Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

The Expression of microRNA and microRNA Clusters in the Aging Heart

  • Xiaomin Zhang,
  • Gohar Azhar,
  • Jeanne Y. Wei

    weijeanne@uams.edu

    Affiliation Donald W. Reynolds Department of Geriatrics, The University of Arkansas for Medical Sciences and Geriatric Research, Education and Clinical Center, Central Arkansas Veterans Healthcare System, Little Rock, Arkansas, United States of America

The Expression of microRNA and microRNA Clusters in the Aging Heart

  • Xiaomin Zhang, 
  • Gohar Azhar, 
  • Jeanne Y. Wei
PLOS
x

Abstract

Background

The microRNAs have been implicated in the process of cardiac development, cardiac hypertrophy, and heart failure. However, the impact of adult aging on cardiac expression of miRNA clusters, as well as both miRNA guide (miR) and passenger (miR*) strands has not been well established.

Methods/Results

We explored the expression profile of both miR and miR* in the hearts of young adult versus old mice. We found that 65 miRNAs were differentially expressed in the old versus young adult hearts; approximately half of them were clustered miRNAs that were distributed in 11 miRNA clusters. Each miRNA cluster contained from 2 to as many as 71 miRNA genes. The majority of the clusters displayed similar expression, with most cluster members within a cluster being either increased or decreased together, suggesting that most clusters are likely to be regulated by a common signaling mechanism and that the combined expression of multiple miRNA genes in a cluster could pose an impact on a broad range of targets during aging. We also found age-related changes in the expression of miR*s. The expression of both miR and miR* correlated with that of pri-miRNA transcript over the time course from development and maturation through adult aging. Age-related changes in the expression of Ago1 and Ago2 proteins in the heart were also observed. Transfection assay revealed that both Ago1 and Ago2 synergistically induced miR-21 and miR-21* when the mir-21 plasmid was co-transfected with either.

Conclusion

The data revealed age-related changes in the expression of pri-miRNA transcript, Argonaut proteins and both miR and miR* strands. The major changes occurred later in life, from middle to old age. It is likely that the expression of miR and miR* is regulated by both pri-miRNA transcription as well as Ago1 and Ago2 proteins during adult aging.

Introduction

Adult aging is a complex biological process associated with a progressive decline in the physiological and biochemical performance of individual tissues and organs, leading to increased susceptibility to age-related disease and functional senescence [1][4]. The functional changes observed in the older heart are usually associated with morphological changes that occur during the normal aging process, which is characterized by a loss of myocytes with subsequent hypertrophy of the remaining viable myocytes, and proliferation of cardiac fibroblasts. As myocytes are lost and fibroblasts continue to proliferate and produce collagen, the physical properties of the aging heart become altered [1], [2]. The functional and morphological changes in the older heart are accompanied by changes in cardiac gene expression, which include α-MHC, β-MHC, ANF, SERCA2 etc. [5][10].

Recent studies suggest that microRNAs (miRNAs) may play a role in the regulation of gene expression in the aging process [11][13]. MiRNAs are short (20 to 23-nucleotide), endogenous, single-stranded RNA molecules that regulate gene expression by hybridization to messenger RNAs (mRNAs) with the consequence of messenger RNA degradation or translational inhibition of targeted transcripts. Genes that encode for miRNA are distributed across chromosomes either individually, or in clusters, in which two or more miRNA genes are located within a short distance on the same segment of a chromosome.

The miRNA gene is usually transcribed by RNA polymerase II into a primary miRNA (pri-miRNA) transcript, which is cleaved at a hairpin-stem by the nuclear microprocessor complex containing Drosha and DGCR8 proteins, and generates hairpin-shaped pre-miRNA. The pre-miRNA is then exported from the nucleus to the cytoplasm, where it is cleaved by Dicer to form a 22 nt double-stranded miRNA duplexes [14]. Following their production, miRNA duplexes are sorted to confer association with specific members of the Argonaute (Ago) family of proteins, which function as the core of the RNA-induced silencing complex (RISC) [15][20]. Post-transcriptional regulation of gene expression is mediated by the RISC complex, which uses one strand of the miRNA molecule (miR, the guide strand) to target relevant messenger RNAs. Once the messenger RNA is targeted by miRNAs, the RISC is thought to inhibit protein production either through blocking translation or by reducing messenger RNA stability [21], [22]. Previously, the microRNA passenger strand (miR* or miRNA*) was thought to be degraded without significant biological impact on gene regulation. Recent studies, including deep-sequencing efforts, however, indicate that a large number of miR*s are not simply degraded, but rather, associate with Ago1 and/or Ago2 and are also capable of silencing target transcripts [15], [16], [18], [19].

To determine the impact of advancing age on microRNA expression in the heart, we examined the microRNA expression level in old versus young adult (YA) hearts. We found that the expression of 65 microRNAs, including 11 miRNAs clusters was significantly altered during adult aging. In addition, we found that major changes in the expression of miRNA occurred from the post-maturational period through adult aging. Our data suggest that transcriptional regulation of microRNA transcripts and altered expression of Argonaut proteins contribute to age-related changes in the expression of both miR and miR* strands.

Materials and Methods

Animal tissues

Healthy C57BL/6 mice were obtained from colonies maintained by the National Institute of Aging (NIA), the National Institutes of Health, under contractual agreement with Harlan Sprague-Dawley, Inc. (Harlan, IN). After euthanasia, the hearts were removed from mice and subjected to standard RNA isolation and histological procedures. Some heart tissue samples (4 months and 24 months) were obtained from the Aged Rodent Tissue Bank at NIA. For each time point, there were three independent biological replicates. The studies were conducted with the approval of the Institutional Animal Care and Use Committee (IACUC) at Central Arkansas Veterans Healthcare System (IACUC# 4-02-03) and in accordance with the NIH Guiding Principles for Research Involving Animals and Human Beings.

Total RNA isolation

All RNA samples were first isolated from the mouse cardiac ventricles using UltraSpec RNA Isolation Reagent as previously described. To minimize mouse DNA contamination and enrich the small RNA fraction, the total RNA samples were purified using miRNeasy Mini kit (Qiagen) and RNase-free DNase I according to the manufacture's instruction manual [23], [24].

MicroRNA arrays

The ventricular tissue samples used for the microRNA array analysis were obtained from healthy young adult (4-month-old) and old (24-month-old) C57BL6 mice. The RNA sample isolation and microRNA array were performed in triplets for young adult and old animals. A total of 6 RNA samples of ventricular tissue representing 3 individual young adult and 3 individual old mice were shipped on dry ice to Exiqon, Inc., which provided the service for RNA quality verification, microRNA array hybridization and comprehensive statistical analysis. The microarray data have been deposited in the NCBI Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo/) under accession no. GSE32935. Briefly, each pair of young adult and old mouse samples were labeled with Hy3 and Hy5 fluorescent dyes respectively and hybridized to a miRCURY LNA™ mouse microRNA Array (version 11.0), which held 648 mature microRNA probes, as well as perfectly matched and mismatched probes for quality control. After signal amplification, the background was subtracted and normalized using LOWESS (Locally Weighted Scatter plot Smoothing) regression algorithm. This within-slide normalization was performed to minimize differences between the colors in an intensity-dependent manner. The array output was received in Excel spreadsheets containing the normalized microRNA expression profiles in each heart sample; the expression comparison between old versus young adult heart samples and “Expression Matrix” containing normalized Hy3/Hy5 ratios (log2 transformed) from all hybridizations. The list was sorted based on the most variant expressed miRNAs comparing the two sample types. 65 miRNAs passed the filtering criteria with an average “log-Median-Ratio” >0.58, which represents at least >1.5-fold change in microRNA expression, and the microRNA expression in all three pairs (young adult versus old) was in the same direction.

