast cancer regions identifies BRCAness.Breast Cancer Res13R107
  26. 26. Musolino A, Bella MA, Bortesi B, Michiara M, Naldi N, et al. (2007) BRCA mutations, molecular markers, and clinical variables in early-onset breast cancer: a population-based study. Breast 16: 280–292.A. MusolinoMA BellaB. BortesiM. MichiaraN. Naldi2007BRCA mutations, molecular markers, and clinical variables in early-onset breast cancer: a population-based study.Breast16280292
  27. 27. de Sanjosé S, Léoné M, Bérez V, Izquierdo A, Font R, et al. (2003) Prevalence of BRCA1 and BRCA2 germline mutations in young breast cancer patients: a population-based study. Int J Cancer 106: 588–593.S. de SanjoséM. LéonéV. BérezA. IzquierdoR. Font2003Prevalence of BRCA1 and BRCA2 germline mutations in young breast cancer patients: a population-based study.Int J Cancer106588593
  28. 28. Møller P, Hagen AI, Apold J, Maehle L, Clark N, et al. (2007) Genetic epidemiology of BRCA mutations-family history detects less than 50% of the mutation carriers. Eur J Cancer 43: 1713–1717.P. MøllerAI HagenJ. ApoldL. MaehleN. Clark2007Genetic epidemiology of BRCA mutations-family history detects less than 50% of the mutation carriers.Eur J Cancer4317131717
  29. 29. Thompson D, Easton D, Breast Cancer Linkage Consortium (2001) Variation in cancer risks, by mutation position, in BRCA2 mutation carriers. Am J Hum Genet 68: 410–419.D. ThompsonD. EastonConsortium Breast Cancer Linkage2001Variation in cancer risks, by mutation position, in BRCA2 mutation carriers.Am J Hum Genet68410419
  30. 30. Lecarpentier J, Noguès C, Mouret-Fourme E, Stoppa-Lyonnet D, Lasset C, et al. (2011) Variation in breast cancer risk with mutation position, smoking, alcohol, and chest X-ray history, in the French National BRCA1/2 carrier cohort (GENEPSO). Breast Cancer Res Treat 130: 927–938.J. LecarpentierC. NoguèsE. Mouret-FourmeD. Stoppa-LyonnetC. Lasset2011Variation in breast cancer risk with mutation position, smoking, alcohol, and chest X-ray history, in the French National BRCA1/2 carrier cohort (GENEPSO).Breast Cancer Res Treat130927938
  31. 31. Milne RL, Osorio A, Ramón y Cajal T, Baiget M, Lasa A, et al. (2010) Parity and the risk of breast and ovarian cancer in BRCA1 and BRCA2 mutation carriers. Breast Cancer Res Treat 119: 221–232.RL MilneA. OsorioT. Ramón y CajalM. BaigetA. Lasa2010Parity and the risk of breast and ovarian cancer in BRCA1 and BRCA2 mutation carriers.Breast Cancer Res Treat119221232
  32. 32. Nkondjock A, Robidoux A, Paredes Y, Narod SA, Ghadirian P (2006) Diet, lifestyle and BRCA-related breast cancer risk among French-Canadians. Breast Cancer Res Treat 98: 285–294.A. NkondjockA. RobidouxY. ParedesSA NarodP. Ghadirian2006Diet, lifestyle and BRCA-related breast cancer risk among French-Canadians.Breast Cancer Res Treat98285294
  33. 33. Gilles A, Meglécz E, Pech N, Ferreira S, Malausa T, et al. (2011) Accuracy and quality assessment of 454 GS-FLX Titanium pyrosequencing. BMC Genomics 12: 245.A. GillesE. MegléczN. PechS. FerreiraT. Malausa2011Accuracy and quality assessment of 454 GS-FLX Titanium pyrosequencing.BMC Genomics12245
  34. 34. Hofmann W, Görgens H, John A, Horn D, Hüttner C, et al. (2003) Screening for large rearrangements of the BRCA1 gene in German breast or ovarian cancer families using semi-quantitative multiplex PCR method. Hum Mutat 22: 103–104.W. HofmannH. GörgensA. JohnD. HornC. Hüttner2003Screening for large rearrangements of the BRCA1 gene in German breast or ovarian cancer families using semi-quantitative multiplex PCR method.Hum Mutat22103104