Real-time RT-PCR quantitation of pri-miRNAs and mature miRNAs

To quantitate the expression of the miRNA primary transcripts and the miRNA mature forms, Real-time RT-PCR was performed. To select a proper internal loading control for RT-PCR, we examined the expression of 5S ribosomal RNA (5S RNA) and U6 snRNA in young adult versus old hearts. We found that the expression of 5S RNA remained unchanged in young adult vs. old, while U6 expression changed significantly in young adult vs. old hearts. Therefore, 5S RNA was used as an internal loading control.

Detection of pri-miRNAs.

The primers for the detection of pri-miRNAs were designed using PRISM Primer Express 3.0 software (Applied Biosystems), and synthesized at Integrated DNA Technologies Inc. The first-strand cDNA synthesis was carried out using random hexamer primer, and the PCR was performed using the following primers: pri-mir-17 forward 5′-gctttggctttttcctttttg-3′, pri-mir-17 reverse 5′-cctcactgcagtagatgcaca-3′; pri-mir-21 forward 5′-ccagagatgtttgctttgctt-3′, pri-mir-21 reverse 5′-tgccatgagattcaacagtca-3′; pri-mir-27a forward 5′- tttgatgccagtcacaaatca-3′, pri-mir-27a reverse 5′-agccactgtgaacacgacttt-3′; pri-mir-93 forward 5′-cacctcacctaatgaccctca-3′, pri-mir-93 reverse 5′-caagtcctagccctcatggat-3′; pri-mir-466d forward 5′- cacatgcaacacacacatatgaa-3′ and pri-mir-466d reverse 5′-ctgattctggcaagcattttc-3′.

Detection of mature miRNAs.

To detect the mature miRNA strand of either miR or miR*, the first-strand cDNA synthesis was carried out using a universal reverse primer and the Universal RT microRNA PCR system (Exiqon). The RT-PCR reagents and the primers for miR-17, miR-21, mir-21*, miR-27, miR-93, miR-466d-3p and the 5S RNA reference primers that were used as endogenous control were purchased from Exiqon.

The PCR amplification was performed in a 7900HT Fast Sequence Detector System (Applied Biosystems) with following program: Cycle 1, 95°C for 10 minutes. Cycle 2, 40 cycles of 95°C for 15 seconds, 60°C for 60 seconds. Cycle 3, 95°C for 15 seconds, 60°C for 15 seconds, 95°C for 15 seconds. CT values were automatically obtained. Relative expression values were obtained by normalizing CT values of the miRNA genes in comparison with CT values of the endogenous control (5S RNA) using the CT method [25], [26].

Transfection Assays

The Ago1 expression plasmid is a gift of Dr. E. K. L. Chan, and the Ago2 expression plasmid is a gift of Dr. T. Tuschl. The plasmid construct that contains the mir-21 gene was generated by PCR and cloning. Briefly, the DNA fragment containing mir-21 gene was amplified using forward primer 5′- tagaattc tgcccaggcttttatgtattg -3′ and reverse primer 5′- ta ctcgag ggcattgcttttcaagtatgg -3′, and then cloned into pCDNA3.1(+) vector. The DNA construct was confirmed by sequencing analysis.

The cardiac muscle cell line H9C2 was cultured in DMEM medium containing 10% newborn bovine serum (Invitrogen). Transient transfections were carried out with the Lipofectamine 2000 reagents (Invirogen) as previously described [24]. At 4 h after the transfection was initiated, the H9C2 cells were placed in Dulbecco's modified Eagle's medium with 10% newborn bovine serum and incubated overnight. The cells were then harvested and the total RNA was isolated using miRNeasy Mini kit (Qiagen) and RNase-free DNase I according to the manufacture's instruction manual. Individual transfection experiments were carried out in triplicate, and the results were reported as average (mean ± S.D.) from representative experiments.

Statistical analysis

Data are given as mean values ± SD, with n denoting the number of experiments unless otherwise indicated. The differentially expressed microRNAs with at least a 1.5-fold change were identified using a t-test with a cut off p-value (p<0.05).

Results

1. Differential expression of cardiac microRNAs in the aging heart

It has been reported that microRNA expression was altered in cardiac hypertrophy, congestive heart failure and also in senescent cells [27][31]. To test the hypothesis that the expression of microRNA may also change during cardiac aging, we compared microRNA profiles in the young adult (YA, 4-month-old) versus old (O, 24-month-od) mouse hearts. The Exiqon microRNA array (version 11.0) was employed for the microarray analysis.

An overview of the total microRNA expression in YA versus old hearts showed that the total microRNA signal intensity was 311248 in YA hearts versus 310447 in old hearts (Figure 1); there was no significant difference between the two age groups (NS, n = 3). However, the comparison of each individual microRNA expression between old and YA showed that 45% of the microRNAs were down-regulated in old versus YA, while 55% of the microRNAs were up-regulated in old versus YA (Figure 2, p<0,01, n = 3). These data indicate that while the expression of many of the individual microRNAs changed in advancing age, the healthy old heart was still able to keep the overall microRNA expression close to that of the YA heart.

thumbnail
Figure 1. The signal intensity of miRNAs expressed in the mouse heart.

There was no significant difference in the overall signal intensity of total microRNAs between young adult (YA) and old hearts.

https://doi.org/10.1371/journal.pone.0034688.g001

thumbnail
Figure 2. The number of miRNA that were differentially expressed in the heart.

Among the 599 microRNAs that were expressed in the heart, 272 miRNAs were down-regulated, while 327 miRNAs were up-regulated in the old compared with young adult hearts.

https://doi.org/10.1371/journal.pone.0034688.g002

To examine the miRNAs that were significantly altered during aging, the expression of miRNAs in YA versus old hearts were compared. It was found that the expression level of 65 miRNAs changed over 1.5-fold in old compared to that of YA hearts. Among them, 34 miRNAs were up-regulated, while 31 were down-regulated (Table 1 and Figure 3, 4).

thumbnail
Figure 3. The miRNAs that were increased during adult aging.

Thirty-four miRNAs were increased in old (O) vs. young adult (YA) hearts.

https://doi.org/10.1371/journal.pone.0034688.g003

thumbnail
Figure 4. The miRNAs that were decreased during adult aging.

Thirty-one miRNAs were decreased in old (O) vs. young adult (YA) hearts.

https://doi.org/10.1371/journal.pone.0034688.g004

thumbnail
Table 1. The 65 miRNAs that were differentially expressed in old versus young adult hearts.

https://doi.org/10.1371/journal.pone.0034688.t001

2. Multiple microRNA clusters are affected in the aging heart

The miRNA genes are distributed across chromosomes either individually, or in clusters. A miRNA cluster is a group of miRNA genes located within a short distance on a chromosome. Based on miRBase database (http://www.mirbase.org) definition, clustered miRNAs are a group of miRNA genes located within 10 Kb of distance on the same chromosome. To test the hypothesis that adult aging may affect both individually distributed miRNAs and the microRNAs in clusters, we examine the genomic location of the 65 miRNAs that were differentially expressed in the aged heart. We found that approximately one half of the differentially expressed miRNAs was individually distributed and the other half was in miRNA clusters.

The 32 miRNAs shown in Table 2 had 1.5-fold change in expression in old compared to that of YA hearts. The miRNA genes that corresponded to the 32 miRNA mature forms were in 11 clusters with their other cluster member(s) (Figure 5, 6, 7 and 8). Each clusters had at least 2 genes, with mir-466∼467∼669 cluster (cluster # 2) having 71 genes and mir-379∼410 cluster (cluster #7) having 38 genes. Since genes in a miRNA cluster may share a common gene promoter and may be regulated as a whole transcriptional unit, it could be of interest to determine whether any entire cluster changed in the same direction, either up or down. After examination, it was found that the majority of the miRNAs in 10 of the 11 clusters (all clusters except cluster #7, Figure 6C) tended to change in the same direction as the other members in that cluster (Figure 5, 6 and 7), although not all of them had a 1.5-fold change (p<0.01) in expression, and not every change was significant (p>0.05).

thumbnail
Figure 5. The miRNA gene clusters and their genomic structures of cluster #1∼cluster #4, which are part of 11 miRNA gene clusters shown in figure 5, 6 and 7.

The number of miRNA genes in each cluster ranged from 2 to 71. In 10 out of 11 clusters, the expression of most miRNA genes in that cluster was in the same direction (the arrow for increased expression, and the arrow for decreased expression). Please note that part of the miRNAs with changes in expression greater than 1.5 fold in old (O) vs. young adult (YA) hearts were listed in table 2.

https://doi.org/10.1371/journal.pone.0034688.g005

thumbnail
Figure 6. The miRNA gene clusters and their genomic structures of cluster #5∼cluster #8, which are part of 11 miRNA gene clusters shown in figure 5, 6 and 7.

The number of miRNA genes in each cluster ranged from 2 to 71. In 10 out of 11 clusters, the expression of most miRNA genes in that cluster was in the same direction (the arrow for increased expression, and the arrow for decreased expression). Only in one cluster, cluster #7 (Figure 6C), were most of the miRNA genes not expressed in the same direction. Please note that part of the miRNAs with changes in expression greater than 1.5 fold in old (O) vs. young adult (YA) hearts were listed in table 2.

https://doi.org/10.1371/journal.pone.0034688.g006

thumbnail
Figure 7. The miRNA gene clusters and their genomic structures of cluster #7∼cluster #11, which are part of 11 miRNA gene clusters shown in figure 5, 6 and 7.

The number of miRNA genes in each cluster ranged from 2 to 71. In 10 out of 11 clusters, the expression of most miRNA genes in that cluster was in the same direction (the arrow for increased expression, and the arrow for decreased expression). Please note that part of the miRNAs with changes in expression greater than 1.5 fold in old (O) vs. young adult (YA) hearts were listed in table 2.

https://doi.org/10.1371/journal.pone.0034688.g007

thumbnail
Figure 8. The 11 miRNA clusters that were affected during adult aging are located on 10 chromosomes.

Mouse×Chromosome contains 2 clusters (cluster #10 “mir-106a-92a-2” with 6 miRNA genes, and #11 “mir-222∼221” with 2 miRNA genes).

https://doi.org/10.1371/journal.pone.0034688.g008

3. Age-related changes in the expression of miRNA guide strands and their corresponding primary transcripts

The transcription of pri-miRNA is the first step in miRNA biogenesis [32]. Pri-miRNA is first cleaved by the microprocessor complex into pre-miRNA, which is then cleaved by the RNase III enzyme Dicer and become mature microRNAs as a guide strand (miR) and a passenger strand (miR*). During typical miRNA biogenesis, the miR strand is preferentially selected for entry into a RISC complex, whereas the miR* strand could be degraded [33][35]. To test the hypothesis that transcriptional regulation plays an important role in the regulation of the mature microRNA form, we examined pri-miRNA and miR with real-time PCR. As shown in Figure 9, the miRNA guide strand miR-17, miR-21, miR-27a and miR-93 had an age-related increase accordingly with their corresponding primary transcripts pri-mir-17, pri-mir-21, pri-mir-27 and pri-mir-93. Similarly, both mir-466d primary transcript and miR-466d-3p showed an age-related decrease in expression.

thumbnail
Figure 9. The expression of miRNAs correlated with that of their corresponding pri-miRNAs.

The mature form of miRNAs: miR-17, miR-21, miR-27 and miR-93 were up-regulated, as were their underlying pri-miRNAs in the old (O) vs. young adult (YA) hearts. The miR-466d-3p was down-regulated, as was also its pri-mir-466d.

https://doi.org/10.1371/journal.pone.0034688.g009

To further examine whether the expression of both pri-miRNA transcript and the miR strand change during maturation and aging, we compared the pri-mir-21 and the miR-21 levels in the mouse heart from 1 month to 24 months of age. As displayed in Figure 10, both miR-21 and pri-mir-21 levels showed no significant change from 1 month to 6 months of age, but started to increase after 6 months of age. Both miRNA forms reached their highest levels at the age of 18 months, then decreased afterwards; both curves showed a reversed “V” shape during adult aging.

thumbnail
Figure 10. The miR-21 expression correlated with pri-mir-21 levels from 1 month to 24 months of age.

https://doi.org/10.1371/journal.pone.0034688.g010

4. Age-related changes in the expression of miRNA passenger strand (miR*) in the mouse heart

In the cytoplasm, the pre-miRNA becomes cleaved by Dicer, which results in the formation of a 22 nt double-stranded miRNA duplex, with one being the guide strand (miR) and the other, the passenger strand (miR*). Recent deep-sequencing efforts indicate that a large number of miR*s are not degraded, but rather associate with Ago1 or Ago2 and remain functional [15], [17][20].

An age-related change in the expression of miRNA passenger strands was observed in the present study. Five miR*s: miR-21*, miR-24-2*, miR-138*, miR-297a*, miR-467b* and miR-467e*, were decreased at least 1.5-fold, while miR-24-2* was increased at least 1.5-fold in old versus YA hearts (Figure 11). Interestingly, the fold of change in expression of miR-21* was the highest among all 65 miRNAs that were differentially expressed in old versus YA hearts (Figure 4 and 11).

thumbnail
Figure 11. Altered expression of miR* during adult aging.

Six miR*s that were differentially expressed in old (O) vs young adult (YA) hearts.

https://doi.org/10.1371/journal.pone.0034688.g011

The level of miR-21* strand was examined in comparison with miR-21 and pri-mir-21 transcript from 1 month to 24 months of age. As shown in Figure 12, the miR-21* expression level did not undergo significant change from 1 month to 9 months of age, but increased thereafter, and reached the highest level at age 18 months. However, its expression level reduced to its lowest level at 24 months of age. The miR-21* expression curve during adult aging resembles a reverse “V” shape (Figure 12), which is similar to what was observed in the miR-21 and pri-mir-21 expression curves. These data suggest that the primary transcript expression level affects both miR-21 and miR-21* levels.

thumbnail
Figure 12. The miR-21* passenger strand expression in comparison with miR-21guide strand and pri-mir-21 transcript in mouse hearts, from 1 month to 24 months of age.

https://doi.org/10.1371/journal.pone.0034688.g012

Bioinformatic analysis using MicroCosm Target Scan (http://www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5/#) revealed that mmu-miR-21* had 879 potential target hits, while Mmu-miR-21 had 894 hits, 95% of them are not overlapped. This finding suggest that the passenger strand is not always passive, but at least in some cases, has an important regulatory role in gene expression as well.

5. Age-related change in the expression of Ago1 and Ago2

Argonaute proteins have endonuclease activity directed against messenger RNA strands that are complementary to their bound miRNA fragments. Argonaut proteins are also partially responsible for selection of the guide strand and destruction of the passenger strand. To test the hypothesis that Argonaute expression may change, thereby affecting both miR and miR* expression level during adult aging, we examined the expression of Ago1 and Ago2 genes during development, maturation and adult aging by real-time RT-PCR. As shown in Figure 13, Ago1 expression level was increased from 1 to 2 months of age and remained at that level from 2 months to 11 months, then reached the highest level at age of 18 months. Afterward, its level was decreased. The Ago2 expression stayed at the same level from 1 month to 11 months of age, increased after 11 months of age and reached the highest level at 18 months of age. It then was also reduced after 18 months. Both the Ago1 and Ago2 expression levels resembled a reversed “V” shape during adult aging from 11 months to 20 months of age.

thumbnail
Figure 13. The expression of Argonaute genes.