  35. 35. Montagna M, Dalla Palma M, Menin C, Agata S, De Nicolo A, et al. (2003) Genomic rearrangements account for more than one-third of the BRCA1 mutations in northern Italian breast/ovarian cancer families. Hum Mol Genet 12: 1055–1061.M. MontagnaM. Dalla PalmaC. MeninS. AgataA. De Nicolo2003Genomic rearrangements account for more than one-third of the BRCA1 mutations in northern Italian breast/ovarian cancer families.Hum Mol Genet1210551061
  36. 36. Ewald IP, Ribeiro PLI, Palmero EI, Cossio SL, Giugliani R, et al. (2009) Genomic rearrangements in BRCA1 and BRCA2: A literature review. Genet Mol Biol 32: 437–446.IP EwaldPLI RibeiroEI PalmeroSL CossioR. Giugliani2009Genomic rearrangements in BRCA1 and BRCA2: A literature review.Genet Mol Biol32437446
  37. 37. De Leeneer K, Coene I, Poppe B, De Paepe A, Claes K (2009) Genotyping of frequent BRCA1/2 SNPs with unlabeled probes: a supplement to HRMCA mutation scanning, allowing the strong reduction of sequencing burden. J Mol Diagn 11: 415–419.K. De LeeneerI. CoeneB. PoppeA. De PaepeK. Claes2009Genotyping of frequent BRCA1/2 SNPs with unlabeled probes: a supplement to HRMCA mutation scanning, allowing the strong reduction of sequencing burden.J Mol Diagn11415419
  38. 38. Blanco A, la Hoya de M, Balmaña J, Ramón y Cajal T, Teulé A, et al. (2011) Detection of a large rearrangement in PALB2 in Spanish breast cancer families with male breast cancer. Breast Cancer Res Treat. A. BlancoM. la Hoya deJ. BalmañaT. Ramón y CajalA. Teulé2011Detection of a large rearrangement in PALB2 in Spanish breast cancer families with male breast cancer.Breast Cancer Res Treat
  39. 39. Manoukian S, Peissel B, Frigerio S, Lecis D, Bartkova J, et al. (2011) Two new CHEK2 germ-line variants detected in breast cancer/sarcoma families negative for BRCA1, BRCA2, and TP53 gene mutations. Breast Cancer Res Treat 130: 207–215.S. ManoukianB. PeisselS. FrigerioD. LecisJ. Bartkova2011Two new CHEK2 germ-line variants detected in breast cancer/sarcoma families negative for BRCA1, BRCA2, and TP53 gene mutations.Breast Cancer Res Treat130207215
  40. 40. Meindl A, Hellebrand H, Wiek C, Erven V, Wappenschmidt B, et al. (2010) Germline mutations in breast and ovarian cancer pedigrees establish RAD51C as a human cancer susceptibility gene. Nat Genet 42: 410–414.A. MeindlH. HellebrandC. WiekV. ErvenB. Wappenschmidt2010Germline mutations in breast and ovarian cancer pedigrees establish RAD51C as a human cancer susceptibility gene.Nat Genet42410414
  41. 41. Vuorela M, Pylkäs K, Hartikainen JM, Sundfeldt K, Lindblom A, et al. (2011) Further evidence for the contribution of the RAD51C gene in hereditary breast and ovarian cancer susceptibility. Breast Cancer Res Treat 130: 1003–1010.M. VuorelaK. PylkäsJM HartikainenK. SundfeldtA. Lindblom2011Further evidence for the contribution of the RAD51C gene in hereditary breast and ovarian cancer susceptibility.Breast Cancer Res Treat13010031010
  42. 42. Liu HX, Cartegni L, Zhang MQ, Krainer AR (2001) A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes. Nat Genet 27: 55–58.HX LiuL. CartegniMQ ZhangAR Krainer2001A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes.Nat Genet275558
  43. 43. Carvalho MA, Marsillac SM, Karchin R, Manoukian S, Grist S, et al. (2007) Determination of cancer risk associated with germ line BRCA1 missense variants by functional analysis. Cancer Res 67: 1494–1501.MA CarvalhoSM MarsillacR. KarchinS. ManoukianS. Grist2007Determination of cancer risk associated with germ line BRCA1 missense variants by functional analysis.Cancer Res6714941501
  44. 44. Tischkowitz M, Hamel N, Carvalho MA, Birrane G, Soni A, et al. (2008) Pathogenicity of the BRCA1 missense variant M1775K is determined by the disruption of the BRCT phosphopeptide-binding pocket: a multi-modal approach. Eur J Hum Genet 16: 820–832.M. TischkowitzN. HamelMA CarvalhoG. BirraneA. Soni2008Pathogenicity of the BRCA1 missense variant M1775K is determined by the disruption of the BRCT phosphopeptide-binding pocket: a multi-modal approach.Eur J Hum Genet16820832