The cardiac expression of Ago1 and Ago2 in the mouse, from 1 month to 24 months of age.

https://doi.org/10.1371/journal.pone.0034688.g013

To test the effect of Ago1 and Ago2 on the expression of miR-21 and miR-21*, the Ago1 or Ago2 expression plasmid vector was transfected into cells derived from a cardiac muscle cell line, H9C2. As shown in Figure 14 and 15, the overexpression of Ago1 or Ago2 induced the expression of miR-21 or miR-21*, respectively. In addition, both Ago1 and Ago2 synergistically induced miR-21 and miR-21* when the mir-21 plasmid vector was co-transfected with either.

thumbnail
Figure 14. The effect of Ago1 and Ago2 on the expression of miR-21.

In the transfection assays, the cells were transfected with empty vector (Control), or Ago1, Ago2, mir-21, Ago1 and mir-21 as well as Ago2 and mir-21. The miR-21 guide strand was upregulated by Ago1, Ago2, mir-21 gene, Ago1 and mir-21 as well as Ago2 and mir-21 gene. The data indicated that Ago1 and Ago2 synergistically upregulated miR-21 guide strand when mir-21 gene was increased. # refers to p<0.05, n = 3. ## refers to p<0.01, n = 3.

https://doi.org/10.1371/journal.pone.0034688.g014

thumbnail
Figure 15. The effect of Ago1 and Ago2 on the expression of miR-21*.

In the transfection assays, the cells were transfected with empty vector (Control), or Ago1, Ago2, mir-21, Ago1 and mir-21 as well as Ago2 and mir-21. The miR-21* passenger strand was upregulated by Ago1, Ago2, mir-21 gene, Ago1 and mir-21 as well as Ago2 and mir-21 gene. The data indicated that Ago1 and Ago2 synergistically upregulated miR-21* passenger strand when mir-21 gene was increased. # refers to p<0.05, n = 3. ## refers to p<0.01, n = 3.

https://doi.org/10.1371/journal.pone.0034688.g015

Discussion

The present study has several major findings. We found that adult aging significantly impacted the expression of 65 miRNAs in the heart; among them 55% miRNAs were increased, while 45% miRNAs were decreased in the old versus young adult hearts. Interestingly, over half of these differentially expressed miRNAs belong to 11 miRNA clusters, suggesting that these clusters participate in the complex regulation of cardiac gene expression during adult life. We also observed age-related changes in the expression of pri-miRNA transcript and Ago genes, which likely contribute to age-related changes in both miR and miR* expression in the heart. These data enhance our understanding of the complex mechanism(s) underlying the altered expression of miRNA during adult aging.

In the present study, half of the miRNAs that are significantly impacted during adult aging belong to 11 miRNA clusters, suggesting the importance of understanding the structure and function of these miRNA clusters. A miRNA cluster is a group of miRNA genes located within a short distance on a chromosome. Many of the miRNA clusters may have one core promoter region and transcriptional start site shared by all miRNA genes within that cluster and were ultimately expressed within a single RNA transcript [36]. The length of the transcript typically varies from a couple of kb to over 10 kb. For instance, the polycistronic transcript of mir-1-1 and mir-133a2 cluster is 10 kb; the mir-1-2 and mir-133a1 cluster is 6 kb [24]. It has been reported that each miRNA cluster usually has 2–3 miRNA genes, with the majority of clusters having less than 10 miRNA genes [37]. However, some clusters could have more than 10 miRNA genes. For example, Hertel reported that mir-134 cluster has more than 50 miRNA genes [37]. In the present study, we found that the miR-379∼329∼667∼410 cluster has 38 mir genes, while the miR-466∼467∼669 cluster, being one of the largest miRNA clusters in mouse genome, has 71 miRNA genes. Although a number of miRNA clusters have been reported to be associated with pathological and physiological conditions, the overall expression pattern of miRNA clusters during adult aging has not been extensively studied. Since many miRNA genes within a cluster share a common promoter or utilize a common regulatory machinery, examination of their expression pattern and regulatory mechanism could enhance our understanding of the role of miRNAs in the process of adult aging.

The effects of these altered microRNAs and miRNA clusters on target gene expression during adult aging and senescence warrant further investigation. Exogenous miRNAs can be introduced into live cells or animals; likewise, endogenous miRNAs can also be knocked-down or deleted in cells or animals with various approaches. However, the effects of the various approaches might not be the same [38]. It is believed that the length of the 3′ untranslated regions (3′ UTRs) of the target messenger RNAs, the cellular proliferative status, and the abundance of target messenger RNA may affect miRNA regulation [39][42]. For instance, functional miRNA target sites tend to reside in 3′ UTRs, therefore the length of the 3′ UTRs often correlates with density of the miRNA target sites [41], [43]. Highly proliferating cells usually express more messenger RNAs with shorter 3′ UTRs, which might escape miRNA targeting, whereas low proliferating cells, including senescent cells, may express miRNAs with longer 3′ UTRs [39][41]. In addition, transfected (exogenous) miRNAs may compete with endogenous miRNAs for the same protein complex, including RISC protein complex that is needed for miRNA regulation. Therefore, genes that are only targeted by endogenous miRNAs but not by the exogenous miRNA may end up relatively increased [44]. In addition, the target messenger RNA abundance could potentially dilute microRNA and siRNA activity, thereby reducing the effectiveness of miRNA regulation [45]. Nevertheless, miRNA transfection assays have been shown to target various messenger RNAs and intracellular pathways. For example, miR-494 down-regulates IGF2BP1 and induces cellular senescence in A549 cell line [46]. In neural stem cells, miR-106b∼25 target the insulin/insulin-like growth factor-1 (IGF) signaling pathways and promote neuron growth [47]. These factors (various approaches of knock-down vs. deletion, cellular proliferative status, length of 3′ UTR of target, and abundance of messenger RNA target) all contribute to the reported and potentially other differences that may result from “aging” in vitro or in vivo, in the experimental models being used.

The present study suggests that most miRNA clusters are likely to be regulated at the cluster level by certain common signaling pathway(s). The combined effects of changes in expression of an entire miRNA cluster warrant further investigation. In addition, whether the altered miRNA expression, alone or in clusters, might be causal or contributory to myocardial aging remains to be determined.

One of the 11 miRNA clusters uncovered in the present study is the cluster miR-17–92. The miR-17–92 cluster is comprised of 6 miRNA genes: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92–1, all of which are located on chromosome 14 in the mouse. The human ortholog of miR-17-92 is indeed expressed within a single expressed sequence tag (EST), chr13orf25. In addition, the sequence upstream of the putative transcriptional start site is highly conserved across vertebrate genomes and contains an extensive CpG island, indicative of a core promoter region [36].

The miR-17-92 cluster has been implicated not only in cell proliferation and tumor growth, but also in cellular senescence. Increased expression of miR-17-92 cluster is usually associated with oncogenesis, cell growth and proliferation, while decreased expression of miR-19 and other members of the miR-17-92 cluster are generally associated with cellular senescence [48][50]. However, in the older heart, decreased expression of miR-17-92 cluster had been observed only in failure-prone (C57Bl6×129Sv) mouse and human failing heart, but not in healthy aging heart [51]. In addition, the change in expression of miR-17-92 cluster is only observed in cardiac myocytes, but not in fibroblasts [51]. In the present study, the miR-17-92 cluster is up-regulated in the old heart of the C57BL6 mouse that is free of disease. This increased miR-17-92 cluster expression in the present study is likely correlated with the age-related hypertrophy of the cardiac myocytes in the old heart. It would be of interest to perform transfection assays to determine if up-regulation of this cluster might reproduce changes that would be similar to the observed age-related differences. However, it is possible that a broad range of genes would be affected if all 6 miRNA genes were to be simultaneously overexpressed by transfection. Future studies of this cluster will be helpful to delineate the effects on their target genes.

Two other clusters, miR-23a∼27a∼24-2 and mir-23b-27b-24-1, each containing three miRNA genes, were observed in the present study to be up-regulated to different degrees in the old versus young adult heart. It has been reported that the expression levels of 23a-27a-24–2 cluster members are significantly up-regulated upon treatment with isoproterenol and aldosterone, but only miR-23a participates in initiating the hypertrophic response [52]. miR-23a, miR-27b were also induced during early hypertrophic growth in response to pressure-overload [53], [54]. The miRNA genes in these clusters are important for cardiac development and maturation [55], [56]. The present study revealed that the miRNAs in these two clusters might also play a role in the cardiac aging process.

The miR-466∼467∼669 cluster is one of the largest miRNA clusters in the mouse genome, containing 71 miRNA genes. It is embedded in the intron of the Scm-like with four mbt domains 2 (Sfmbt2) gene. Sfmbt2 is a mouse and human homologue of Polycomb group (PcG) gene. Sfmbt2 is located on proximal chromosome 2, in a region known to be imprinted [57], [58]. Sfmbt2 is expressed preferentially from the paternal allele in early embryos and in later stage extra-embryonic tissues. This is partly due to the fact that a CpG island spanning the transcriptional start site is differentially methylated on the maternal allele during embryogenesis [57].

Although insight into the regulatory function of miRNAs toward their messenger RNA targets are continuing to emerge, less is currently known about the regulation of miRNA gene expression and miRNA biogenesis [14], [24]. To date, hundreds of miRNAs have been discovered in mammalian genomes. Approximately 50% of mammalian miRNAs are “intragenic miRNAs” that are located in introns or exons of protein coding genes; the other half of the miRNAs are “intergenic” miRNAs that are derived from pri-miRNAs expressed from intergenic regions where a stretch of DNA sequences located in the chromosomal region referred as junk DNA region that contain few or no protein-coding genes [59], [60]. It is generally believed that intragenic miRNAs are co-transcribed with their host genes, while most intergenic miRNAs are transcribed from their own RNA polymerase II (Pol II) promoter. However, recent studies indicate that as much as 26% of the intragenic miRNAs may be transcribed from their own unique promoters even though they are physically located within protein coding genes. The miRNA gene promoters have similar features to those of protein coding genes, but miRNA transcript organization is more complex [60]. In the present study, we observed that the expression of pri-miRNA levels change during adult aging, which correlates with the level of miRNA, suggesting that transcription regulation likely impacts miRNA biogenesis.

Argonaute proteins are key effectors of small RNA-mediated regulatory pathways that modulate gene expression and regulate various cellular functions, and are essential for development, differentiation and maturation [61], [62]. The structure of Ago proteins is well conserved, consisting of an amino-terminal domain, the MID domain, and their signature PAZ and Piwi domains [61], [62]. Argonaute proteins form the core of RNA-induced silencing complexes (RISCs). Mice and humans generate four Ago proteins, but only Ago2 appears to retain the ability to cleave RNA targets. Whether the functions of Ago1, Ago3, and Ago4 might differ is not clear [62], [63]. Ago1 and Ago2 are the two proteins that have been more extensively studied. Ago1 selectively binds to microRNAs, while Ago2 binds to both microRNAs and siRNAs [15]. MicroRNA duplexes are intrinsically asymmetric, with the guide strand preferentially entering Ago1-RISC complex, while the miR* strand is usually loaded as functional species into Ago2-RISC complex [15]. It has been shown that the miR* strand can silence its messenger RNA targets both in vitro and in-vivo. Therefore, each microRNA precursor can potentially produce two mature strands (miR and miR*) that are differentially sorted into Ago1-mediated or Ago2-mediated RNA interference (RNAi) pathways, respectively.

In addition to being key components in the RISC complex that are responsible for gene silencing, Ago proteins also play a role in maintaining a proper level of mature miRNA strands, which was initially revealed by gene targeting against Ago1 and Ago2 genes. When Ago1 was depleted, a significant reduction in miR strands and an unexpected concomitant increase in the levels of target messenger RNAs were observed. When Ago2 was depleted, a reduction of endogenous siRNA and miR* levels was observed, however, the miR strand levels were unaffected. Recent studies further indicate that Ago proteins stabilize miRNAs, either within living cells or after the miRNAs are released from cells into the bloodstream [64][66].

In the present study, the in-vitro transfection experiments suggest that increased expression of Ago1 and/or Ago2 genes contribute to the altered levels of miR-21 and miR-21* in the cells. The in vivo data from mouse hearts revealed age-related changes in the expression of Ago1 and Ago2 genes. However, the Ago1 and miR-21* gene expression were decreased in 24-month-old mouse hearts vs. 4 month-old hearts; while Ago2 expression was increased in 24-month-old mouse hearts vs. 4 month-old hearts. We also observed that some miRNAs were down-regulated in the 24-month-old vs. 4-month-old hearts. It is plausible that the degree of down-regulation of Ago1 and up-regulation of Ago2, the length of the 3′ UTR of the target, the relative abundance of the endogenous miRNA of interest, and the relative abundance of the target messenger RNA might influence the down-regulation of the miRNAs/clusters. In addition, some miRNAs are processed through a non-canonical miRNA biogenesis pathway that might not require Ago proteins [67], [68].

Taken together, we propose a model of miRNA expression in the aging heart where miRNAs are regulated by the levels of Ago proteins and miRNA primary transcripts. In this model, the Ago proteins bind to the miRNA to stabilize the miRNAs while the pri-miRNA transcripts upregulate synthesis of miRNAs, thereby resulting in a synergistic effect when both are increased (Figure 16).

thumbnail
Figure 16. Schematic representation of a model of miRNA expression, which is regulated by transcriptional regulation and other factors, such as Ago proteins.

The major change in expression of the miRNA biogenesis components occurred during later adulthood. miRs: both miR and miR*. Pri-miRNAs: the primary miRNA transcripts. Agos: the Argonaute proteins. Month: the mouse age (from 1–24 months in the present study). Adult Aging is a process that spans many decades in human beings and, similarly, many months in rodents. To translate human aging with a much longer life span into rodent years may be fraught with complexities. However, in general, adult aging might be arbitrarily divided into an earlier phase (humans between approximately 20 and 39 years and in C57BL6 mouse strain between 4 and 10 mo), a middle phase (humans between approximately 40 and 59 years and in C57BL6 between approximately 11 and 22 mo), and a later phase (humans between 60 and 79 years and in C57BL6 between 23 and 35 mo). Senescence (the age at which 50% of the populations has died) occurs in humans at around 79–80 yrs, and in C57BL6 mice at around 35–36 months. Of course, with the progressively changing demographics and aging of the population, these arbitrary divisions of what might be considered “early” or “late” aging will likely undergo revision and change.

https://doi.org/10.1371/journal.pone.0034688.g016

Acknowledgments

We thank Dr. E. K. L. Chan, Dr. T. Tuschl and Dr. C. D. Novina for Ago1 and Ago2 plasmid constructs. We thank S. Luo for his helpful input.

Author Contributions

Conceived and designed the experiments: XMZ JYW. Performed the experiments: XMZ. Analyzed the data: XMZ GA JYW. Contributed reagents/materials/analysis tools: XMZ GA JYW. Wrote the paper: XMZ GA JYW. Participated in the coordination of the study: GA. Led the study: JYW. Overall interpretation of results: JYW. Read and approved the final manuscript: XMZ GA JYW.