  45. 45. Nackley AG, Shabalina SA, Tchivileva IE, Satterfield K, Korchynskyi O, et al. (2006) Human Catechol-O-Methyltransferase Haplotypes Modulate Protein Expression by Altering mRNA Secondary Structure. Science 314: 1930–1933.AG NackleySA ShabalinaIE TchivilevaK. SatterfieldO. Korchynskyi2006Human Catechol-O-Methyltransferase Haplotypes Modulate Protein Expression by Altering mRNA Secondary Structure.Science31419301933
  46. 46. Duan J (2003) Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Hum Mol Genet 12: 205–216.J. Duan2003Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor.Hum Mol Genet12205216
  47. 47. Liede A, Malik IA, Aziz Z, Rios Pd P de L, Kwan E, et al. (2002) Contribution of BRCA1 and BRCA2 mutations to breast and ovarian cancer in Pakistan. Am J Hum Genet 71: 595–606.A. LiedeIA MalikZ. AzizL. Rios Pd P deE. Kwan2002Contribution of BRCA1 and BRCA2 mutations to breast and ovarian cancer in Pakistan.Am J Hum Genet71595606
  48. 48. Evans DGR, Neuhausen SL, Bulman M, Young K, Gokhale D, et al. (2004) Haplotype and cancer risk analysis of two common mutations, BRCA1 4184del4 and BRCA2 2157delG, in high risk northwest England breast/ovarian families. Journal of Medical Genetics 41: e21.DGR EvansSL NeuhausenM. BulmanK. YoungD. Gokhale2004Haplotype and cancer risk analysis of two common mutations, BRCA1 4184del4 and BRCA2 2157delG, in high risk northwest England breast/ovarian families.Journal of Medical Genetics41e21
  49. 49. Saxena S, Chakraborty A, Kaushal M, Kotwal S, Bhatanager D, et al. (2006) Contribution of germline BRCA1 and BRCA2 sequence alterations to breast cancer in Northern India. BMC Med Genet 7: 75.S. SaxenaA. ChakrabortyM. KaushalS. KotwalD. Bhatanager2006Contribution of germline BRCA1 and BRCA2 sequence alterations to breast cancer in Northern India.BMC Med Genet775
  50. 50. Salazar R, Cruz-Hernandez JJ, Sanchez-Valdivieso E, Rodriguez CA, Gomez-Bernal A, et al. (2006) BRCA1-2 mutations in breast cancer: identification of nine new variants of BRCA1-2 genes in a population from central Western Spain. Cancer Letters 233: 172–177.R. SalazarJJ Cruz-HernandezE. Sanchez-ValdiviesoCA RodriguezA. Gomez-Bernal2006BRCA1-2 mutations in breast cancer: identification of nine new variants of BRCA1-2 genes in a population from central Western Spain.Cancer Letters233172177
  51. 51. Simard J, Dumont M, Moisan A-M, Gaborieau V, Malouin H, et al. (2007) Evaluation of BRCA1 and BRCA2 mutation prevalence, risk prediction models and a multistep testing approach in French-Canadian families with high risk of breast and ovarian cancer. Journal of Medical Genetics 44: 107–121.J. SimardM. DumontA-M MoisanV. GaborieauH. Malouin2007Evaluation of BRCA1 and BRCA2 mutation prevalence, risk prediction models and a multistep testing approach in French-Canadian families with high risk of breast and ovarian cancer.Journal of Medical Genetics44107121
  52. 52. Borg A, Haile RW, Malone KE, Capanu M, Diep A, et al. (2010) Characterization of BRCA1 and BRCA2 deleterious mutations and variants of unknown clinical significance in unilateral and bilateral breast cancer: the WECARE study. Hum Mutat 31: E1200–40.A. BorgRW HaileKE MaloneM. CapanuA. Diep2010Characterization of BRCA1 and BRCA2 deleterious mutations and variants of unknown clinical significance in unilateral and bilateral breast cancer: the WECARE study.Hum Mutat31E120040
  53. 53. Díez Gilbert O, Machuca Cordano I, Angel Navarro M (1996) [Characterization of the BRCA1 gene and its significance in hereditary breast cancer]. Med Clin (Barc) 107: 623–627.O. Díez GilbertI. Machuca CordanoM. Angel Navarro1996[Characterization of the BRCA1 gene and its significance in hereditary breast cancer].Med Clin (Barc)107623627