References

  1. 1. Pugh KG, Wei JY (2001) Clinical implications of physiological changes in the aging heart. Drugs Aging 18: 263–276.KG PughJY Wei2001Clinical implications of physiological changes in the aging heart.Drugs Aging18263276
  2. 2. Zhang X, Azhar G, Furr MC, Zhong Y, Wei JY (2003) Model of functional cardiac aging: young adult mice with mild overexpression of serum response factor. Am J Physiol Regul Integr Comp Physiol 285: R552–560.X. ZhangG. AzharMC FurrY. ZhongJY Wei2003Model of functional cardiac aging: young adult mice with mild overexpression of serum response factor.Am J Physiol Regul Integr Comp Physiol285R552560
  3. 3. Wei JY, Levkoff S (2000) Aging Well: The Complete Guide to Physical and Emotional Health. New York, NY: Wiley. JY WeiS. Levkoff2000Aging Well: The Complete Guide to Physical and Emotional HealthNew York, NYWiley
  4. 4. Vijg J, Wei JY (1995) Understanding the biology of aging: the key to prevention and therapy. J Am Geriatr Soc 43: 426–434.J. VijgJY Wei1995Understanding the biology of aging: the key to prevention and therapy.J Am Geriatr Soc43426434
  5. 5. Kimball KA, Cornett LE, Seifen E, Kennedy RH (1991) Aging: changes in cardiac alpha 1-adrenoceptor responsiveness and expression. Eur J Pharmacol 208: 231–238.KA KimballLE CornettE. SeifenRH Kennedy1991Aging: changes in cardiac alpha 1-adrenoceptor responsiveness and expression.Eur J Pharmacol208231238
  6. 6. Chevalier B, Charlemagne D, Callens-el Amrani F, Carre F, Moalic JM, et al. (1992) The membrane proteins of the overloaded and senescent heart. Basic Res Cardiol 87: Suppl 1187–197.B. ChevalierD. CharlemagneF. Callens-el AmraniF. CarreJM Moalic1992The membrane proteins of the overloaded and senescent heart.Basic Res Cardiol87Suppl 1187197
  7. 7. Carrier L, Boheler KR, Chassagne C, de la Bastie D, Wisnewsky C, et al. (1992) Expression of the sarcomeric actin isogenes in the rat heart with development and senescence. Circ Res 70: 999–1005.L. CarrierKR BohelerC. ChassagneD. de la BastieC. Wisnewsky1992Expression of the sarcomeric actin isogenes in the rat heart with development and senescence.Circ Res709991005
  8. 8. Besse S, Assayag P, Delcayre C, Carre F, Cheav SL, et al. (1993) Normal and hypertrophied senescent rat heart: mechanical and molecular characteristics. Am J Physiol 265: H183–190.S. BesseP. AssayagC. DelcayreF. CarreSL Cheav1993Normal and hypertrophied senescent rat heart: mechanical and molecular characteristics.Am J Physiol265H183190
  9. 9. Ball KL, Solaro RJ (1994) Discoordinate regulation of contractile protein gene expression in the senescent rat myocardium. J Mol Cell Cardiol 26: 519–525.KL BallRJ Solaro1994Discoordinate regulation of contractile protein gene expression in the senescent rat myocardium.J Mol Cell Cardiol26519525
  10. 10. Younes A, Boluyt MO, O'Neill L, Meredith AL, Crow MT, et al. (1995) Age-associated increase in rat ventricular ANP gene expression correlates with cardiac hypertrophy. Am J Physiol 269: H1003–1008.A. YounesMO BoluytL. O'NeillAL MeredithMT Crow1995Age-associated increase in rat ventricular ANP gene expression correlates with cardiac hypertrophy.Am J Physiol269H10031008
  11. 11. Lanceta J, Prough RA, Liang R, Wang E (2010) MicroRNA group disorganization in aging. Exp Gerontol 45: 269–278.J. LancetaRA ProughR. LiangE. Wang2010MicroRNA group disorganization in aging.Exp Gerontol45269278
  12. 12. Chen LH, Chiou GY, Chen YW, Li HY, Chiou SH (2010) microRNA and aging: a novel modulator in regulating the aging network. Ageing Res Rev 9: Suppl 1S59–66.LH ChenGY ChiouYW ChenHY LiSH Chiou2010microRNA and aging: a novel modulator in regulating the aging network.Ageing Res Rev9Suppl 1S5966
  13. 13. Drummond MJ, McCarthy JJ, Sinha M, Spratt HM, Volpi E, et al. (2011) Aging and microRNA expression in human skeletal muscle: a microarray and bioinformatics analysis. Physiol Genomics 43: 595–603.MJ DrummondJJ McCarthyM. SinhaHM SprattE. Volpi2011Aging and microRNA expression in human skeletal muscle: a microarray and bioinformatics analysis.Physiol Genomics43595603
  14. 14. Winter J, Jung S, Keller S, Gregory RI, Diederichs S (2009) Many roads to maturity: microRNA biogenesis pathways and their regulation. Nat Cell Biol 11: 228–234.J. WinterS. JungS. KellerRI GregoryS. Diederichs2009Many roads to maturity: microRNA biogenesis pathways and their regulation.Nat Cell Biol11228234
  15. 15. Czech B, Zhou R, Erlich Y, Brennecke J, Binari R, et al. (2009) Hierarchical rules for Argonaute loading in Drosophila. Mol Cell 36: 445–456.B. CzechR. ZhouY. ErlichJ. BrenneckeR. Binari2009Hierarchical rules for Argonaute loading in Drosophila.Mol Cell36445456
  16. 16. Siomi H, Siomi MC (2010) Posttranscriptional regulation of microRNA biogenesis in animals. Mol Cell 38: 323–332.H. SiomiMC Siomi2010Posttranscriptional regulation of microRNA biogenesis in animals.Mol Cell38323332
  17. 17. Ghildiyal M, Xu J, Seitz H, Weng Z, Zamore PD (2010) Sorting of Drosophila small silencing RNAs partitions microRNA* strands into the RNA interference pathway. Rna 16: 43–56.M. GhildiyalJ. XuH. SeitzZ. WengPD Zamore2010Sorting of Drosophila small silencing RNAs partitions microRNA* strands into the RNA interference pathway.Rna164356
  18. 18. Okamura K, Liu N, Lai EC (2009) Distinct mechanisms for microRNA strand selection by Drosophila Argonautes. Mol Cell 36: 431–444.K. OkamuraN. LiuEC Lai2009Distinct mechanisms for microRNA strand selection by Drosophila Argonautes.Mol Cell36431444
  19. 19. Okamura K, Phillips MD, Tyler DM, Duan H, Chou YT, et al. (2008) The regulatory activity of microRNA* species has substantial influence on microRNA and 3′ UTR evolution. Nat Struct Mol Biol 15: 354–363.K. OkamuraMD PhillipsDM TylerH. DuanYT Chou2008The regulatory activity of microRNA* species has substantial influence on microRNA and 3′ UTR evolution.Nat Struct Mol Biol15354363
  20. 20. Seitz H, Ghildiyal M, Zamore PD (2008) Argonaute loading improves the 5′ precision of both MicroRNAs and their miRNA* strands in flies. Curr Biol 18: 147–151.H. SeitzM. GhildiyalPD Zamore2008Argonaute loading improves the 5′ precision of both MicroRNAs and their miRNA* strands in flies.Curr Biol18147151
  21. 21. Lewis BP, Burge CB, Bartel DP (2005) Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120: 15–20.BP LewisCB BurgeDP Bartel2005Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets.Cell1201520
  22. 22. Zamore PD, Haley B (2005) Ribo-gnome: the big world of small RNAs. Science 309: 1519–1524.PD ZamoreB. Haley2005Ribo-gnome: the big world of small RNAs.Science30915191524
  23. 23. Zhang X, Azhar G, Zhong Y, Wei JY (2004) Identification of a novel serum response factor cofactor in cardiac gene regulation. J Biol Chem 279: 55626–55632.X. ZhangG. AzharY. ZhongJY Wei2004Identification of a novel serum response factor cofactor in cardiac gene regulation.J Biol Chem2795562655632
  24. 24. Zhang X, Azhar G, Helms SA, Wei JY (2011) Regulation of cardiac microRNAs by serum response factor. J Biomed Sci 18: 15.X. ZhangG. AzharSA HelmsJY Wei2011Regulation of cardiac microRNAs by serum response factor.J Biomed Sci1815
  25. 25. Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3: 1101–1108.TD SchmittgenKJ Livak2008Analyzing real-time PCR data by the comparative C(T) method.Nat Protoc311011108
  26. 26. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402–408.KJ LivakTD Schmittgen2001Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.Methods25402408
  27. 27. Sayed D, Hong C, Chen IY, Lypowy J, Abdellatif M (2007) MicroRNAs play an essential role in the development of cardiac hypertrophy. Circ Res 100: 416–424.D. SayedC. HongIY ChenJ. LypowyM. Abdellatif2007MicroRNAs play an essential role in the development of cardiac hypertrophy.Circ Res100416424
  28. 28. Thum T, Galuppo P, Wolf C, Fiedler J, Kneitz S, et al. (2007) MicroRNAs in the human heart: a clue to fetal gene reprogramming in heart failure. Circulation 116: 258–267.T. ThumP. GaluppoC. WolfJ. FiedlerS. Kneitz2007MicroRNAs in the human heart: a clue to fetal gene reprogramming in heart failure.Circulation116258267
  29. 29. Vasa-Nicotera M, Chen H, Tucci P, Yang AL, Saintigny G, et al. (2011) miR-146a is modulated in human endothelial cell with aging. Atherosclerosis 217: 326–330.M. Vasa-NicoteraH. ChenP. TucciAL YangG. Saintigny2011miR-146a is modulated in human endothelial cell with aging.Atherosclerosis217326330
  30. 30. Grillari J, Grillari-Voglauer R (2010) Novel modulators of senescence, aging, and longevity: Small non-coding RNAs enter the stage. Exp Gerontol 45: 302–311.J. GrillariR. Grillari-Voglauer2010Novel modulators of senescence, aging, and longevity: Small non-coding RNAs enter the stage.Exp Gerontol45302311
  31. 31. Martinez I, Cazalla D, Almstead LL, Steitz JA, DiMaio D (2011) miR-29 and miR-30 regulate B-Myb expression during cellular senescence. Proc Natl Acad Sci U S A 108: 522–527.I. MartinezD. CazallaLL AlmsteadJA SteitzD. DiMaio2011miR-29 and miR-30 regulate B-Myb expression during cellular senescence.Proc Natl Acad Sci U S A108522527
  32. 32. Cullen BR (2004) Transcription and processing of human microRNA precursors. Mol Cell 16: 861–865.BR Cullen2004Transcription and processing of human microRNA precursors.Mol Cell16861865
  33. 33. Shomron N, Levy C (2009) MicroRNA-biogenesis and Pre-mRNA splicing crosstalk. J Biomed Biotechnol 2009: 594678.N. ShomronC. Levy2009MicroRNA-biogenesis and Pre-mRNA splicing crosstalk.J Biomed Biotechnol2009594678
  34. 34. Winter J, Diederichs S (2011) Argonaute proteins regulate microRNA stability: Increased microRNA abundance by Argonaute proteins is due to microRNA stabilization. RNA Biol 8: 1149–1157.J. WinterS. Diederichs2011Argonaute proteins regulate microRNA stability: Increased microRNA abundance by Argonaute proteins is due to microRNA stabilization.RNA Biol811491157
  35. 35. Wang B, Li S, Qi HH, Chowdhury D, Shi Y, et al. (2009) Distinct passenger strand and mRNA cleavage activities of human Argonaute proteins. Nat Struct Mol Biol 16: 1259–1266.B. WangS. LiHH QiD. ChowdhuryY. Shi2009Distinct passenger strand and mRNA cleavage activities of human Argonaute proteins.Nat Struct Mol Biol1612591266
  36. 36. Woods K, Thomson JM, Hammond SM (2007) Direct regulation of an oncogenic micro-RNA cluster by E2F transcription factors. J Biol Chem 282: 2130–2134.K. WoodsJM ThomsonSM Hammond2007Direct regulation of an oncogenic micro-RNA cluster by E2F transcription factors.J Biol Chem28221302134
  37. 37. Hertel J, Lindemeyer M, Missal K, Fried C, Tanzer A, et al. (2006) The expansion of the metazoan microRNA repertoire. BMC Genomics 7: 25.J. HertelM. LindemeyerK. MissalC. FriedA. Tanzer2006The expansion of the metazoan microRNA repertoire.BMC Genomics725
  38. 38. Morrisey EE (2010) The magic and mystery of miR-21. J Clin Invest 120: 3817–3819.EE Morrisey2010The magic and mystery of miR-21.J Clin Invest12038173819
  39. 39. Sandberg R, Neilson JR, Sarma A, Sharp PA, Burge CB (2008) Proliferating cells express mRNAs with shortened 3′ untranslated regions and fewer microRNA target sites. Science 320: 1643–1647.R. SandbergJR NeilsonA. SarmaPA SharpCB Burge2008Proliferating cells express mRNAs with shortened 3′ untranslated regions and fewer microRNA target sites.Science32016431647
  40. 40. Mayr C, Bartel DP (2009) Widespread shortening of 3′UTRs by alternative cleavage and polyadenylation activates oncogenes in cancer cells. Cell 138: 673–684.C. MayrDP Bartel2009Widespread shortening of 3′UTRs by alternative cleavage and polyadenylation activates oncogenes in cancer cells.Cell138673684
  41. 41. Bartel DP (2009) MicroRNAs: target recognition and regulatory functions. Cell 136: 215–233.DP Bartel2009MicroRNAs: target recognition and regulatory functions.Cell136215233
  42. 42. Saito T, Saetrom P (2012) Target gene expression levels and competition between transfected and endogenous microRNAs are strong confounding factors in microRNA high-throughput experiments. Silence 3: 3.T. SaitoP. Saetrom2012Target gene expression levels and competition between transfected and endogenous microRNAs are strong confounding factors in microRNA high-throughput experiments.Silence33
  43. 43. Friedman RC, Farh KK, Burge CB, Bartel DP (2009) Most mammalian mRNAs are conserved targets of microRNAs. Genome Res 19: 92–105.RC FriedmanKK FarhCB BurgeDP Bartel2009Most mammalian mRNAs are conserved targets of microRNAs.Genome Res1992105
  44. 44. Khan AA, Betel D, Miller ML, Sander C, Leslie CS, et al. (2009) Transfection of small RNAs globally perturbs gene regulation by endogenous microRNAs. Nat Biotechnol 27: 549–555.AA KhanD. BetelML MillerC. SanderCS Leslie2009Transfection of small RNAs globally perturbs gene regulation by endogenous microRNAs.Nat Biotechnol27549555
  45. 45. Arvey A, Larsson E, Sander C, Leslie CS, Marks DS (2010) Target mRNA abundance dilutes microRNA and siRNA activity. Mol Syst Biol 6: 363.A. ArveyE. LarssonC. SanderCS LeslieDS Marks2010Target mRNA abundance dilutes microRNA and siRNA activity.Mol Syst Biol6363
  46. 46. Ohdaira H, Sekiguchi M, Miyata K, Yoshida K (2012) MicroRNA-494 suppresses cell proliferation and induces senescence in A549 lung cancer cells. Cell Prolif 45: 32–38.H. OhdairaM. SekiguchiK. MiyataK. Yoshida2012MicroRNA-494 suppresses cell proliferation and induces senescence in A549 lung cancer cells.Cell Prolif453238
  47. 47. Brett JO, Renault VM, Rafalski VA, Webb AE, Brunet A (2011) The microRNA cluster miR-106b∼25 regulates adult neural stem/progenitor cell proliferation and neuronal differentiation. Aging (Albany NY) 3: 108–124.JO BrettVM RenaultVA RafalskiAE WebbA. Brunet2011The microRNA cluster miR-106b∼25 regulates adult neural stem/progenitor cell proliferation and neuronal differentiation.Aging (Albany NY)3108124
  48. 48. Grillari J, Hackl M, Grillari-Voglauer R (2010) miR-17-92 cluster: ups and downs in cancer and aging. Biogerontology 11: 501–506.J. GrillariM. HacklR. Grillari-Voglauer2010miR-17-92 cluster: ups and downs in cancer and aging.Biogerontology11501506
  49. 49. Hackl M, Brunner S, Fortschegger K, Schreiner C, Micutkova L, et al. (2011) miR-17, miR-19b, miR-20a, and miR-106a are down-regulated in human aging. Aging Cell 9: 291–296.M. HacklS. BrunnerK. FortscheggerC. SchreinerL. Micutkova2011miR-17, miR-19b, miR-20a, and miR-106a are down-regulated in human aging.Aging Cell9291296
  50. 50. Li G, Luna C, Qiu J, Epstein DL, Gonzalez P (2009) Alterations in microRNA expression in stress-induced cellular senescence. Mech Ageing Dev 130: 731–741.G. LiC. LunaJ. QiuDL EpsteinP. Gonzalez2009Alterations in microRNA expression in stress-induced cellular senescence.Mech Ageing Dev130731741
  51. 51. van Almen GC, Verhesen W, van Leeuwen RE, van de Vrie M, Eurlings C, et al. (2011) MicroRNA-18 and microRNA-19 regulate CTGF and TSP-1 expression in age-related heart failure. Aging Cell 10: 769–779.GC van AlmenW. VerhesenRE van LeeuwenM. van de VrieC. Eurlings2011MicroRNA-18 and microRNA-19 regulate CTGF and TSP-1 expression in age-related heart failure.Aging Cell10769779
  52. 52. Lin Z, Murtaza I, Wang K, Jiao J, Gao J, et al. (2009) miR-23a functions downstream of NFATc3 to regulate cardiac hypertrophy. Proc Natl Acad Sci U S A 106: 12103–12108.Z. LinI. MurtazaK. WangJ. JiaoJ. Gao2009miR-23a functions downstream of NFATc3 to regulate cardiac hypertrophy.Proc Natl Acad Sci U S A1061210312108
  53. 53. Busk PK, Cirera S (2010) MicroRNA profiling in early hypertrophic growth of the left ventricle in rats. Biochem Biophys Res Commun 396: 989–993.PK BuskS. Cirera2010MicroRNA profiling in early hypertrophic growth of the left ventricle in rats.Biochem Biophys Res Commun396989993
  54. 54. Han M, Toli J, Abdellatif M (2011) MicroRNAs in the cardiovascular system. Curr Opin Cardiol 26: 181–189.M. HanJ. ToliM. Abdellatif2011MicroRNAs in the cardiovascular system.Curr Opin Cardiol26181189
  55. 55. Nishi H, Ono K, Horie T, Nagao K, Kinoshita M, et al. (2011) MicroRNA-27a regulates beta cardiac myosin heavy chain gene expression by targeting thyroid hormone receptor beta1 in neonatal rat ventricular myocytes. Mol Cell Biol 31: 744–755.H. NishiK. OnoT. HorieK. NagaoM. Kinoshita2011MicroRNA-27a regulates beta cardiac myosin heavy chain gene expression by targeting thyroid hormone receptor beta1 in neonatal rat ventricular myocytes.Mol Cell Biol31744755
  56. 56. Chinchilla A, Lozano E, Daimi H, Esteban FJ, Crist C, et al. (2011) MicroRNA profiling during mouse ventricular maturation: a role for miR-27 modulating Mef2c expression. Cardiovasc Res 89: 98–108.A. ChinchillaE. LozanoH. DaimiFJ EstebanC. Crist2011MicroRNA profiling during mouse ventricular maturation: a role for miR-27 modulating Mef2c expression.Cardiovasc Res8998108
  57. 57. Kuzmin A, Han Z, Golding MC, Mann MR, Latham KE, et al. (2008) The PcG gene Sfmbt2 is paternally expressed in extraembryonic tissues. Gene Expr Patterns 8: 107–116.A. KuzminZ. HanMC GoldingMR MannKE Latham2008The PcG gene Sfmbt2 is paternally expressed in extraembryonic tissues.Gene Expr Patterns8107116
  58. 58. Bennett LB, Schnabel JL, Kelchen JM, Taylor KH, Guo J, et al. (2009) DNA hypermethylation accompanied by transcriptional repression in follicular lymphoma. Genes Chromosomes Cancer 48: 828–841.LB BennettJL SchnabelJM KelchenKH TaylorJ. Guo2009DNA hypermethylation accompanied by transcriptional repression in follicular lymphoma.Genes Chromosomes Cancer48828841
  59. 59. Saini HK, Enright AJ, Griffiths-Jones S (2008) Annotation of mammalian primary microRNAs. BMC Genomics 9: 564.HK SainiAJ EnrightS. Griffiths-Jones2008Annotation of mammalian primary microRNAs.BMC Genomics9564
  60. 60. Corcoran DL, Pandit KV, Gordon B, Bhattacharjee A, Kaminski N, et al. (2009) Features of mammalian microRNA promoters emerge from polymerase II chromatin immunoprecipitation data. PLoS One 4: e5279.DL CorcoranKV PanditB. GordonA. BhattacharjeeN. Kaminski2009Features of mammalian microRNA promoters emerge from polymerase II chromatin immunoprecipitation data.PLoS One4e5279
  61. 61. Cheloufi S, Dos Santos CO, Chong MM, Hannon GJ (2010) A dicer-independent miRNA biogenesis pathway that requires Ago catalysis. Nature 465: 584–589.S. CheloufiCO Dos SantosMM ChongGJ Hannon2010A dicer-independent miRNA biogenesis pathway that requires Ago catalysis.Nature465584589
  62. 62. Cenik ES, Zamore PD (2011) Argonaute proteins. Curr Biol 21: R446–449.ES CenikPD Zamore2011Argonaute proteins.Curr Biol21R446449
  63. 63. Czech B, Hannon GJ (2011) Small RNA sorting: matchmaking for Argonautes. Nat Rev Genet 12: 19–31.B. CzechGJ Hannon2011Small RNA sorting: matchmaking for Argonautes.Nat Rev Genet121931
  64. 64. Chatterjee S, Fasler M, Bussing I, Grosshans H (2011) Target-mediated protection of endogenous microRNAs in C. elegans. Dev Cell 20: 388–396.S. ChatterjeeM. FaslerI. BussingH. Grosshans2011Target-mediated protection of endogenous microRNAs in C. elegans.Dev Cell20388396
  65. 65. Arroyo JD, Chevillet JR, Kroh EM, Ruf IK, Pritchard CC, et al. (2011) Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A 108: 5003–5008.JD ArroyoJR ChevilletEM KrohIK RufCC Pritchard2011Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma.Proc Natl Acad Sci U S A10850035008
  66. 66. Turchinovich A, Weiz L, Langheinz A, Burwinkel B (2011) Characterization of extracellular circulating microRNA. Nucleic Acids Res 39: 7223–7233.A. TurchinovichL. WeizA. LangheinzB. Burwinkel2011Characterization of extracellular circulating microRNA.Nucleic Acids Res3972237233
  67. 67. Yang JS, Lai EC (2011) Alternative miRNA biogenesis pathways and the interpretation of core miRNA pathway mutants. Mol Cell 43: 892–903.JS YangEC Lai2011Alternative miRNA biogenesis pathways and the interpretation of core miRNA pathway mutants.Mol Cell43892903
  68. 68. Havens MA, Reich AA, Duelli DM, Hastings ML (2012) Biogenesis of mammalian microRNAs by a non-canonical processing pathway. Nucleic Acids Res. MA HavensAA ReichDM DuelliML Hastings2012Biogenesis of mammalian microRNAs by a non-canonical processing pathway.Nucleic Acids Res